ID: 1131393362

View in Genome Browser
Species Human (GRCh38)
Location 15:92067305-92067327
Sequence CACGGGAAGCAGAGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1078
Summary {0: 1, 1: 1, 2: 4, 3: 91, 4: 981}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131393362_1131393369 -6 Left 1131393362 15:92067305-92067327 CCCTCCTCCCTCTGCTTCCCGTG 0: 1
1: 1
2: 4
3: 91
4: 981
Right 1131393369 15:92067322-92067344 CCCGTGTGGTTTCTTCAGCCTGG 0: 1
1: 0
2: 0
3: 13
4: 130
1131393362_1131393376 27 Left 1131393362 15:92067305-92067327 CCCTCCTCCCTCTGCTTCCCGTG 0: 1
1: 1
2: 4
3: 91
4: 981
Right 1131393376 15:92067355-92067377 CCTCACCTCAGCCCTCACGTAGG 0: 1
1: 0
2: 2
3: 20
4: 235
1131393362_1131393371 -5 Left 1131393362 15:92067305-92067327 CCCTCCTCCCTCTGCTTCCCGTG 0: 1
1: 1
2: 4
3: 91
4: 981
Right 1131393371 15:92067323-92067345 CCGTGTGGTTTCTTCAGCCTGGG 0: 1
1: 0
2: 1
3: 12
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131393362 Original CRISPR CACGGGAAGCAGAGGGAGGA GGG (reversed) Intronic
900084076 1:878840-878862 CTCTGGAATCAGATGGAGGAAGG - Intergenic
900394232 1:2446567-2446589 CATTGGAGGCAGAGGGAGGAAGG + Intronic
900411087 1:2513020-2513042 CAGGTGAAGCAGCGGGAGAATGG - Exonic
900419139 1:2548032-2548054 CAGGGGGAGGGGAGGGAGGAGGG + Intergenic
900466705 1:2829168-2829190 CGCGGCAGGCAGATGGAGGATGG - Intergenic
900547125 1:3235434-3235456 TTCCGGAAGCAGAAGGAGGAAGG + Intronic
900565677 1:3330853-3330875 GGCTGGAGGCAGAGGGAGGAGGG - Intronic
900822402 1:4899665-4899687 CCTGGGAGGCAGAGTGAGGAGGG - Intergenic
900861040 1:5231581-5231603 CATAGGAAGCAGAAGGAAGAGGG + Intergenic
901269566 1:7941457-7941479 CATGGGTGACAGAGGGAGGAAGG + Intronic
901510921 1:9717692-9717714 GAGGGGTAGCAGAGGAAGGAGGG + Intronic
901703404 1:11057399-11057421 CTCGGGAGGCTGAGGCAGGAGGG - Intronic
901735194 1:11307985-11308007 GACAGGAGGCAGAGGGAAGAGGG - Intergenic
901740338 1:11338069-11338091 GAGGGGGAGGAGAGGGAGGAGGG - Intergenic
902076908 1:13794276-13794298 CACAGCAAGTAGAGGGATGAGGG - Intronic
902241635 1:15094087-15094109 CCCGGGAGGCAGAGGGTGGTGGG - Intronic
902249994 1:15148050-15148072 CACGGGAAGATGAGAGAGCATGG + Intergenic
902250967 1:15153974-15153996 CGCGGGAAGCAGCGGGCGCAAGG - Intronic
902315549 1:15616205-15616227 CTCGGGAGGCTGAGGCAGGAGGG - Intergenic
902774252 1:18664445-18664467 CTGGGGAAGGGGAGGGAGGAGGG + Intronic
902936613 1:19769319-19769341 CAAGGAGAGCAGAGAGAGGAGGG - Intronic
902959638 1:19953905-19953927 CAGGGGAATCAGATGGAGGGAGG + Intergenic
902974480 1:20079000-20079022 CTCGAGAGGCAGAGGCAGGAGGG + Intronic
903054997 1:20629722-20629744 TTTGGGAAGCTGAGGGAGGAAGG + Intergenic
903073287 1:20740013-20740035 CTCGGGAGGCTGAGGCAGGAGGG + Intergenic
903218951 1:21858277-21858299 CATGGGAATCAGAGGGAAAAGGG - Intronic
903674327 1:25054750-25054772 CATGGGGAGCAGGGGGAGCAGGG + Intergenic
903885299 1:26537486-26537508 CAGGGGAAGCAGAGATAGCAGGG - Intronic
904149304 1:28424297-28424319 CACAGGAGGCTGAGGCAGGAGGG - Intronic
904372443 1:30058412-30058434 CAGGGGAAGGGGAGGGAGGGTGG - Intergenic
904380398 1:30106923-30106945 CACGGGAGGCAGAGGTGGGAGGG - Intergenic
904545622 1:31268782-31268804 CACGGGATGCGGAGGCAGGTAGG + Intronic
904813291 1:33178146-33178168 CAGGAGAGGGAGAGGGAGGAAGG - Intronic
904974300 1:34444026-34444048 CAATGGAAGCAGAGAGTGGAGGG - Intergenic
905542094 1:38767939-38767961 CAAGGGAGGCAGAGGGAAGCTGG - Intergenic
905842058 1:41189562-41189584 CACCAGAAGAAGGGGGAGGAAGG + Intronic
906191793 1:43903655-43903677 CCCTGGGAGGAGAGGGAGGAGGG + Intronic
906653712 1:47533150-47533172 TGGGGGAAGAAGAGGGAGGATGG - Intergenic
906764803 1:48418856-48418878 GAGGGGAAGGAGAGGGAGGAAGG + Intronic
906819698 1:48916389-48916411 CACAGGGAGGAGAGGGAGGCGGG + Intronic
907222548 1:52917557-52917579 CATGGGTAGAGGAGGGAGGATGG + Intronic
907468472 1:54655476-54655498 CTCGGGAGGCTGAGGCAGGAGGG - Intronic
907523583 1:55040503-55040525 CATGGGCAGCGGAGGGTGGAGGG + Intronic
907716800 1:56933625-56933647 AAGGGGAAGCAGAGAGAAGATGG - Intronic
907865897 1:58398754-58398776 GACAGGAAGCAGAGGAAGGCTGG + Intronic
908287310 1:62621136-62621158 GAGAGGAAGAAGAGGGAGGAAGG + Intronic
908396840 1:63733026-63733048 CATGGGAAGCTCAGGGTGGAGGG + Intergenic
908947427 1:69516524-69516546 CACAAGAACCAGAGGCAGGAGGG - Intergenic
908983136 1:69983279-69983301 CATGGGAAGCTGAGGGAGCAGGG + Intronic
909072131 1:71007511-71007533 CCCTGGAAGCAAAGAGAGGAAGG - Intronic
909296364 1:73954286-73954308 GACGGGAGACAGAGGAAGGAAGG - Intergenic
910285184 1:85545775-85545797 GAGGAGATGCAGAGGGAGGAGGG + Intronic
910672132 1:89784060-89784082 CTCAGGAGGCAGAGGAAGGATGG + Intronic
911121283 1:94299742-94299764 TAAGGGAGCCAGAGGGAGGAAGG + Intergenic
911633795 1:100211877-100211899 CTCGGGAGGCTGAGGCAGGAGGG - Intronic
912928453 1:113933757-113933779 CTCGGGAGGCTGAGGTAGGAGGG + Intronic
913223401 1:116677636-116677658 GACGGGCAGCAGAAGGAGGAAGG - Intergenic
914232129 1:145772820-145772842 CATGGTAAGGAGAGGGAGAAAGG - Intronic
914238967 1:145838573-145838595 CTCGGGAGGCTGAGGCAGGAAGG + Intronic
914693943 1:150058399-150058421 CTCAGGAGGCTGAGGGAGGAGGG + Intergenic
914787558 1:150848634-150848656 CTCGGGAAGCTGAGGTGGGAGGG - Intronic
914802289 1:150970601-150970623 CTCGGGAGGCTGAGGCAGGAGGG - Intronic
915141760 1:153772446-153772468 CACTGGACGCCGAGGGTGGAAGG - Intronic
915342998 1:155186380-155186402 GAAGGAGAGCAGAGGGAGGAGGG - Intronic
915407583 1:155673121-155673143 CTCAGGAGGCAGTGGGAGGATGG - Intronic
915468540 1:156112557-156112579 CACCAGAAGCAGAGGCAGGAGGG - Intronic
915652901 1:157332211-157332233 CAGGGGAGGCAGAGGGAGACAGG - Intergenic
915716565 1:157950148-157950170 GAGGGGAAACAGAGGGAGGGAGG + Intergenic
915724307 1:158006972-158006994 CAGTGTAAGCAGAGAGAGGAGGG + Intronic
915734446 1:158075909-158075931 CATGGGTCTCAGAGGGAGGAAGG + Intronic
915736548 1:158088979-158089001 CACGGGAAGCAGGGTGGGGTGGG + Intronic
916237235 1:162602672-162602694 CCCGGGAAGCAGAGGTTGCAGGG - Intergenic
916303492 1:163302598-163302620 CAAGGGAGCCAGAGGTAGGAGGG - Intronic
916344764 1:163775336-163775358 CACGGGAGTCAGAGGGAGCTGGG + Intergenic
916606021 1:166343156-166343178 CAGGGGGAGCAGGGGGAGCAGGG + Intergenic
916897640 1:169182110-169182132 CTCTGGAAGCTGAGGCAGGAAGG - Intronic
916944826 1:169716000-169716022 CATGGGAGGCTGAGGGAGAAGGG - Intronic
917736809 1:177928985-177929007 CACTGGAGTGAGAGGGAGGAGGG - Intronic
917975833 1:180237089-180237111 CAGGGGAAGGAGAAGGAGGGAGG - Intronic
918612068 1:186504225-186504247 CAAGGGCAGTGGAGGGAGGAGGG + Intergenic
918807746 1:189071323-189071345 CAGGGGAAGCAAAGGGAGTAGGG + Intergenic
919583838 1:199410767-199410789 CAAGGGAAGGTGAGGGAGCAGGG - Intergenic
919781455 1:201223978-201224000 CACGGAAAGCAGAGAGAACAAGG - Intronic
919786684 1:201262533-201262555 GACGGGAAGGGGAGGGAAGAGGG - Intergenic
919854211 1:201694542-201694564 CCCTGGCTGCAGAGGGAGGAGGG + Intronic
920313577 1:205062380-205062402 CACAGGAGCCACAGGGAGGAGGG - Intronic
920578896 1:207086045-207086067 GAAGGGGAGCAGAGGGAGGCAGG + Intronic
920940836 1:210480728-210480750 AAAGGGAAGCAGAGGCTGGATGG - Intronic
921150443 1:212397726-212397748 AATGGGAAGCACAGGGAGAAGGG + Intronic
921223812 1:212996512-212996534 CTCGGGAAGCTGAGGTGGGAAGG + Intronic
921686790 1:218098499-218098521 CACGGTAAGCAGAAGTCGGAGGG - Intergenic
922170469 1:223150339-223150361 CTTGGGAAGCTGAGTGAGGAGGG - Intergenic
922572914 1:226644355-226644377 CACAGGACGCTGGGGGAGGAGGG + Intronic
922651339 1:227341601-227341623 AAGGAGAAGCAGAGGGATGAGGG + Intergenic
922656710 1:227391086-227391108 CCCGGGAAGCAGAGGTTGCAGGG + Intergenic
922671635 1:227512512-227512534 CTCTGGAACCAGATGGAGGAAGG - Intergenic
922883904 1:229003491-229003513 CAGGGGGAGGGGAGGGAGGAAGG + Intergenic
922888117 1:229036242-229036264 CAGGGGAATCAGAGGAGGGAAGG - Intergenic
923037214 1:230292638-230292660 CAAGAGAAGGAGAGAGAGGAAGG - Intergenic
923207625 1:231774144-231774166 CTCGGGAGGCTGAGGCAGGAAGG + Intronic
923321923 1:232842785-232842807 CAAAGGAAACAGATGGAGGATGG + Intergenic
923669587 1:236029067-236029089 CTTGGGAAGCTGAGGCAGGAGGG + Intronic
924244075 1:242064459-242064481 CTCTGGAACCAGATGGAGGAAGG - Intergenic
924255724 1:242180873-242180895 CTTGGGAAGCTGAGGCAGGAGGG + Intronic
924306329 1:242692720-242692742 CTCGGGAGGCTGAGGCAGGAGGG - Intergenic
924385300 1:243493873-243493895 AACTGGAAGCAAAGGGAGAAGGG + Intronic
1062763170 10:43096-43118 CTCTGGAATCAGATGGAGGAAGG + Intergenic
1063612804 10:7577016-7577038 CAGTGGAAGCACAGGGAGGGAGG + Intronic
1063938942 10:11107803-11107825 AGGGGGAAGAAGAGGGAGGAGGG - Intronic
1063989557 10:11545231-11545253 CACTGGAGGCTGAGGGAGGGTGG - Intronic
1064066668 10:12188029-12188051 CTCAGGAAGCTGAGGCAGGAGGG + Intronic
1065834626 10:29645460-29645482 CTCGGGAGGCTGAGGCAGGAGGG + Intronic
1065857984 10:29845892-29845914 CTGGGGAGGCAGAGGCAGGAGGG - Intergenic
1066818845 10:39456609-39456631 CACGGGAGCCAGAGGCAGGGAGG + Intergenic
1067091362 10:43267124-43267146 CGCGGGACGCGGAGGGAGGAGGG + Intergenic
1067438128 10:46292990-46293012 GACGGAGAGGAGAGGGAGGAGGG + Intronic
1067748197 10:48952348-48952370 CACTGTAATCAGAGGGAGGCTGG - Intronic
1067748786 10:48956513-48956535 AGCAAGAAGCAGAGGGAGGAGGG - Intronic
1068164694 10:53313604-53313626 CTCGGGAGGCTGTGGGAGGATGG + Intergenic
1068707378 10:60091836-60091858 CTCGGGAGGCTGAGGCAGGAGGG - Intronic
1068967711 10:62929433-62929455 CACGGGAACCCGAGGCAGGGAGG + Intergenic
1069550468 10:69360567-69360589 CACAGAAAGCAGAGGAAGCAGGG + Intronic
1069711956 10:70495336-70495358 CAAGAGAAGGAGAGGGAGGGAGG - Intronic
1069844940 10:71364492-71364514 CACGGGAATCAGAGAGAGAAAGG + Intergenic
1070098438 10:73361398-73361420 CACGGGAGGCTGAGGTGGGAGGG - Intergenic
1070509507 10:77147628-77147650 TACGGGAAGAAGAGGGAGATTGG - Intronic
1070725964 10:78790795-78790817 CATGGGAGGCTGAGGCAGGAGGG - Intergenic
1070836794 10:79452528-79452550 CAAGGGAAGCTGAGTGAGAAGGG - Intergenic
1071295768 10:84218124-84218146 CAAGGGATGGAGAGGGAGAATGG + Intronic
1071930036 10:90458679-90458701 CACAGGAATAAGAGTGAGGACGG - Intergenic
1072124223 10:92431292-92431314 GAAGGGAAGGAGAGGAAGGAAGG - Intergenic
1072228634 10:93393786-93393808 GATGAGAAGCAGAAGGAGGAAGG - Intronic
1072306092 10:94108636-94108658 CAGGGGAAGCAGGGGGTGGAGGG - Intronic
1072687541 10:97547388-97547410 CTGGGGCAGAAGAGGGAGGATGG - Intronic
1072740669 10:97907236-97907258 CACGGGCAGCAGGAGGAGGAAGG + Intronic
1072917237 10:99545556-99545578 GAGGGGGAGCAGTGGGAGGAGGG + Intergenic
1073062696 10:100741949-100741971 CCCGGGAAGTGGAAGGAGGAAGG + Intronic
1073091173 10:100940941-100940963 CTCAGGAAGCTGAGGCAGGAGGG - Intronic
1073344551 10:102772675-102772697 CTCGGGAAGCTGAGGTGGGAGGG - Intronic
1074509737 10:114101295-114101317 CAAAGGATGCAGAGCGAGGAGGG - Intergenic
1074609173 10:115004541-115004563 GAAGGGAAGGAGAGGGAGAAGGG - Intergenic
1074735285 10:116424973-116424995 CACGGGATGGGGTGGGAGGATGG - Intergenic
1074969993 10:118528286-118528308 CTTGGGAAGCTGAGGCAGGAGGG - Intergenic
1075076303 10:119352935-119352957 CAGGGGAGAGAGAGGGAGGACGG - Intronic
1075236753 10:120737425-120737447 CACGGGCAGCAGAGGTGGGATGG - Intergenic
1075559518 10:123458441-123458463 GAAGGGAGGCAGAGAGAGGAGGG - Intergenic
1075667671 10:124242674-124242696 CAGGGGAAACAGAGGGGGAAGGG + Intergenic
1075687061 10:124371555-124371577 CCCAGGAAGCACAGGGAAGATGG + Intergenic
1075714495 10:124548241-124548263 CACAGGAGGCAGAGGCAGCATGG - Intronic
1075981810 10:126746797-126746819 GACTGGAATCAGAGGGAGGGAGG + Intergenic
1076236692 10:128869036-128869058 CTCGGGAAGCTGAGGAAGGAGGG - Intergenic
1076369862 10:129945221-129945243 GAAAGGAAGCAGAGGGAGGGAGG + Intronic
1076393081 10:130118451-130118473 CTCGGGAGGCTGAGGCAGGAGGG + Intergenic
1076667676 10:132102402-132102424 CATGGGGTACAGAGGGAGGAAGG - Intergenic
1076805021 10:132851181-132851203 CACGGGCAGCAGAGTGAGCAGGG - Exonic
1076992537 11:282945-282967 CACACAGAGCAGAGGGAGGAGGG + Intronic
1077040825 11:521414-521436 CTCGGGAGGCTGAGGCAGGAGGG - Intergenic
1077155486 11:1089148-1089170 CTGGGGAGGCAGAGGGAGGCCGG - Intergenic
1077164419 11:1128771-1128793 CACGGGAGGCACATGGAGGTCGG - Intergenic
1077219963 11:1411462-1411484 CTTGGGGAGCAGAGGGAGGAAGG - Exonic
1078495574 11:11813102-11813124 CCCGGGAGGCAGAGGTAGCAGGG + Intergenic
1079107018 11:17578291-17578313 CAGGGGCAGCAGCTGGAGGATGG - Intronic
1079318142 11:19427338-19427360 AAAGGGAAGCAGAAGGAAGAAGG - Intronic
1079601377 11:22316158-22316180 CAGGGGAGACAGAGGCAGGAGGG - Intergenic
1080478364 11:32619857-32619879 GAAGGGAAGGAGAAGGAGGAGGG + Intronic
1081737836 11:45416717-45416739 CATGGGGAAGAGAGGGAGGAAGG - Intergenic
1082099710 11:48162392-48162414 AAAGGGAGGGAGAGGGAGGAGGG - Intronic
1082740064 11:56900964-56900986 CCTGTGAAGCAGAGGGAGCAAGG + Intergenic
1083052281 11:59788004-59788026 CGTGGGAAGCAGGAGGAGGATGG - Intronic
1083593628 11:63908938-63908960 CACGTGAAGCGGAGGGAGCGGGG - Exonic
1084164003 11:67366751-67366773 CAGGGAAAGAAAAGGGAGGAGGG - Intronic
1084633208 11:70370336-70370358 CACGGCAAGCAGAAGGAACAAGG - Intronic
1084938281 11:72598940-72598962 CCCGGGAAGGAGAGGGACGTAGG + Intronic
1085071193 11:73547552-73547574 CTTGGGATGCAGAGGCAGGAGGG + Intronic
1085177669 11:74505040-74505062 GACAGGAAGCAGGGAGAGGAGGG + Intronic
1085291995 11:75407574-75407596 CTCGGGAGGCTGAGGTAGGATGG - Intronic
1085473178 11:76771220-76771242 GACAGAAAGCAGAGGGTGGAAGG - Intergenic
1085510697 11:77086704-77086726 CAGGGGATGGAGTGGGAGGAGGG - Intronic
1085633155 11:78136427-78136449 TTCGGGAGGCTGAGGGAGGAAGG + Intronic
1085919714 11:80938178-80938200 CAGGGGAATCAGTGAGAGGAGGG - Intergenic
1085923611 11:80988681-80988703 CAGGGGAAGGAGTGGGAGGGAGG + Intergenic
1086900139 11:92358063-92358085 CTCAGGAAGCTGAGGCAGGAAGG + Intronic
1087194305 11:95289882-95289904 CACTGGAGGTAGAGGGAGCAGGG - Intergenic
1087360958 11:97158733-97158755 GGCGGGAGGCAGAGGGAGGGGGG - Intergenic
1088644312 11:111904543-111904565 CTTGGGAAGCTGAGGCAGGAAGG + Intergenic
1088986613 11:114914746-114914768 CTTGGGAAGCAGAGAGATGAAGG - Intergenic
1089177846 11:116561213-116561235 CCCTGGAGGTAGAGGGAGGATGG - Intergenic
1089356639 11:117858241-117858263 GACGGGAAGCAGAAAAAGGAGGG - Intronic
1089396253 11:118137863-118137885 CACGGAGAGCTCAGGGAGGAAGG - Intronic
1089457231 11:118632721-118632743 CAAGGGAAGCAGAGGCCCGAGGG - Intronic
1089665737 11:120017493-120017515 GATGGGAAGCTGAGGCAGGATGG - Intergenic
1089702884 11:120255863-120255885 CAAGGTCACCAGAGGGAGGAAGG - Intronic
1089959089 11:122599835-122599857 CAGGGAAAGCAGAATGAGGAAGG - Intergenic
1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG + Intergenic
1090346027 11:126071512-126071534 CAACTGAAGCAGAGGAAGGAAGG + Intergenic
1090622450 11:128572993-128573015 TACAGGAAGCACAAGGAGGAGGG + Intronic
1090998082 11:131885157-131885179 CCCGGGAAGCAGAGAGGGTAGGG + Intronic
1091534362 12:1391591-1391613 CAGGGAAAGCCGAGGGAGGCAGG - Intronic
1091691723 12:2601761-2601783 CAAGGGATGCTGTGGGAGGAAGG + Intronic
1091721998 12:2820565-2820587 CAAGGGTAGCAGCAGGAGGAAGG - Intronic
1091748086 12:3005399-3005421 CTCAGGAAGCTGAGGCAGGAGGG - Intronic
1091960689 12:4691718-4691740 CCCTGGAAGCAGAGGGTGGTGGG + Exonic
1092542143 12:9426657-9426679 CATGGGAAGAAGAGGGGAGAAGG + Intergenic
1092906771 12:13107460-13107482 TATGAGAAGCTGAGGGAGGATGG + Intronic
1094510869 12:31095776-31095798 CATGGGAAGAAGAGGGGAGAAGG - Intronic
1095549437 12:43416626-43416648 CTCGGGAGGCTGAGGGAGAATGG - Intronic
1095878445 12:47106867-47106889 CCCCGGAAGCAGAGGAAGCAAGG - Intronic
1095943652 12:47741405-47741427 CCCAGGGAGAAGAGGGAGGAGGG - Intronic
1096016365 12:48279516-48279538 AAAGAGAGGCAGAGGGAGGATGG - Intergenic
1096154601 12:49334986-49335008 CACAGGCTGCAGAGGGAGGTTGG - Intronic
1096604939 12:52757933-52757955 GAGGGGCAGGAGAGGGAGGAGGG - Intergenic
1096699090 12:53370631-53370653 CCCGGGAGGCAGAGGTAGCAAGG + Intergenic
1096748646 12:53744893-53744915 CAGGGGAAGCAGAGAGAGAATGG - Intergenic
1097824720 12:64163230-64163252 CTCGGGAAGCTGAGACAGGAGGG + Intergenic
1098006579 12:66003716-66003738 GGGGGGAAGCAGAGGGAGGTGGG - Intergenic
1098011922 12:66062186-66062208 CACAGGAAACATAGGAAGGAGGG + Intergenic
1098081508 12:66790887-66790909 AAGGGGAAGGAGCGGGAGGAAGG + Intronic
1098357379 12:69624424-69624446 CTCGGGAGGCTGAGGCAGGAGGG - Intergenic
1098493699 12:71111231-71111253 CACGGGGTGCATATGGAGGAGGG + Intronic
1098844311 12:75517174-75517196 CACGGTAACCAGAGGGTAGAGGG + Intergenic
1098904889 12:76151664-76151686 CCTGGGAGGCAGAGGGAGGTTGG + Intergenic
1099248045 12:80217299-80217321 GATGGGAAGGGGAGGGAGGATGG + Intronic
1099304605 12:80937782-80937804 GACGGAAAGGAGGGGGAGGAGGG + Exonic
1099903092 12:88736811-88736833 CTCGGGAAGCTGAGGCAGAATGG - Intergenic
1100550689 12:95644204-95644226 GAGGGGAAGGAGGGGGAGGAGGG - Intergenic
1100635382 12:96430553-96430575 CTTGGGAGGCTGAGGGAGGAGGG + Intergenic
1100784427 12:98064150-98064172 CACAGGAAACAGAGAGAGAAGGG + Intergenic
1100844414 12:98644622-98644644 CCCGGGAAGCGGAGCGAGGGCGG - Exonic
1101763318 12:107676959-107676981 CATGAGAAGCAGAGGAAGGATGG - Intergenic
1102147321 12:110664160-110664182 CTCGGGAAGCTGAGGCTGGAAGG - Intronic
1102531147 12:113547428-113547450 AGAGGGAGGCAGAGGGAGGAGGG + Intergenic
1102596647 12:113998043-113998065 CTTGGGAGGCAGAGGCAGGAGGG - Intergenic
1102650779 12:114440872-114440894 CACGGAAAGCAGAAGGCGGAAGG + Intergenic
1102709878 12:114916547-114916569 GAGGGGAAGAAGAAGGAGGAAGG - Intergenic
1102943752 12:116966824-116966846 CTCGGGAGGCTGAGGCAGGAAGG - Intronic
1102972719 12:117182983-117183005 CTCGGGAGGCTGAGGCAGGAGGG + Intronic
1103152040 12:118649191-118649213 GGCGGGAAGCAGGGAGAGGATGG + Intergenic
1103270568 12:119669679-119669701 CTCGGGAGGCTGAGGCAGGATGG - Intronic
1103851560 12:123936920-123936942 CAAGAGAAGCAGAAGGAGAATGG + Exonic
1104369866 12:128215089-128215111 CAACGGAAGCAGAGGTGGGAGGG + Intergenic
1104574822 12:129957459-129957481 CCCGGGAAGCAGCAGGCGGAAGG + Intergenic
1104579189 12:129997297-129997319 CAGAGGTAGCAGAGGAAGGAAGG + Intergenic
1104589238 12:130070988-130071010 CACGGGAGGCAGAGGTTGCAGGG - Intergenic
1104713587 12:131002820-131002842 CTCGTGAAGCACAGGGAGGTAGG + Intronic
1105005787 12:132719758-132719780 CTCGGGAAGCAGCGTGAGGGTGG + Intronic
1105510140 13:21044835-21044857 CATGGGATGCTGAGGCAGGAGGG - Intronic
1105581075 13:21697254-21697276 CACAGGAGGCTGAGGCAGGAAGG - Intronic
1105938427 13:25123992-25124014 CACGGGAGGCTGAGGTAGGAGGG + Intergenic
1106633126 13:31498056-31498078 GACAGGAGGCAGAGGGAGCAAGG + Intergenic
1107510217 13:41076176-41076198 AACAGGAAGCAGAAGAAGGAGGG + Exonic
1108320363 13:49283657-49283679 CAAGAGAAGCAGAAGGAGGCAGG + Intronic
1108447947 13:50527967-50527989 AACTGGAAGCTGGGGGAGGATGG + Intronic
1108853832 13:54768883-54768905 CAAGGGAAGGGAAGGGAGGAAGG - Intergenic
1109217450 13:59605725-59605747 AACGAGAAGAAGAGGGAGGGAGG + Intergenic
1110439372 13:75510028-75510050 CTCGGGAGGCTGAGGCAGGAGGG - Intergenic
1110568846 13:76982798-76982820 CTCGGGAAGCTGAGGCAGGGAGG + Intergenic
1110589324 13:77236788-77236810 CTCGGGAGGCTGAGGCAGGAGGG + Intronic
1110637552 13:77783395-77783417 GAGGAGAAGGAGAGGGAGGAGGG + Intergenic
1111785533 13:92782071-92782093 AACGGGAAGGGGAGGGAGAAAGG + Intronic
1112034848 13:95487780-95487802 CTCGGGAAGCTGAGGTGGGAGGG - Intronic
1112248771 13:97758626-97758648 CTCGGGAGGCTGAGGCAGGAGGG + Intergenic
1113618497 13:111697375-111697397 GAAGGGAGGCAGAGAGAGGAAGG - Intergenic
1113624026 13:111782636-111782658 GAAGGGAGGCAGAGAGAGGAAGG - Intergenic
1113754778 13:112803810-112803832 GAGGGGAAGGAGAGGAAGGAGGG - Intronic
1113821974 13:113221111-113221133 CACCAGAAGCAGAGCGTGGAGGG + Intronic
1114370130 14:22077342-22077364 CACTGGAATCTGAGGGAAGAAGG + Intergenic
1114444039 14:22774320-22774342 CAGGTGGAGCAGAGGTAGGATGG + Intronic
1114630400 14:24155846-24155868 AAAGGGAAGCAGAGGGAGGGAGG + Intronic
1114693697 14:24607751-24607773 CACAGAGAGCAGAGTGAGGATGG + Intronic
1114696641 14:24632463-24632485 CACAGAGAGCAGAGTGAGGATGG + Intronic
1115657990 14:35462538-35462560 GAGGGGAAGGGGAGGGAGGAAGG - Intergenic
1116277894 14:42860215-42860237 CAGAGGATGCAGAGGGAAGAGGG + Intergenic
1116336606 14:43665565-43665587 CACCTGTAGCAGAGGGAGCATGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117754899 14:58964737-58964759 GGCGACAAGCAGAGGGAGGAGGG - Intergenic
1117942611 14:60984308-60984330 CACTGGAAGTAGAGGGAGGAAGG + Intronic
1118029558 14:61807247-61807269 CTCGGGAAGCTGAGGCAGGCAGG - Intergenic
1118597688 14:67448780-67448802 GACTGGAAACAGAGGGAGTAGGG + Intronic
1118737362 14:68711621-68711643 CAGGGCAAGCAGATGGGGGAAGG - Intronic
1118860437 14:69658815-69658837 CAGGGAGAGCAGAGGGTGGAGGG + Intronic
1118877836 14:69799376-69799398 AATGGGAAGGAGTGGGAGGAGGG - Intergenic
1119205498 14:72790943-72790965 CACCAGGAGCAGAGGGAAGAGGG - Intronic
1119534960 14:75395571-75395593 CCCTGGAAGCAAAGGGAGAAGGG - Intergenic
1119719694 14:76882706-76882728 CAGGGGAAGCAGAAGCAGGCAGG - Intergenic
1119757873 14:77131550-77131572 AATGGGAGGGAGAGGGAGGAGGG - Exonic
1119767686 14:77200628-77200650 CAGGGGCAGCAGAGCCAGGATGG - Intronic
1119901025 14:78259886-78259908 AACGGGGAGCCTAGGGAGGAGGG + Intronic
1120649557 14:87115421-87115443 CAGGGAAAGCAGAGGGAAAAGGG - Intergenic
1120680681 14:87477412-87477434 AGCAGGAAGCAGAGAGAGGAGGG + Intergenic
1120802839 14:88711835-88711857 CCTGGGAAGCTGAGGCAGGAGGG + Intronic
1121317925 14:92973326-92973348 CACTGGAAACAAAAGGAGGAGGG + Intronic
1121409268 14:93737969-93737991 CAGGGGATGCTGAGGGAGGAAGG + Intronic
1121432867 14:93899860-93899882 CTAGGGAGGGAGAGGGAGGAGGG + Intergenic
1121441425 14:93952077-93952099 GACTGGCAGCAGGGGGAGGAGGG + Intronic
1121468206 14:94129400-94129422 GAAGGGAAGGGGAGGGAGGAAGG + Intronic
1121637084 14:95461295-95461317 CACGGGAAGCAGCGGGGGTGAGG + Intronic
1121747936 14:96316165-96316187 TACGGGAAGGAGAGAGCGGAAGG + Intronic
1122221007 14:100239139-100239161 GAAGGAAGGCAGAGGGAGGAAGG - Exonic
1122251544 14:100443466-100443488 CACGGAAAGCAGAGAATGGAGGG - Intronic
1122697294 14:103562364-103562386 CGGGGGAAGCCGGGGGAGGAGGG + Intronic
1122877048 14:104672428-104672450 TTTGGGAAGCAGAGGAAGGAGGG + Intergenic
1123115279 14:105891637-105891659 CAGCGGAAGCAGAGAGAGCAGGG - Intergenic
1123117449 14:105901080-105901102 CAGCGGAAGCAGAGAGAGCAGGG - Intergenic
1123414960 15:20088702-20088724 CCCGGGAAGCAGAGGTTGCAGGG - Intergenic
1123524302 15:21095816-21095838 CCCGGGAAGCAGAGGTTGCAGGG - Intergenic
1124025731 15:25963951-25963973 CTCGGGAGGCTGAGGTAGGAGGG - Intergenic
1124045803 15:26148815-26148837 CATGGGAAGCAGAAGAGGGAAGG - Intergenic
1124849364 15:33321429-33321451 CATGGAAAGCAGAGGGAAAAAGG - Intronic
1126142052 15:45446854-45446876 GACGGGAAGGACAGGAAGGACGG - Intronic
1126142501 15:45449771-45449793 GAGGGGAAGGGGAGGGAGGAGGG + Intergenic
1126497608 15:49309694-49309716 CCCGGGAAGCAGAGGTTGCAGGG - Intronic
1126791681 15:52227300-52227322 CTCGGGAGGCTGAGGCAGGAGGG - Intronic
1127119227 15:55757035-55757057 CAGAGGAAGAACAGGGAGGAAGG + Intergenic
1127386076 15:58468253-58468275 CTGGGGAAGCAGAGAGAGCAAGG - Intronic
1127633547 15:60848373-60848395 TAAGGGAAAAAGAGGGAGGAAGG + Intronic
1127758699 15:62117158-62117180 CTCGGGAAGCTGAGGCAGGCGGG - Intergenic
1128270559 15:66305630-66305652 CTCGGGAGGCTGAGGCAGGAGGG - Intronic
1128585431 15:68845367-68845389 CACGGGATGCAGGTGGAGGGAGG - Intronic
1128686681 15:69691525-69691547 CATGTGAACCAGAGAGAGGATGG + Intergenic
1129048923 15:72761804-72761826 CTCGGGAGGCTGAGGCAGGAGGG - Intronic
1129252824 15:74318287-74318309 CAAGGGCAGGTGAGGGAGGAGGG + Intronic
1129597130 15:76973928-76973950 CACAGTAAGTAGTGGGAGGATGG + Intergenic
1129824928 15:78628668-78628690 CCTGGGAAGCACAGTGAGGAAGG - Intronic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1130339029 15:82983695-82983717 CTCGGGAAGCTGAGGCAGGGAGG - Intronic
1130616840 15:85418181-85418203 CTCGGGAGGCTGAGGCAGGAGGG - Intronic
1130838200 15:87672487-87672509 CAGGGGGAGCAGAGGATGGAAGG + Intergenic
1131040922 15:89266102-89266124 CTTGGGAAGCAGAGGCTGGAGGG - Intronic
1131119794 15:89814966-89814988 CCCGGGAAGCCGCGGGCGGACGG - Intronic
1131393362 15:92067305-92067327 CACGGGAAGCAGAGGGAGGAGGG - Intronic
1131679922 15:94710569-94710591 CTCAGGAAGCTGAGGCAGGAAGG - Intergenic
1131791459 15:95970209-95970231 AAAGGGAAGGAAAGGGAGGAGGG + Intergenic
1131897036 15:97044875-97044897 CATGGGAAGCTGAGGTGGGAGGG + Intergenic
1131983387 15:98017408-98017430 CAGAGGGAGCAGGGGGAGGATGG - Intergenic
1132406290 15:101543381-101543403 CAAGGGAAGCGGAAGGAGGAAGG - Intergenic
1132537335 16:489025-489047 CACGGGAAGAAGAGGGAGGAGGG - Intronic
1132606354 16:795397-795419 CACGGGCAGCACAGGGGGGCGGG - Intronic
1132606429 16:795581-795603 CACGGGCAGCACAGGGGGGCGGG - Intronic
1132612944 16:826528-826550 CCCGGGAAGCAGAGGTTGTAGGG + Intergenic
1132694061 16:1194380-1194402 CCAGGGAACCAGAGGAAGGAGGG - Intronic
1132724971 16:1334471-1334493 GTCGGTGAGCAGAGGGAGGAGGG + Intronic
1132812942 16:1810434-1810456 CACAGCAAGCACGGGGAGGAGGG + Intronic
1132833478 16:1941171-1941193 TGGGGCAAGCAGAGGGAGGAAGG + Intronic
1132855897 16:2044403-2044425 GCGGGGAAGCAGAGGAAGGAAGG + Intronic
1133302812 16:4793169-4793191 GCCTGGAAGCAGAGGGTGGAGGG + Intronic
1133405746 16:5523176-5523198 CTCGGGAGGCTGAGGCAGGAGGG + Intergenic
1133497794 16:6336301-6336323 CACGGGAGGCTGAGGCAGAATGG - Intronic
1133526597 16:6611774-6611796 CTTGGGAAGCAGAGAGAGAAGGG - Intronic
1133720364 16:8488966-8488988 GGGGGGAGGCAGAGGGAGGAAGG + Intergenic
1133820528 16:9232287-9232309 AAAGGGAGGGAGAGGGAGGAGGG - Intergenic
1133853202 16:9525306-9525328 CACAGCAACCTGAGGGAGGAAGG - Intergenic
1134085570 16:11355213-11355235 CAGGTGAAGCAGGAGGAGGAAGG + Intergenic
1134126476 16:11619672-11619694 CTCAGGAAGCTGAGGCAGGATGG - Intronic
1134255742 16:12609980-12610002 CTTGGGAGGCTGAGGGAGGATGG - Intergenic
1134303275 16:13010068-13010090 CTCGGGAGGCTGAGGCAGGAAGG + Intronic
1135803241 16:25518575-25518597 CTCAGGAAGCTGAGGCAGGAGGG + Intergenic
1135894440 16:26386138-26386160 CAGGGAAAGCAGAGTGAGGCTGG - Intergenic
1135913868 16:26586032-26586054 CATGGGAAGCAAGGGGAAGAGGG - Intergenic
1135920023 16:26641541-26641563 CAGGGGAGGGAGATGGAGGATGG - Intergenic
1135980099 16:27140657-27140679 CACGGGGAGAAGTGGGAGAAGGG - Intergenic
1137236560 16:46623215-46623237 GGGGGGAAGCAGAGGGAGGTGGG - Intergenic
1137385682 16:48040633-48040655 CCCGGGAGGCTGAGGCAGGAGGG - Intergenic
1137715856 16:50597976-50597998 CACTGGCAGTAGAGGGAGGAGGG + Intronic
1137884396 16:52086926-52086948 CACTAGAAGCAGAAGGAGGAGGG + Intergenic
1137963773 16:52911231-52911253 TAAAGGAAGCAGAGGGAGGGAGG - Intergenic
1138315464 16:56065923-56065945 CACAGGGAGCAGAGGGATGAAGG - Intergenic
1138689906 16:58757561-58757583 CTCAGGAAGCTGAGGTAGGAGGG - Intergenic
1139018919 16:62724496-62724518 CACAGGAGGCTGAGGTAGGAGGG + Intergenic
1139308826 16:66011196-66011218 CCCAGGAAACAGAGGGAGCATGG - Intergenic
1139310364 16:66023376-66023398 CACAGGCAGCCGAGGGAGGAAGG + Intergenic
1139800936 16:69522161-69522183 TAGGTGAAGAAGAGGGAGGAGGG + Intergenic
1139847314 16:69930100-69930122 CACGGGAAGAAAAGGGTGAAGGG - Intronic
1139924531 16:70478866-70478888 AACAGGAAGCAGAGAGGGGAAGG + Intronic
1140254351 16:73322125-73322147 CTCGGAGAGCAGAGGGAGGAAGG + Intergenic
1140734208 16:77883765-77883787 CATCGGATGAAGAGGGAGGAGGG - Intronic
1140874397 16:79137680-79137702 CGGGGGAAGGAGACGGAGGAGGG - Intronic
1141278360 16:82608063-82608085 GACCGGAAGCAGAGAGGGGAGGG + Intergenic
1141471509 16:84241702-84241724 CACGGGAGTCAGTGGAAGGAGGG - Intergenic
1141498404 16:84426227-84426249 CAGGGGCAGGAGAGGGAGGAAGG + Intronic
1141506561 16:84482103-84482125 CACAGGAAGCAGGGGGAAGCGGG - Intronic
1141757035 16:85998143-85998165 CAGGGGTGGCAGAGGGAGGAGGG - Intergenic
1141774773 16:86115974-86115996 CCTGCAAAGCAGAGGGAGGATGG - Intergenic
1141844970 16:86602190-86602212 CTCGGGAGGCTGAGGCAGGATGG - Intergenic
1141863046 16:86731013-86731035 CACTGGCTGCAGCGGGAGGATGG + Intergenic
1141911581 16:87063228-87063250 CTCGGGAGGCTGAGGCAGGAGGG - Intergenic
1142216341 16:88831803-88831825 CACGGGGAGCGTGGGGAGGAGGG + Intronic
1142273693 16:89104601-89104623 CAGGAGAAGCAGAGGGAAGGTGG - Intronic
1142655983 17:1394496-1394518 CTAGGGAAGCTGAGGCAGGAGGG + Intronic
1142889271 17:2932423-2932445 CAGGGAGAGGAGAGGGAGGAAGG + Intronic
1144044135 17:11439716-11439738 AAAGGGAAGAAGAGGGTGGAAGG - Intronic
1144708515 17:17385459-17385481 CAGGGGCTGCAGAGGGGGGATGG - Intergenic
1144740891 17:17581693-17581715 CACAGGAGGGAGAGGGGGGAGGG - Intronic
1144763048 17:17718127-17718149 CAGGGGAAGCAGGGGGAGAGGGG - Intronic
1146057095 17:29586963-29586985 GCCCGGGAGCAGAGGGAGGATGG + Intronic
1146099112 17:29961694-29961716 CTTGGGAAGCTGAGGTAGGAGGG - Intronic
1146116812 17:30147885-30147907 CCCGGGAAGCAGAGGTTGCAGGG - Intronic
1146376149 17:32295893-32295915 CACAGGTAGTATAGGGAGGAAGG + Intronic
1146507317 17:33416598-33416620 CAGTGGCAGCTGAGGGAGGATGG + Intronic
1146662676 17:34675028-34675050 CATGTGCAGCAGAGTGAGGAGGG - Intergenic
1147017749 17:37506155-37506177 CTCGGGAGGCTGAGGCAGGAGGG + Intronic
1147165744 17:38592281-38592303 GATCGGAAGCTGAGGGAGGAGGG + Intronic
1147356033 17:39897485-39897507 TTCAGAAAGCAGAGGGAGGAGGG + Intergenic
1147461619 17:40575654-40575676 CTCGGGAGGCTGAGGTAGGAGGG - Intergenic
1147596765 17:41722889-41722911 CACTGGCAGAAGAGGGAGGGAGG + Exonic
1147743321 17:42680802-42680824 AGCTGGAAGCAGAGGTAGGAGGG - Intronic
1147960018 17:44161679-44161701 CAAGGGGAGCAGAGGGAAGATGG + Intronic
1148127193 17:45242942-45242964 CAGGGGAAGCACAGGGAGCCTGG - Intronic
1148145555 17:45362426-45362448 CCCGGGTGGCTGAGGGAGGAGGG - Intergenic
1148208089 17:45792120-45792142 CACGGGCAGCTGAGGGATGCCGG - Intronic
1148376229 17:47149001-47149023 CTCGGGAAGCAGAGGTTGCAGGG + Intronic
1148525362 17:48327731-48327753 CTTGGGAGGCTGAGGGAGGACGG - Intronic
1148694223 17:49549421-49549443 CAGGGCAGGCAGAGGGAGAAAGG + Intergenic
1149032935 17:52104304-52104326 CTCGGGAGGCTGAGGTAGGAGGG - Intronic
1149393255 17:56213521-56213543 CAAGGAAAACAGAGGGAGGCAGG + Intronic
1149464988 17:56871036-56871058 CTCGGGAGGCTGATGGAGGAGGG + Intergenic
1149939019 17:60843290-60843312 CACGGGAAGCAGAGGTTGCAGGG - Intronic
1150055391 17:62010112-62010134 CTCGGGAGGCTGAGGCAGGAGGG + Intronic
1150135268 17:62691962-62691984 CACAGTAACCAGAGGTAGGATGG + Intronic
1150135446 17:62692713-62692735 CACAGGAACCAGAGGTAGGATGG + Exonic
1150397519 17:64832864-64832886 CTCGGGAGGCTGAGGGAGAATGG + Intergenic
1150786259 17:68165371-68165393 GAAGGGAAGGGGAGGGAGGAGGG + Intergenic
1151084438 17:71364457-71364479 CACAGTAAGGAGAGGGAGGAGGG - Intergenic
1151200239 17:72462617-72462639 CACGAGGAGGAGAGGGAGGCTGG - Intergenic
1151226250 17:72650474-72650496 CACAGGAAACAGAGGCATGAGGG + Intronic
1151266436 17:72959569-72959591 GAAGGGTGGCAGAGGGAGGAGGG + Intronic
1151309014 17:73282176-73282198 CAAGGGAAGAAGAGAGAGGGAGG - Intergenic
1151370820 17:73645158-73645180 CCCGGGAAGCGGAGGGCGGCGGG - Intergenic
1151818182 17:76481844-76481866 CTCGGGAGGCTGAGGCAGGATGG + Intronic
1151918752 17:77138502-77138524 CTCGGGAGGCTGAGGCAGGAGGG + Intronic
1152105043 17:78323923-78323945 CACAGGAAGGAGAGAGAAGAGGG - Intergenic
1152126412 17:78450017-78450039 CAGGGGAAGAGCAGGGAGGAGGG + Intronic
1152209976 17:78997908-78997930 CGTGGGAAGCTGAGTGAGGAAGG + Exonic
1152303480 17:79508493-79508515 TGCGGGGAGCAGAGAGAGGAGGG - Intronic
1152657869 17:81528317-81528339 CGCGGGCAGCAGAGGGCGGGCGG - Intergenic
1152780101 17:82223618-82223640 CTCGGGAGGCTGAGGCAGGAGGG - Intergenic
1152956079 18:43427-43449 CTCTGGAATCAGATGGAGGAAGG + Intergenic
1153118415 18:1689801-1689823 CAGGGAAAGCAGAGGAAGAAGGG + Intergenic
1153469754 18:5430669-5430691 CTCAGGAGGCTGAGGGAGGAGGG - Intronic
1153587388 18:6637126-6637148 AACTGGCTGCAGAGGGAGGATGG - Intergenic
1153921355 18:9793179-9793201 CTCAGGAAGCTGAGGCAGGAGGG - Intronic
1154050734 18:10954595-10954617 GATGAGAAGAAGAGGGAGGAGGG + Intronic
1154250605 18:12741248-12741270 CTCAGGAAGCTGAGGCAGGAGGG - Intergenic
1155298791 18:24409807-24409829 CATGGGAAGCTGAGGCTGGAGGG + Intergenic
1155474580 18:26225448-26225470 CTCGGGAATCTGAGGTAGGAGGG + Intergenic
1156508790 18:37617440-37617462 CACCGGAAGCAAAGGGCAGAAGG - Intergenic
1157301676 18:46484016-46484038 CTTGGAGAGCAGAGGGAGGAGGG + Intronic
1157367692 18:47081014-47081036 GAAGGGAAGGAAAGGGAGGAGGG - Intronic
1157481844 18:48060227-48060249 CAGGGGAAGCAGAGGGGAGAAGG + Intronic
1157651204 18:49333528-49333550 GACAGGAAGAACAGGGAGGATGG + Intronic
1157824736 18:50802542-50802564 CAGGTAAACCAGAGGGAGGAGGG + Intronic
1158272102 18:55727671-55727693 CCCGGGAAGCAGAGGTTGCAGGG - Intergenic
1159300976 18:66567274-66567296 AGCAAGAAGCAGAGGGAGGAAGG + Intronic
1159310195 18:66698104-66698126 CACAGGAGGCTGAGGAAGGAGGG + Intergenic
1159914716 18:74178382-74178404 ACCAGGAAGCAGAGGGAGGAAGG + Intergenic
1160400314 18:78605964-78605986 CTTAGGATGCAGAGGGAGGATGG - Intergenic
1160781823 19:880811-880833 CTCGGGAGGCTGAGGCAGGAAGG + Intronic
1160813787 19:1026371-1026393 CACGGGAAACTGAGGCAGGGAGG - Intergenic
1160816196 19:1036963-1036985 CTCGGGAGGCTGAGGCAGGAAGG - Intronic
1160839837 19:1141288-1141310 CTCGGGAAGCAGAGGTTGCAGGG - Intronic
1160906526 19:1454017-1454039 CAGGGCCAGCAGAGGGAGGCAGG + Intronic
1160949098 19:1657246-1657268 CAGGGGAAGCTGAGGGACAAAGG + Intergenic
1161173925 19:2828589-2828611 CACGGGAGGCAGAGGTTGCAGGG + Intronic
1161227083 19:3151648-3151670 CCTGGGAAGCAAAGGGAGGCTGG + Intronic
1161319291 19:3633576-3633598 CAAGAGAGGCAGAGGGAGGAAGG + Intronic
1161502294 19:4623003-4623025 CACGGGCAGCAGAGGGAGCGAGG - Intergenic
1161792804 19:6370748-6370770 CAAGGGGAGCAGAGGGTGGGGGG + Intergenic
1161961780 19:7527423-7527445 CTGGGGAAGCACAGGGAAGAAGG + Intronic
1162080482 19:8214939-8214961 GAGGGGGAGGAGAGGGAGGAGGG + Intronic
1162182966 19:8883201-8883223 CACCTGAAGGAGAGGGAGGTAGG + Intronic
1162861009 19:13505870-13505892 GAGGGGAGGCGGAGGGAGGAGGG + Intronic
1162929926 19:13952696-13952718 CGAGGGAGGCGGAGGGAGGAGGG + Intronic
1162951518 19:14074239-14074261 CCCAGGAACCCGAGGGAGGAGGG - Intronic
1163036857 19:14574802-14574824 CTCGGGAGGCTGAGGCAGGAGGG - Intergenic
1163113866 19:15177942-15177964 CCCGGGAAGCTGCGGCAGGAGGG + Exonic
1163119219 19:15206539-15206561 CTCGGGAGGCTGAGGAAGGAGGG - Intergenic
1163212201 19:15849413-15849435 CTCAGGAGGCAGAGGCAGGAGGG - Intergenic
1163275549 19:16281750-16281772 CTCGGGAGGCTGAGGCAGGAGGG + Intergenic
1163288892 19:16365735-16365757 CACGGGAAGCAGAGTGGTGAGGG - Intronic
1163415063 19:17181317-17181339 CACGGGGAGGAGACGGAGGATGG - Intronic
1163453990 19:17395234-17395256 AACAGGAAGAGGAGGGAGGAGGG - Intergenic
1163584514 19:18156539-18156561 CAGGAGGACCAGAGGGAGGAAGG + Intronic
1163586468 19:18167026-18167048 CTCGGGAGGCTGAGGTAGGAGGG + Intronic
1163668084 19:18612443-18612465 CAGGGAACGGAGAGGGAGGAAGG - Intronic
1163693682 19:18751414-18751436 CTCGGGAGGCTGAGGCAGGAGGG + Intronic
1163738618 19:18997023-18997045 CATGGGAAGCAGGGTGAGAAGGG + Intronic
1163760805 19:19135436-19135458 AAAGGGAAGAAGAGGGAGGAGGG - Intronic
1163821637 19:19499541-19499563 CCCAGGATACAGAGGGAGGAGGG + Intronic
1163933823 19:20423906-20423928 CAGGGAAAGAAGAGGGAAGAAGG + Intergenic
1164734757 19:30532636-30532658 AAAGGGAAGCTGAGGGAGGCCGG + Intronic
1164747649 19:30627991-30628013 CACGGGAAGCAGGGGTGGTACGG - Intronic
1164794649 19:31015867-31015889 CACAGGAAGCACAGAGAGGGTGG + Intergenic
1164924868 19:32122722-32122744 CACTGGAAGCAGAGTGAGCCTGG - Intergenic
1164960465 19:32424210-32424232 CTTGGGAAGCTGAGGCAGGAGGG + Intronic
1165163320 19:33831726-33831748 CACTGAGAGCAGAGTGAGGAGGG - Intergenic
1165375231 19:35437160-35437182 CACGGACAGCAGATGGAGAAGGG + Intergenic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1165450688 19:35880453-35880475 CTCGGGAGGCTGAGGCAGGAGGG - Intergenic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166161777 19:40959448-40959470 GAGGGGAAGGAGAGGGAGGGAGG - Intergenic
1166326857 19:42056394-42056416 CACAGGAAGCAGGGGGAAGAGGG + Intronic
1166819396 19:45568295-45568317 CTCGGGAGGCTGAGGCAGGAGGG - Intronic
1166894750 19:46016403-46016425 CAGGGGCAGGTGAGGGAGGAAGG - Intronic
1167013979 19:46827612-46827634 CTCGGGAGGCTGAGGCAGGAGGG + Intergenic
1167367779 19:49064030-49064052 GATGGGAAGCAGATGGAGGGAGG + Intronic
1167433974 19:49468580-49468602 TACGGGGAGGAGAGGCAGGAAGG - Intronic
1167435028 19:49474345-49474367 CAGGGGGAGCAGAGGGTGGGGGG + Intronic
1167728633 19:51236246-51236268 GTCAGGAAGCAGAGGGAGCAAGG + Intronic
1167747935 19:51363802-51363824 GACAGAAAGCAGAGGTAGGAGGG + Intronic
1168153607 19:54461589-54461611 CACTGGGGGCAGAGGGAGGAGGG - Exonic
1168258922 19:55181968-55181990 GACGGGAGGCAGTGGGACGAGGG - Intronic
1168375149 19:55870789-55870811 CACGAGAAGGAGAGTGAAGAGGG - Intronic
1168517073 19:57017542-57017564 GGAGGGAAGCAGAGGGAGAAGGG - Intergenic
1168518742 19:57031695-57031717 CGGGGGCAGCAGAGGGAGGAAGG - Intergenic
1168688204 19:58361244-58361266 AACGGGGAGCAGAGGTAGGAGGG + Intronic
925079660 2:1053972-1053994 CAGGGCCTGCAGAGGGAGGAGGG - Intronic
925385984 2:3461914-3461936 CACAGGCAGCACAGGGAGAATGG - Intronic
925428493 2:3771132-3771154 CGGAGGATGCAGAGGGAGGACGG - Intronic
925609330 2:5691373-5691395 GGCGGGGAGCAGAGGGAGAAGGG + Intergenic
925894284 2:8459410-8459432 CAGGATAAGCAGAGGGAAGAGGG - Intergenic
926142662 2:10377604-10377626 CACGGGAGCCAGGGGGAGGAGGG - Intronic
926697724 2:15782454-15782476 CAGGGGTGGGAGAGGGAGGATGG - Intergenic
926853431 2:17226448-17226470 CTCGGGAGGCTGAGGCAGGAGGG + Intergenic
927408677 2:22800631-22800653 CACAGACAGCAGTGGGAGGAAGG + Intergenic
927468242 2:23352527-23352549 AAGGGGAAAGAGAGGGAGGATGG + Intergenic
928143287 2:28749605-28749627 CAAGTGAGGCAGAGGGAGGCCGG - Intergenic
928162385 2:28939997-28940019 CTCGGGAGGCTGAGGGAGGCAGG + Intronic
928316815 2:30252813-30252835 CAGGGCTGGCAGAGGGAGGAAGG + Intronic
928868084 2:35942643-35942665 CAAGGGAGGCTGAGGCAGGAAGG - Intergenic
929164339 2:38865992-38866014 GGAGGGAAGAAGAGGGAGGAAGG + Intronic
929724716 2:44412998-44413020 CCCGGGAAGCAGAGGTTGCAGGG + Intronic
929778885 2:44944773-44944795 GAGGGGAAGGAGAGGGAGGAGGG - Exonic
930234235 2:48873663-48873685 CTCTGGGAGCAGAGGGAGCAGGG + Intergenic
930752757 2:54948618-54948640 AAGGTTAAGCAGAGGGAGGAGGG + Intronic
931049168 2:58390691-58390713 CAGGGAAAGCAGAGTTAGGAAGG - Intergenic
931163888 2:59724493-59724515 CAGGAGAAGCAGAGGGAGTGAGG + Intergenic
931597695 2:63967766-63967788 AAGGGGTAGCAGAGGGATGAGGG + Intronic
931723103 2:65081800-65081822 CACGGGAGGCTGAGGCAGAATGG - Intronic
932243476 2:70176734-70176756 CTCAGGAAGCTGAGGCAGGAGGG - Intronic
932299703 2:70657631-70657653 AACGTGAATCAGAAGGAGGATGG - Exonic
932314879 2:70773386-70773408 GACGGAAAGGAGAGGGAGCAGGG + Intergenic
932381758 2:71290504-71290526 CTCGGGAGGCTGAGGTAGGAGGG - Intronic
932834448 2:75023185-75023207 CAGGGGGAGTAGAGGGAGCAAGG + Intergenic
932881152 2:75503342-75503364 CCCAGGAAGCAGAGTGGGGAGGG + Intronic
933727201 2:85433702-85433724 CAAGGGAAGCAGATGGAGCCAGG - Intronic
933791270 2:85885718-85885740 CTCGGGAAGCTGAGGCAGAATGG + Intronic
933848122 2:86342283-86342305 CTCAGGAAGCTGAGGCAGGAGGG - Intergenic
933990244 2:87628651-87628673 CAAGGGAGACAGAGGGTGGAGGG + Intergenic
934616094 2:95772192-95772214 GAAGAGAAGCAGAGGCAGGAGGG - Intergenic
934644802 2:96052368-96052390 GAAGAGAAGCAGAGGCAGGAGGG + Intergenic
934818957 2:97355366-97355388 CAAGGGAAGCAGATGTATGAGGG + Intergenic
934838213 2:97608457-97608479 GAAGAGAAGCAGAGGCAGGAGGG + Intergenic
934958994 2:98650841-98650863 CTCGGGAAGCTGAGGCAGAATGG + Intronic
935063252 2:99626428-99626450 GAAGGGAAGGAGAGGGAGGGAGG - Intronic
935434014 2:103008721-103008743 GACGGGGAGCAGAGGCAGCAAGG - Intergenic
935653250 2:105399417-105399439 CGGGGGAGGCGGAGGGAGGAGGG + Intronic
935764417 2:106351499-106351521 CACGGGAGGCTGAGGTGGGAGGG - Intergenic
936005328 2:108882044-108882066 CTCGAGAAGCTGAGGCAGGAGGG + Intronic
936303602 2:111322173-111322195 CAAGGGAGACAGAGGGTGGAGGG - Intergenic
936407095 2:112214545-112214567 CAAGGGGAGCAGAGGGAAGTAGG + Exonic
936616697 2:114055355-114055377 CAAGGGATGCAGATGGAGGGAGG - Intergenic
937197625 2:120173788-120173810 CTCAGGAAGCTGAGGCAGGAGGG - Intronic
937499728 2:122465001-122465023 CCAGGGAAGCAGAGCAAGGATGG - Intergenic
938104411 2:128520348-128520370 CACGCCAAGCAGAGGCTGGAAGG + Intergenic
938105353 2:128526312-128526334 CAGGAGAACCAGAGGGAGGGTGG - Intergenic
938124947 2:128664693-128664715 CTGGGGTAGCAGTGGGAGGAGGG + Intergenic
938265094 2:129922887-129922909 CACACGAAGCTGAGGAAGGAAGG + Intergenic
938541978 2:132290661-132290683 CCCGGGAGGCAGAGGTTGGAGGG + Intergenic
938844868 2:135197900-135197922 CACAGGAGGCTGAGGTAGGAGGG - Intronic
939002717 2:136755001-136755023 CAGGGGAAGCAGTGACAGGATGG - Intergenic
940711503 2:157167703-157167725 CAAGTGAAGCAGAGGCAGCAAGG + Intergenic
940746957 2:157578008-157578030 CTTGGGAAGCTGAGGCAGGAGGG - Intronic
941011782 2:160308285-160308307 CTCAGGAAGCTGAGGGTGGAAGG + Intronic
941017502 2:160373873-160373895 CAAGGGAAGATCAGGGAGGAGGG + Intronic
941638113 2:167957995-167958017 CCCAGGTAGCAGAGGAAGGAGGG - Intronic
941754613 2:169171639-169171661 CCAGAGAAGTAGAGGGAGGAAGG - Intronic
941797085 2:169611098-169611120 CTCGGGAGGCTGAGGCAGGAAGG + Intronic
941809214 2:169738953-169738975 AAGGGGGAGGAGAGGGAGGAGGG - Intronic
941918568 2:170828149-170828171 CGAGGACAGCAGAGGGAGGAGGG - Intronic
941918704 2:170828733-170828755 CGAGGACAGCAGAGGGAGGAGGG - Intronic
941918735 2:170828853-170828875 CAAGGACCGCAGAGGGAGGAAGG - Intronic
942787863 2:179720544-179720566 CAAGGGGAGGAGAGGGAGGGAGG + Intronic
943919152 2:193679978-193680000 CAAGGGAAACAGAGAAAGGAAGG + Intergenic
944743285 2:202633277-202633299 CCCGGGAGGCAGAGGTTGGAAGG - Intergenic
944781333 2:203021031-203021053 CTCGGGAGGCTGAGGGAGGCAGG - Intronic
945020668 2:205567816-205567838 CATTGGAAGCGGAGTGAGGAAGG + Intronic
945285174 2:208074924-208074946 CACAGGAAGCACAGAGAGGCGGG - Intergenic
945302278 2:208225675-208225697 CTCGGGAGGCTGAGGCAGGAGGG + Intergenic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
946113824 2:217444538-217444560 CATGGGAAGCAGAGGAACAAAGG - Intronic
946276085 2:218632912-218632934 GAAGGGAGGCAGAGGGAGAAGGG + Intronic
946426644 2:219601959-219601981 CAAGGAAAGAGGAGGGAGGAAGG - Intronic
947120327 2:226807633-226807655 CAGTGGGAGCAGAGTGAGGAAGG + Intergenic
947387400 2:229605271-229605293 GACAGGAAGCAAAGGGATGAGGG + Intronic
947401890 2:229739565-229739587 CTCGGGAGGCTGAGGTAGGAAGG + Intergenic
947492910 2:230611253-230611275 CCAGGGCAGCAGAGGGTGGAGGG - Intergenic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
947812214 2:233011693-233011715 CTCAGGAGGCAGAGGCAGGAGGG - Intronic
948051570 2:234982857-234982879 CAAGGGAGGAAGAGGCAGGAAGG + Intronic
948202083 2:236136545-236136567 CATGGGCAGCAGAGGAGGGAGGG - Intergenic
948262243 2:236613018-236613040 CACATGGAGCAGAGGGAGGAGGG - Intergenic
948833960 2:240615310-240615332 CAGGGGAAACAGACGGAGAAGGG - Intronic
1168856487 20:1012843-1012865 CGAGGGAGGCAGAGGGAGGGAGG + Intergenic
1169007689 20:2222401-2222423 CACAGGAGGCTGAGGCAGGAAGG - Intergenic
1169623746 20:7539452-7539474 CTCAGGAAGCTGAGGCAGGAAGG + Intergenic
1170092742 20:12609177-12609199 GACGTGAAGCAGAGAGGGGAAGG - Intergenic
1170858458 20:20079490-20079512 GAAGGGAAGCAGAGAGAGGGAGG + Intronic
1170907517 20:20529072-20529094 CACGGAAACTAGAGGGAGGCAGG + Intronic
1171030076 20:21669185-21669207 CAGGAGAAGCAGAGAAAGGAGGG - Intergenic
1171178985 20:23077589-23077611 GAAGGGAGGGAGAGGGAGGAGGG - Intergenic
1171178993 20:23077607-23077629 GAAGGGAGGGAGAGGGAGGAAGG - Intergenic
1171304269 20:24091899-24091921 CAGGGAAAGGAGAGGGAGGAGGG - Intergenic
1171481730 20:25459992-25460014 CACGGGAAGGACAGGAAGGGTGG - Intronic
1171519001 20:25761323-25761345 CAGAAGAAGCAGAGGGAGGGAGG - Intergenic
1172061034 20:32187709-32187731 CTCTGCAAGCAGGGGGAGGAGGG + Intergenic
1172635699 20:36408239-36408261 AAAGGGAAGAACAGGGAGGAGGG + Intronic
1172737617 20:37139739-37139761 CTTGGGAAGCTGAGGCAGGAGGG - Intronic
1172780659 20:37435148-37435170 CATGGGAAGTAGAGCGAGGTGGG - Intergenic
1172895235 20:38295553-38295575 GATGTGAAGCAGAGGGGGGATGG + Intronic
1172900928 20:38334408-38334430 CCTGGAAATCAGAGGGAGGATGG - Exonic
1173019394 20:39254411-39254433 CACGAGAAGAAGAAGGAGGGAGG - Intergenic
1173078831 20:39846672-39846694 CATTGGGAGCAGAGGGAGAAAGG - Intergenic
1173556984 20:43973288-43973310 CAGGAGAAGCAGCCGGAGGAGGG - Intronic
1173901969 20:46596943-46596965 CTCGGGAGGCTGAGGCAGGAGGG + Intronic
1174000069 20:47368108-47368130 CTCGGGAGGCTGAGGCAGGAAGG + Intergenic
1174179530 20:48666128-48666150 AACGGGAAGGGGAGGGAGGTGGG + Intronic
1174359358 20:50018130-50018152 GACAGGAAGGAGAGTGAGGAAGG - Intergenic
1174445898 20:50590888-50590910 CATGGGAAGCAGAGGCTGCAGGG - Intronic
1174622693 20:51888317-51888339 TTCGGGAAGCCGAGGGCGGAGGG + Intergenic
1174743243 20:53037226-53037248 CTCAGGAAGCAGAGGCAGAAAGG + Intronic
1174798695 20:53544158-53544180 CTCGGGAGGCTGAGGTAGGAGGG + Intergenic
1175119765 20:56708693-56708715 CATGGGAGGCTGAGGCAGGAGGG + Intergenic
1175334246 20:58184830-58184852 CAATGGAAGCAGAGAGAGGCTGG + Intergenic
1175902190 20:62364358-62364380 CACGAGCAGCAGAGGGAAGCTGG + Intronic
1176041845 20:63069860-63069882 CTTGGGAAGCACAGGGAGGCAGG + Intergenic
1176134678 20:63517070-63517092 CTCAGGAAGCTGAGGCAGGAGGG - Intergenic
1177381814 21:20354254-20354276 CAAGGCAAGATGAGGGAGGAAGG + Intergenic
1177688433 21:24470919-24470941 CACGGCAAGCAGAGAGAAAATGG + Intergenic
1178436171 21:32560297-32560319 CAGGGAAAGCAGAGGAAGAAGGG + Intergenic
1178705375 21:34868534-34868556 CAGAGAAAGCAGAGTGAGGAAGG - Intronic
1178855042 21:36243778-36243800 CTCGGGAGGCTGAGGCAGGAGGG - Intronic
1179086588 21:38223825-38223847 GGTGGGAAGCAGAGGGAGGATGG - Intronic
1179404771 21:41116227-41116249 CTCGGGAGGCTGAGGTAGGAGGG + Intergenic
1179953653 21:44725720-44725742 CCCGGGAAGCAGAGGCTGCAGGG + Intergenic
1179984824 21:44914368-44914390 CAGGGGAAGCAGGGGGCTGAGGG + Intronic
1180581565 22:16844179-16844201 CTCTGTAGGCAGAGGGAGGAGGG + Intergenic
1180753009 22:18138179-18138201 CACTGGACGCTGAGGTAGGAGGG - Intronic
1181104153 22:20562926-20562948 CTCGGGAGGCTGAGGCAGGAGGG + Intronic
1181410024 22:22712234-22712256 CAAAGGAAACAGAGAGAGGAGGG - Intergenic
1181422333 22:22810645-22810667 AAGGAGAGGCAGAGGGAGGAGGG - Intronic
1181464275 22:23102390-23102412 CCCTGGGAGCAGAGGAAGGAAGG - Intronic
1181513888 22:23400852-23400874 CAGGGCAACCACAGGGAGGAGGG + Intergenic
1181772159 22:25133648-25133670 CTCGGGAAGCTGAGGCAGGAGGG - Intronic
1181832322 22:25570716-25570738 CAGGAGAAGCAGAGGGGGGCCGG - Intronic
1182387162 22:29954187-29954209 CTCGGGAGGCTGAGGCAGGAGGG - Intronic
1182401936 22:30085036-30085058 CTCGGGAGGCTGAGGCAGGAGGG + Intronic
1182880018 22:33725132-33725154 CGCGGGAGGCAGAGCCAGGAGGG + Intronic
1183002033 22:34868578-34868600 CAGGTGAAGCAGAGGGAGTGAGG - Intergenic
1183366887 22:37411571-37411593 CACAGCAAGCGGAGGCAGGAAGG + Intronic
1183615707 22:38944075-38944097 GAGGAGAAGGAGAGGGAGGAAGG - Intergenic
1183689201 22:39378788-39378810 CCTGGGCTGCAGAGGGAGGATGG - Intronic
1183730895 22:39617811-39617833 CAAGGGAAGGAGCAGGAGGAGGG - Intronic
1183758769 22:39796378-39796400 CACGGGAGGCTGAGGCAGGAGGG - Intronic
1183861004 22:40669963-40669985 CAAGGGAAGCAGAGAGGGGTGGG - Intergenic
1184205185 22:42997767-42997789 CTCGGGAGGCAGAGTGAGGCAGG + Intronic
1184239346 22:43203770-43203792 GAAGGGAGGCAGAGGGAGGGAGG + Exonic
1184288429 22:43484883-43484905 TACGGGAAGGAGACGGAGGTGGG - Intronic
1184407353 22:44307748-44307770 CTGGGGAAGGAGAGGAAGGAGGG + Intronic
1184517935 22:44974304-44974326 CTCGGGAGGCTGAGGCAGGAGGG + Intronic
1184598811 22:45530436-45530458 CACTGGTAGCAGTGGGAGGAAGG - Intronic
1184600243 22:45539137-45539159 GAAGGGAAGGAGGGGGAGGAGGG - Intronic
1184601787 22:45548291-45548313 CATGGGAGGCTGAGGCAGGAGGG - Intronic
1184696510 22:46142372-46142394 CTCAGGAGGCAGAGGCAGGAGGG + Intergenic
1184916887 22:47575427-47575449 CAAGGGAAGGACAGGGAGGAGGG - Intergenic
1185014052 22:48333257-48333279 AAGGGGAAGCAGAGTGAGGCTGG - Intergenic
1185088447 22:48753114-48753136 CATGGGGAGCAGAGGGAGCTTGG - Intronic
1185107690 22:48883579-48883601 CCTGGGAAGGAGAGGGAGTAGGG + Intergenic
1185342751 22:50299058-50299080 CACGGGAACCAGAGAGGGCAGGG + Intronic
1185359962 22:50400200-50400222 CAAGGGAAACACTGGGAGGAAGG + Intronic
949311874 3:2709057-2709079 CAGTGGCAGCAGAGGGGGGATGG - Intronic
949413510 3:3792567-3792589 CAAGGGAAGCAGAGGAATGTAGG - Intronic
949485116 3:4530671-4530693 CACAGGAGGCTGAGGCAGGAGGG + Intronic
950191545 3:10980174-10980196 AACTGGAAGTAGAGAGAGGAGGG + Intergenic
950525914 3:13523184-13523206 CACGGGAAGCAGGGGGAAGCTGG - Intergenic
952295272 3:32056696-32056718 CAAGGGTTGCAGAGGGACGAAGG - Intronic
952431727 3:33230182-33230204 GATGGGAAGCTAAGGGAGGAAGG + Intergenic
952463531 3:33555471-33555493 CTCGGGAAGCTGAGGTGGGAGGG - Intronic
952655073 3:35776420-35776442 CAGGGAAAGCAGAGGAAGGGTGG + Intronic
952777641 3:37061496-37061518 CTTGGGAAGCTGAGGCAGGAGGG - Intronic
952832484 3:37576709-37576731 CTCGGGAGGCTGAGGGAGGATGG - Intronic
953526229 3:43691613-43691635 CCCGGGAAGCGGCGGGAGGGCGG + Intronic
953850105 3:46459553-46459575 CAGGTGAAGCAGAGGAAGTAAGG + Intronic
954253636 3:49388112-49388134 CTCGGGAAGCTGAGGTGGGAGGG - Intronic
954485269 3:50844321-50844343 CTCAGGAGGCTGAGGGAGGACGG - Intronic
954692515 3:52403188-52403210 CACGGACAGCAGAGAGAAGACGG - Exonic
954794225 3:53153345-53153367 GTGGGGAGGCAGAGGGAGGAAGG + Intergenic
954852254 3:53613338-53613360 TACAGGAAGAAGAGGGAAGAGGG - Intronic
955672363 3:61415272-61415294 CACTGGCAGCAGAGGGAGGGAGG + Intergenic
955703123 3:61701913-61701935 AAGAGGAAGGAGAGGGAGGAAGG + Intronic
955977403 3:64491669-64491691 CAGGGGAAGAAGAGGGAGTTGGG - Intergenic
956152821 3:66261107-66261129 CTCGGGAAGCCGAGACAGGAAGG - Intronic
956665157 3:71635462-71635484 ATTGGGAAGCAGTGGGAGGAGGG - Intergenic
956774064 3:72550365-72550387 CACCGGAAGCTGGGGGAGGCAGG - Intergenic
956776373 3:72568630-72568652 GACAAGCAGCAGAGGGAGGAAGG - Intergenic
956800905 3:72757495-72757517 CTTGGGAAGCTGAGGCAGGAGGG - Intronic
958459774 3:94379953-94379975 CTCGGGAGGCTGAGGCAGGAAGG + Intergenic
959608865 3:108271470-108271492 CTCAGGAAGCTGAGGCAGGAGGG + Intergenic
960653015 3:119972541-119972563 CTCGGGAGGCTGAGGCAGGAGGG - Intronic
960660626 3:120054225-120054247 CTAGGGAAGGAGAGAGAGGAGGG - Intronic
960963545 3:123089346-123089368 CAGGGGAAGGAGTGGGAGGCAGG + Intronic
961486831 3:127222576-127222598 CCAGGGAAGCAGTGGGAGGGAGG + Intergenic
961749680 3:129087913-129087935 GGGGGGAAGCAGAGGGAGGTGGG - Exonic
961820368 3:129572740-129572762 CAGGGGCAGCTGTGGGAGGAAGG + Exonic
962222202 3:133573618-133573640 GAGGGGAGGGAGAGGGAGGAGGG - Intergenic
962898629 3:139737646-139737668 CATGTGAAGCAGAGAGAGCAGGG + Intergenic
963918851 3:150886726-150886748 CCAGGGAAGCAGAGGGAGGAGGG - Intronic
965084505 3:164077476-164077498 CAGGGAAAGCAGAGGGAAAAAGG + Intergenic
965360692 3:167735121-167735143 CACGGAAAGGAGAGGAAGGGCGG + Intergenic
965402717 3:168232190-168232212 CACAGGAAGGAAAGGAAGGAAGG - Intergenic
966568641 3:181413423-181413445 AAGGGCAAGCAGAGGAAGGAAGG + Intergenic
966729694 3:183140329-183140351 CACGGGAGGCAGAGGTTGCAGGG + Intronic
966882620 3:184358825-184358847 GAAGGGAAGAAGGGGGAGGATGG + Intronic
966942637 3:184756608-184756630 CAGGGGCAGCACAGGGAGAACGG - Intergenic
967210199 3:187161764-187161786 TAGGGGAAGCAGAGGTAGGAAGG - Intronic
967529603 3:190533491-190533513 CAGGGGAAGCACAGGGGGGAGGG - Intronic
967537479 3:190623630-190623652 GACGGCTAGCAGAGGGAGAAGGG - Intronic
967861593 3:194155997-194156019 GTAGGGAAGCAGAGGAAGGAAGG + Intergenic
967976083 3:195035509-195035531 CACGGGAAGCAGAGTCAGCCTGG - Intergenic
968669731 4:1842654-1842676 CACAGGCAGCAGTGGGAGGCTGG + Intronic
968783505 4:2601010-2601032 CACAGGAGGCTGAGGCAGGAGGG + Intronic
968913430 4:3486923-3486945 CCCGGGGAGCAGAGGGAAGCAGG + Intronic
968914484 4:3491356-3491378 CAGGGGGAGCAGAGGAAGGAAGG - Intronic
969160739 4:5256487-5256509 CAGGGGAAGCAGTGGGAGAGTGG - Intronic
969480589 4:7445007-7445029 GGCGGGGAGCAGAGGGAGGGCGG + Intronic
969593766 4:8136694-8136716 CGAGGGAAGCGGAGGAAGGAAGG + Intronic
969843073 4:9897780-9897802 CACGGGAGGCTGAGGCAGGAGGG + Intronic
969872161 4:10111398-10111420 CAGGGGAAGCAGAGGGTGGTGGG - Intronic
970054461 4:11954762-11954784 CACCAGTAGCAGAGGGAGAAAGG - Intergenic
970727107 4:19060031-19060053 CCCGGGAAGCAGAAGGAGTCAGG + Intergenic
971114904 4:23633663-23633685 CTTGGGAAGCTGAGGCAGGAGGG + Intergenic
971452409 4:26812288-26812310 CAGAGGAAGCTGAGGAAGGAAGG - Intergenic
972032991 4:34486081-34486103 CTTGGGAAGCAGAGGCAGGAGGG - Intergenic
972446615 4:39150415-39150437 CAGGGGATGGAGAGGGAGGAAGG + Intergenic
973318713 4:48788062-48788084 AAAGTGAAGGAGAGGGAGGAAGG + Intergenic
973901490 4:55477863-55477885 TAAGGGAAGCCAAGGGAGGAGGG + Intronic
974310092 4:60194682-60194704 CTTGGGAAGCTGAGGCAGGAGGG - Intergenic
974508920 4:62811558-62811580 CCCGGGAAGCAGAGGTTGCAGGG - Intergenic
975347267 4:73306397-73306419 CTCGGGAAGCTGAGGCATGAGGG + Intergenic
975460767 4:74650976-74650998 CTCAGGAGGCTGAGGGAGGATGG + Intergenic
976547925 4:86359403-86359425 GAGGGGTAGCAGAGGGAGGGAGG - Intronic
977374213 4:96180571-96180593 CAGGGGAAGGAGAGAGAGGAGGG - Intergenic
977747647 4:100569468-100569490 CAGGGCAAGCAGAGGGAGATGGG - Intronic
977818376 4:101442712-101442734 CTCGGGAGGCTGAGGCAGGAGGG - Intronic
977870165 4:102081605-102081627 GAAGGGAAGGAAAGGGAGGAAGG + Intergenic
979212346 4:118120318-118120340 CTCAGGAGGCAGAGGGAGCAGGG + Intronic
979562563 4:122116908-122116930 CAATGGAAGCAGAGTGAGGAAGG + Intergenic
979666171 4:123313194-123313216 GAATGGATGCAGAGGGAGGAGGG - Intronic
979816013 4:125104899-125104921 TACAGGAAGCAGGGGGAGGGAGG - Intergenic
980224889 4:129969966-129969988 CTCAGGAAGCTGAGGCAGGAGGG - Intergenic
980658082 4:135815776-135815798 CACGGGTTGCACAGGGAGTATGG - Intergenic
981542415 4:145859673-145859695 CGCGAGAACCAGAGAGAGGAAGG - Intronic
981641876 4:146953673-146953695 CTCGGGAGGCTGAGGCAGGAAGG + Intergenic
982277934 4:153656013-153656035 AAGGGGTGGCAGAGGGAGGATGG - Intergenic
982370442 4:154627424-154627446 CAGGGGAGGGAGACGGAGGAAGG - Intronic
982561261 4:156930758-156930780 CTCGGGAGGCTGAGGCAGGAGGG + Intronic
982710466 4:158753561-158753583 CTTGGGAAGCTGAGGCAGGAGGG + Intergenic
982926182 4:161339622-161339644 GACAGGAAGTAGAGGGAGAAAGG - Intergenic
983091745 4:163511715-163511737 CATGGGAGGCTGAGGCAGGATGG + Intronic
983308210 4:166021368-166021390 GGAGGGAAGCAGAGGGAGGAAGG - Intronic
983932293 4:173465768-173465790 AGGGGGAAGCGGAGGGAGGAAGG - Intergenic
984241003 4:177219214-177219236 CAAGGGAAAAAGAGGGAGTAGGG - Intergenic
984660398 4:182368234-182368256 CACGAGCATCAGAGGCAGGATGG + Intronic
984804855 4:183742669-183742691 CTCGGGAGGCTGAGGTAGGAGGG - Intergenic
984940016 4:184922685-184922707 CCAGGGAAGCAGAGTGGGGAGGG + Intergenic
985440186 4:189978252-189978274 CTCTGGAATCAGATGGAGGAAGG + Intergenic
985487301 5:158679-158701 CAGGACAGGCAGAGGGAGGAAGG - Intronic
985487326 5:158763-158785 CAGGAAGAGCAGAGGGAGGAGGG - Intronic
985548271 5:520741-520763 CCCTGGAAGGAGAGGGAGGCGGG - Intronic
985828098 5:2207649-2207671 CACGCAAAGTAGAGTGAGGAAGG + Intergenic
985836130 5:2273184-2273206 CACCGCATGCAGAGGGTGGAGGG - Intergenic
986174053 5:5336963-5336985 CATGGGCAGCACAGGGAGGAGGG + Intergenic
986226748 5:5823106-5823128 CTCGGGAGGCTGAGGCAGGAGGG - Intergenic
986339526 5:6777305-6777327 CAGAGAAAGCAGAGGGATGAAGG - Intergenic
986439125 5:7763196-7763218 CGCGGGACGCAGAGGCAGAATGG - Intronic
986970847 5:13334731-13334753 TACTGGAAGCAGAGGGTGGGAGG - Intergenic
987149095 5:15020849-15020871 AAGGAGAAGCAGAGAGAGGAGGG + Intergenic
987365647 5:17146595-17146617 GAAGGGAAGGAGAGGAAGGAGGG - Intronic
987614524 5:20255132-20255154 GGAGGGAAGGAGAGGGAGGATGG + Intronic
988570311 5:32358550-32358572 CTCGGGAGGCAGAGGCAGAATGG + Intronic
990217768 5:53552955-53552977 CACCCCAAGCAGGGGGAGGAAGG - Intergenic
990480517 5:56206081-56206103 CTCGGGAGGCTGAGGTAGGAGGG - Intronic
990739197 5:58895086-58895108 TGCAGGAAGCATAGGGAGGAAGG - Intergenic
991081486 5:62605841-62605863 CACAGGAAGCTGAGACAGGAAGG - Intronic
991084855 5:62639394-62639416 CACAGGAAGAAGAGGAAGTATGG + Intergenic
991249537 5:64544564-64544586 CCTGGGAAGCTGAGGCAGGAGGG + Intronic
991377715 5:65984002-65984024 CACGGGAAGCAGGTGGGAGAAGG - Intronic
991646735 5:68808154-68808176 GAAGGGAAGGAAAGGGAGGAAGG + Intergenic
992103572 5:73431075-73431097 CTCGGGAGGCTGAGGCAGGATGG + Intergenic
992299376 5:75362948-75362970 CACTGGAAGCCGAGAGAAGATGG + Intergenic
993130830 5:83896244-83896266 CAGAGGGAGCAGAGGGAGCAGGG + Intergenic
993632936 5:90309504-90309526 GAAGGGAAGGAGAGGGAGGGAGG + Intergenic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
994092315 5:95820241-95820263 CACGGGAGGCTGAGGTGGGAGGG + Intronic
994153424 5:96475258-96475280 CATGGGAAGCAAAGCCAGGAAGG - Intergenic
994346042 5:98687467-98687489 AAAGGGAAGCAGAAGGAGGAAGG + Intergenic
995502374 5:112821397-112821419 CTCCGGAAGCTGAGGCAGGAAGG + Intronic
995519346 5:112986893-112986915 CTCGGGAGGCTGAGGCAGGAGGG + Intronic
995558217 5:113352661-113352683 CACGGGGGGCAGTGGGAGAAAGG + Intronic
996614371 5:125422734-125422756 CATGGAAGGCAGAGGGAGGTGGG - Intergenic
997499144 5:134357748-134357770 AATGGGAAGGAGAGGAAGGATGG - Intronic
997521625 5:134527201-134527223 GAAGGGAGGGAGAGGGAGGAAGG - Intronic
997713200 5:136023347-136023369 CACGGGGAGCAGAGCAAGGCTGG + Intergenic
997737495 5:136224783-136224805 CTGTGGAAGCAGAGGGTGGAGGG - Intronic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
999301872 5:150496269-150496291 CTCGGGAGGCTGAGGTAGGAGGG + Intronic
999496961 5:152108494-152108516 GTAGGGAAGCAGAGGGAGGGTGG + Intergenic
999762873 5:154716193-154716215 CCCGGGAGGCAGAGGGTGCAGGG - Intronic
1000024030 5:157343313-157343335 CACAGGAAGTAGAGAGTGGAAGG + Exonic
1000091068 5:157930100-157930122 GAGGGGAAGAAGGGGGAGGAAGG + Intergenic
1000209114 5:159095223-159095245 CCCGGGAAGCAGAGGGGCGAGGG - Intronic
1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG + Intergenic
1000922061 5:167149944-167149966 GAAGGGAAGGAGAGGAAGGATGG + Intergenic
1001123018 5:168995722-168995744 ACAGGGAAGCAGAGGGAGCAGGG - Intronic
1001482551 5:172098493-172098515 CACAGGATGCAGAGGAAGGATGG + Intronic
1001546626 5:172574463-172574485 GAGGGGAAGGAGAGGAAGGATGG - Intergenic
1002118840 5:176985710-176985732 CACAGGAAGCTGAGGTGGGAGGG - Intronic
1002570426 5:180136673-180136695 CACGGGGAGAGGAGGGGGGACGG + Intronic
1002909881 6:1481686-1481708 CAGGGAATGCAGAGGGAGGCTGG - Intergenic
1003276288 6:4655991-4656013 CACGTGAAGCAGAGGCTCGAGGG - Intergenic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1003662396 6:8074903-8074925 CACAGGAAGAAGCGGGAAGAGGG + Intronic
1003754390 6:9100461-9100483 GAGAGGAAGGAGAGGGAGGAAGG - Intergenic
1003867984 6:10381056-10381078 GAAGGGAGGCAGAGGAAGGAAGG - Intergenic
1003890069 6:10556143-10556165 ACGGGGAGGCAGAGGGAGGAGGG + Intronic
1004618812 6:17315438-17315460 TAAGGGAAGCAGGGGGTGGAAGG + Intergenic
1005016259 6:21377981-21378003 CAGGGGAAGGAGAGGGATGAGGG + Intergenic
1005152499 6:22768194-22768216 CTCGGGAGGCTGAGGGCGGAGGG + Intergenic
1006076167 6:31534115-31534137 CTTGGGAAGCTGAGGCAGGAGGG - Intronic
1006310818 6:33257905-33257927 CTTGGGAGGCTGAGGGAGGAGGG + Intronic
1006376957 6:33676994-33677016 CGCTGAAAGCAGAGAGAGGAAGG - Exonic
1006485269 6:34334696-34334718 TTTGGGAAGCTGAGGGAGGAGGG + Intronic
1006676141 6:35765010-35765032 CACGGGAGGTTGAGGCAGGAGGG + Intergenic
1006713899 6:36101328-36101350 CTTGGGAAGCTGAGGCAGGAGGG + Intronic
1006825089 6:36928771-36928793 CCCAGGGAGCAGAGGGAGGCAGG + Intronic
1006860425 6:37168961-37168983 CAAGGGAGGCAGAGGGTGGGGGG + Intergenic
1006936024 6:37718814-37718836 TTTGGGAAGCCGAGGGAGGAAGG + Intergenic
1007116956 6:39349557-39349579 CAGGGGGAGCAGTGGGTGGAAGG + Intronic
1007233926 6:40377093-40377115 CAGGAGAAAGAGAGGGAGGAGGG + Intergenic
1007372429 6:41434952-41434974 CACAGGAAGCGGAGGGGGGAGGG - Intergenic
1007485706 6:42179207-42179229 AAAGGGAATCAGGGGGAGGAGGG - Intronic
1007615808 6:43179371-43179393 AAGGGGAGGCTGAGGGAGGACGG - Exonic
1007692108 6:43709129-43709151 GAGGGGAAGGAGGGGGAGGAGGG - Intergenic
1007695799 6:43733777-43733799 CACGGGGAGAGGAGGGAGCAAGG + Intergenic
1007727739 6:43926869-43926891 CTCAGGCGGCAGAGGGAGGAGGG - Intergenic
1007730751 6:43944122-43944144 CATGGAGAGCAGAGAGAGGAAGG - Intergenic
1007899831 6:45400239-45400261 GAGGGGAGACAGAGGGAGGAAGG + Intronic
1008029744 6:46680951-46680973 TAGGGGAAGCAGTGGGAGAAAGG - Intergenic
1008145411 6:47885892-47885914 CCCGGGAGGCAGAGGTAGCAGGG - Intronic
1008543042 6:52562296-52562318 TAAGGGAAGCACAGGGAGAAAGG + Intronic
1009911241 6:69930708-69930730 CTCGGGAGGCTGAGGCAGGAGGG + Intronic
1010022064 6:71171872-71171894 CAAGGCAAGCAGAAGGAAGAAGG - Intergenic
1012490730 6:99780181-99780203 CACTGGAAGCAGAGGCAGGGTGG + Intergenic
1012976981 6:105791419-105791441 CACAGGCAGCAGAGGGAGGCTGG + Intergenic
1013044398 6:106470058-106470080 CTCGGGGACCAAAGGGAGGAGGG - Intergenic
1013223538 6:108101784-108101806 CTCAGGAAGCTGAGGTAGGAGGG - Intronic
1013294225 6:108744221-108744243 CAAGGGAAGCAAGGGAAGGAAGG + Intergenic
1013570356 6:111417547-111417569 CCAGTGAAGCAGAGTGAGGAGGG - Intronic
1013680375 6:112518884-112518906 CAGGGAAAGCAGAGGAAGAAAGG + Intergenic
1014693574 6:124591491-124591513 CATTGGAAGCAAAGGGAGGGAGG - Intronic
1016278064 6:142378648-142378670 GAAAGGAAGCAGAGAGAGGAAGG - Intronic
1016828846 6:148413756-148413778 TAAGGGGAGAAGAGGGAGGAAGG - Intronic
1017132191 6:151117080-151117102 CACAGGAGGCTGAGGCAGGAGGG + Intergenic
1017294287 6:152776152-152776174 CAGGGGGTGCAGTGGGAGGAGGG + Intergenic
1017348896 6:153416492-153416514 CAGGGAAAGCAGAGGAAGAAGGG + Intergenic
1018147825 6:160909546-160909568 CACGTGAAGCAGAGGAAAGCTGG + Intergenic
1018423277 6:163658547-163658569 AAAGGGAAGGGGAGGGAGGAAGG - Intergenic
1018573444 6:165233941-165233963 GGAGGGAAGCAGAGGCAGGAAGG - Intergenic
1018867734 6:167758941-167758963 GACGGGGGGCAGAGGGAGGAGGG - Intergenic
1018963454 6:168465241-168465263 CACAGAAAGCAGCGGCAGGATGG - Intronic
1018998203 6:168726036-168726058 CAGAGGAGGCAGTGGGAGGAGGG + Intergenic
1019109035 6:169694993-169695015 CCCGGCCAGCAGAGGGAGAAGGG + Intronic
1019142899 6:169959503-169959525 CAGGGGGAGAGGAGGGAGGAGGG - Intergenic
1019147055 6:169982256-169982278 CACGGGAAGGAAAGGAGGGAGGG + Intergenic
1019168369 6:170114623-170114645 CATCGCAAGAAGAGGGAGGAAGG - Intergenic
1019234395 6:170597537-170597559 GAAGGGAAGCAAAGGGAGGAAGG + Intergenic
1019302048 7:310435-310457 CTCGGGAGGCTGAGGCAGGAGGG - Intergenic
1019430767 7:997908-997930 CTCGGGCCGCAGTGGGAGGACGG - Intronic
1019464175 7:1177506-1177528 CTCAGGAAGCAGAAGCAGGAGGG - Intergenic
1019479785 7:1261224-1261246 CAGGGGACGGACAGGGAGGATGG + Intergenic
1019531083 7:1503872-1503894 CCCGGGCTGCAGAGCGAGGAGGG + Intronic
1019709646 7:2512342-2512364 AACGGGCTGCAGAGAGAGGACGG + Intergenic
1019776113 7:2913000-2913022 GGAGGGAAGAAGAGGGAGGAGGG + Intronic
1019788878 7:2997424-2997446 CAGGGGAGGCAGGGCGAGGATGG + Intronic
1019920839 7:4162473-4162495 CACGGGAGGCAGAGGTTGCAGGG - Intronic
1020080026 7:5282203-5282225 AAGGGGAAGGAGAGGGAGGGAGG + Intronic
1020131525 7:5561443-5561465 CACGGGAGGCAGAGGCTGCAGGG + Intronic
1020204478 7:6104628-6104650 CCAGGGAAGCACAGGGCGGAAGG + Intergenic
1022492637 7:30832583-30832605 CCCAGGAAACAGAGGGCGGAGGG - Intronic
1022665215 7:32404459-32404481 CCCAGGAGGCAGAGGCAGGAGGG - Intergenic
1023061339 7:36330191-36330213 CTCGGGAAGCTGAGGTGGGAGGG - Intronic
1023119984 7:36899407-36899429 CAGGTGAAGAAGAGGGAGAAGGG + Intronic
1023251680 7:38269992-38270014 CTCGAGAAGCTGAGGCAGGAGGG + Intergenic
1023402918 7:39803467-39803489 CTCGGGAGGCTGAGGTAGGAAGG - Intergenic
1023888534 7:44377006-44377028 CACGGGAGGGACAGGGAGGGAGG - Intergenic
1023911143 7:44557680-44557702 AAGGGGAAGGGGAGGGAGGAAGG + Intergenic
1023990301 7:45124646-45124668 CAGGGGAAGCTCAGGGAGAAAGG + Intergenic
1024118322 7:46213353-46213375 CTCAGGAAGCAGAAGGAGCAGGG + Intergenic
1024159915 7:46663516-46663538 CTGGGAAAGCAGAGGGAGTAAGG + Intergenic
1024242785 7:47448236-47448258 GAGGGGGAGCACAGGGAGGAGGG + Intronic
1024646714 7:51377175-51377197 CTCGGGAGGCTGAGGTAGGAAGG + Intergenic
1025198890 7:56950013-56950035 AAGGGGAAGGAGAGGGAGGGAGG - Intergenic
1025206950 7:56999190-56999212 CTCGGGAGGCTGAGGCAGGAAGG + Intergenic
1025664989 7:63577706-63577728 CTCGGGAGGCTGAGGCAGGAAGG - Intergenic
1025673056 7:63626920-63626942 AAGGGGAAGGAGAGGGAGGGAGG + Intergenic
1025977508 7:66380442-66380464 CTCGGGAAGCTGAAGTAGGAGGG + Intronic
1026557933 7:71423812-71423834 CCCAGGAAGCTGAGGAAGGAGGG + Intronic
1026825245 7:73577749-73577771 CATGGGAGGCCGAGGCAGGAGGG - Intronic
1026844536 7:73690791-73690813 GAAGGGAAGCTGTGGGAGGAGGG + Intronic
1027825658 7:83112131-83112153 CCCGGGAAGCAGAGGTTGCAGGG - Intronic
1028063473 7:86350747-86350769 CTCGGGAGGCTGAGGGAGAAAGG + Intergenic
1028176356 7:87664216-87664238 CCCAGGAAGCTGAGGCAGGAGGG + Intronic
1028718399 7:94000892-94000914 CTTGGGAAGCTGAGGGAGGCAGG + Intronic
1028844419 7:95463273-95463295 TTTGGGAAGCAGAGGCAGGAGGG - Intergenic
1028980922 7:96967336-96967358 GAAGGGAAGGAGAGGGAGAAAGG + Intergenic
1029369701 7:100141133-100141155 CTCGGGAGGCTGAGGCAGGAAGG - Intergenic
1029474718 7:100776208-100776230 CTCGGGAGGCTGAGGCAGGAGGG + Intronic
1029565786 7:101336804-101336826 CTCGGGAGGCTGAGGGAGGCAGG - Intergenic
1029631350 7:101752800-101752822 CTCAGGAAGCTGAGGTAGGAGGG - Intergenic
1030236620 7:107270367-107270389 CTTGGGAAGCTGAGGCAGGAAGG - Intronic
1030299177 7:107958068-107958090 AACAGGGAGCAGAGAGAGGAGGG - Intronic
1031493668 7:122420905-122420927 CTGGGGAAGGGGAGGGAGGATGG + Intronic
1031881015 7:127198780-127198802 CTTGGGAAGCTGAGGCAGGAGGG - Intronic
1032433675 7:131883005-131883027 AGAGGGAAGGAGAGGGAGGAAGG - Intergenic
1032646071 7:133825250-133825272 CTCGGGAGGCTGAGGCAGGAGGG + Intronic
1033195228 7:139321782-139321804 CTGGGGAAGCAGGGGAAGGAAGG - Intergenic
1033217878 7:139506743-139506765 CTCGGGAGGCTGAGGCAGGAGGG + Intergenic
1033568823 7:142606931-142606953 CTCGGGAAACTGAGGCAGGAGGG + Intergenic
1033582702 7:142751619-142751641 CATGGGCAGCAGAGGGATGTGGG - Intronic
1034399485 7:150852653-150852675 AACAGGACACAGAGGGAGGAGGG + Intronic
1034431102 7:151041560-151041582 CACCTCAAGCAGAGGGAGAACGG - Intronic
1034435140 7:151059792-151059814 CCAGGGCCGCAGAGGGAGGAAGG + Intronic
1034533698 7:151713685-151713707 CTCAGGAAGCTGAGGCAGGAGGG - Intronic
1034605276 7:152307180-152307202 GAAGGAAAGAAGAGGGAGGAAGG + Intronic
1034622132 7:152464234-152464256 CCCGGGAAGCCGCGCGAGGACGG - Intergenic
1034918836 7:155062283-155062305 CAGGAGAAGGGGAGGGAGGAGGG + Intergenic
1035553549 8:546361-546383 CGCGGGACGCACAGGGAGGGCGG + Intergenic
1035572973 8:686050-686072 CTCGGGAGGCTGAGGCAGGAGGG + Intronic
1036963165 8:13268490-13268512 CTCGGGAAGCTGAGGTGGGAGGG - Intronic
1037026155 8:14040619-14040641 GAGGAGAAGCAGAGGGAGCAGGG + Intergenic
1037579837 8:20238629-20238651 CTCAGGAAGCAGGGGGAGGCAGG + Intergenic
1037656173 8:20886042-20886064 GGAGGGAAGGAGAGGGAGGAGGG + Intergenic
1038379552 8:27079860-27079882 TACTTGAAGCAGAGAGAGGATGG - Intergenic
1039272767 8:35900849-35900871 CACGGGAAGAAAAGGAAGGATGG - Intergenic
1039840014 8:41286446-41286468 CAAGGGAGGCAGAGGGAGTGTGG + Intronic
1040006834 8:42628132-42628154 CAGGGGGAGCAGAGGGACCAGGG - Intergenic
1040089904 8:43387129-43387151 CCCGGGAAGCAGAGGTTGTAGGG - Intergenic
1040481123 8:47828085-47828107 CACGGGAAACATAGTGATGATGG + Intronic
1040695087 8:49986771-49986793 CTCGGGAGGCAGAGGTGGGAGGG + Intronic
1040832391 8:51691814-51691836 CCCGGCCAGCAGAGGGAGGAAGG + Intronic
1041005344 8:53492569-53492591 CAAGGGAAGCAACGGGAGGTAGG + Intergenic
1041225429 8:55692726-55692748 ATCAGGAGGCAGAGGGAGGATGG - Intergenic
1041268086 8:56084336-56084358 CTCGGGAGGCTGAGGCAGGAGGG + Intergenic
1041330656 8:56720101-56720123 CTCAGGAAGCACAGGGAAGAAGG - Intergenic
1041457018 8:58072008-58072030 CACAGCAGGCAGAGGGAGGGAGG - Intronic
1041646934 8:60262608-60262630 CTCAGGAAGCTGAGGCAGGAGGG + Intronic
1041893814 8:62901360-62901382 CATGGGAAGCTGAGGCAGGAGGG + Intronic
1042138153 8:65652047-65652069 CATGGGAGGCTGAGGCAGGAGGG - Intronic
1042139721 8:65665729-65665751 CTCAGGAAGCTGAGGGAGGAGGG - Intronic
1042903953 8:73754541-73754563 CACTGGATGCACAGAGAGGATGG - Intronic
1043403091 8:79902922-79902944 CCCGGGAAGCAGAGGTTGCAGGG - Intergenic
1043489697 8:80736690-80736712 CAGGGGAAATAGTGGGAGGAGGG + Intronic
1044473263 8:92597155-92597177 CACTGGAAGGAGAGGGAGGGAGG + Intergenic
1045130021 8:99140648-99140670 GACGGGGAGGAGGGGGAGGAAGG - Intronic
1045211781 8:100106455-100106477 CCCGGGAAGCGGAGGAAGCAGGG + Intronic
1045582620 8:103498531-103498553 CCTGGGGAACAGAGGGAGGAGGG + Intergenic
1046654865 8:116882307-116882329 CTTGGGAGGCAGAGGTAGGAGGG - Intergenic
1046993358 8:120486649-120486671 TATTGGAAGCCGAGGGAGGAGGG + Intronic
1047966927 8:130051829-130051851 CAGGGCAAGAAGAGGGTGGAGGG - Intergenic
1048297717 8:133226974-133226996 CACGAGAGGCAAAGGCAGGAGGG + Intronic
1048327807 8:133452432-133452454 CACAGGCATCAGAGGGAGGGAGG + Intergenic
1048643163 8:136387345-136387367 AAGGAGAAGCAGAGGGAGTATGG - Intergenic
1049009029 8:139875154-139875176 CGGGGGAAGAAGAGAGAGGAGGG + Intronic
1049062579 8:140287363-140287385 GAGACGAAGCAGAGGGAGGAGGG + Intronic
1049243508 8:141550361-141550383 CACATGCAGCAGAGGGAGCAGGG + Intergenic
1049388186 8:142354774-142354796 CACGAAAAGCAGGGGGAAGAGGG + Intronic
1049407411 8:142457878-142457900 TACCGGAAGCAGAGGCAGCACGG - Intronic
1049492726 8:142913756-142913778 CAATGGAAGCAGAGGGAGCTGGG - Intronic
1049552379 8:143266635-143266657 CACGCGGAGCAGAGGGCGGGGGG - Intronic
1049672950 8:143877859-143877881 CGTGGGAGGCAGAGGCAGGAAGG - Intronic
1049840385 8:144767317-144767339 CATGGGAAGCAGAGGTGGGAGGG - Intergenic
1049949169 9:627699-627721 CAGGGGGACCAGAGGGTGGATGG + Intronic
1050995924 9:12217651-12217673 CCCGGGAGGCAGAGGGTGCAGGG - Intergenic
1051241085 9:15056677-15056699 CTCGGGAGGCTGAGGCAGGAAGG + Intergenic
1051242159 9:15069827-15069849 CTCGGGAGGCCGAGGCAGGAGGG + Intergenic
1051901294 9:22044689-22044711 CACAGGAAGGAGGGGGAGGGAGG - Intergenic
1052964505 9:34329580-34329602 CACCCGAAGCAGAAGGAGGTAGG - Exonic
1053014482 9:34654202-34654224 AAGGGGGAGCAGAAGGAGGAAGG - Intronic
1053049321 9:34945669-34945691 TACAGGAGACAGAGGGAGGAAGG - Intergenic
1053175661 9:35921203-35921225 CTCGGGAGGCTGAGGAAGGAGGG - Intergenic
1053219101 9:36296671-36296693 GAAGGGAAGCAGAGGGTGGAAGG + Intronic
1053662144 9:40291471-40291493 CTGGGGATGCAGAGAGAGGAGGG - Intronic
1053912590 9:42921639-42921661 CTGGGGATGCAGAGAGAGGAGGG - Intergenic
1054374270 9:64437712-64437734 CTGGGGATGCAGAGAGAGGAGGG - Intergenic
1054522466 9:66084813-66084835 CTGGGGATGCAGAGAGAGGAGGG + Intergenic
1055053379 9:72001290-72001312 AAGGGGATGCAGAAGGAGGATGG + Intergenic
1055442934 9:76354272-76354294 CAATGGGAGCAGAGGGAGGGGGG + Intronic
1055571427 9:77621039-77621061 CATGGGAAGCTGAGGTGGGAGGG - Intronic
1055892110 9:81134541-81134563 TTGGGGAAGCTGAGGGAGGAGGG - Intergenic
1056165547 9:83937409-83937431 GAAGGGAAGAAGAAGGAGGAGGG + Intergenic
1056707730 9:88966311-88966333 CTTGGGAAGCTGAGGCAGGAGGG - Intergenic
1056954573 9:91072053-91072075 GAAGAGAAGCAGAGGGAGGGAGG + Intergenic
1058297443 9:103326890-103326912 CAGGAGAAGCAGAGGGAGCAGGG - Intergenic
1058478141 9:105361941-105361963 CTCGGGAGGCAGAGGTGGGAGGG + Intronic
1058711524 9:107683468-107683490 AAGGGGATGCAGAGGGAGAAGGG - Intergenic
1059175267 9:112164437-112164459 CTCGGGAGGCTGAGGCAGGAGGG + Intronic
1059438079 9:114288452-114288474 CAGGGGGAGCAGGGCGAGGACGG + Exonic
1059678180 9:116560462-116560484 AACAAGAAGAAGAGGGAGGAAGG - Intronic
1059806404 9:117805791-117805813 TAAGGGAAGGAGAGGGAGGGAGG - Intergenic
1059807646 9:117820984-117821006 CACTGGAAGCTGAGGGAGCAAGG + Intergenic
1060199449 9:121644061-121644083 CTCGGGAGGCTGAGGCAGGAGGG + Intronic
1060720915 9:125976787-125976809 GGAGGGAAGGAGAGGGAGGAAGG - Intergenic
1060800372 9:126540814-126540836 CTCGGGAGGCTGAGGCAGGATGG + Intergenic
1060903064 9:127278761-127278783 CACGGCCCTCAGAGGGAGGATGG - Intronic
1060979145 9:127782826-127782848 GACGGGAAGCATAGGAGGGAAGG - Intergenic
1061188775 9:129070102-129070124 CAGAGGAAGCAGTGGGAGGGAGG + Intronic
1061219640 9:129242767-129242789 CAAGGACAGCTGAGGGAGGATGG + Intergenic
1061233473 9:129328444-129328466 CCCTGGAAGGGGAGGGAGGAAGG + Intergenic
1061611794 9:131751566-131751588 CTTGGGAAGCTGAGGCAGGAGGG + Intergenic
1061628438 9:131856242-131856264 CACGGGAAGCATTGGCAAGACGG + Intergenic
1061630104 9:131866963-131866985 CACGCGAAGGAGAGGGGGAAAGG - Intronic
1061820736 9:133226029-133226051 TGCAGGAAGCCGAGGGAGGAGGG + Intergenic
1062043073 9:134412907-134412929 CACAGGAAGCAAAGGCAGGCAGG - Intronic
1062291631 9:135797858-135797880 CTTGGGAAGCAGAGGAAAGAGGG - Intergenic
1062343277 9:136103306-136103328 CACTGGAAGAAGGTGGAGGAGGG - Intergenic
1062596766 9:137303025-137303047 CGTGGGCAGCAGAGGGAGGCAGG - Intergenic
1185448561 X:271233-271255 CCCAGGACACAGAGGGAGGAAGG + Intergenic
1185485831 X:481466-481488 CGGAGGAAGGAGAGGGAGGAAGG + Intergenic
1185485896 X:481690-481712 CGGAGGAAGGAGAGGGAGGAAGG + Intergenic
1185485972 X:481949-481971 CGGAGGAAGGAGAGGGAGGAAGG + Intergenic
1185511620 X:668215-668237 AAAGGGGAGGAGAGGGAGGAGGG - Intergenic
1185603620 X:1355037-1355059 GAAGGGGAGCAGATGGAGGAAGG + Intronic
1185661916 X:1735173-1735195 GAAGGGAAGGAGGGGGAGGAGGG - Intergenic
1186479020 X:9881716-9881738 TCGGGGAGGCAGAGGGAGGAAGG - Intronic
1186492868 X:9988185-9988207 CTCAAGAAGCTGAGGGAGGAGGG + Intergenic
1187474654 X:19600274-19600296 CTCGGGAGGCTGAGGCAGGAGGG + Intronic
1187515775 X:19968562-19968584 CACGGGACCCAGAGGGTGGGGGG + Intronic
1187565332 X:20443964-20443986 CATGGCAAGGAGAGGGAAGAAGG + Intergenic
1187576224 X:20559173-20559195 CAAGGGAAGGAGAAGGAGAAGGG - Intergenic
1188623216 X:32251874-32251896 CCCAGGAAGCTGAGGTAGGAGGG + Intronic
1189230795 X:39451036-39451058 AAGGGGAAGCAGAGGGAGGAAGG - Intergenic
1189470963 X:41313827-41313849 CTTGGGAAGCTGAGGCAGGAGGG + Intergenic
1190196144 X:48320146-48320168 CATGGGAGGCTGAGGCAGGAGGG + Intergenic
1190270168 X:48856776-48856798 CTCGGGAGGCTGAGGCAGGAGGG + Intergenic
1190619076 X:52266989-52267011 AAGGGGAGCCAGAGGGAGGAAGG + Intergenic
1190637099 X:52446146-52446168 AAGGGGAGCCAGAGGGAGGAAGG - Intergenic
1190662850 X:52670493-52670515 CATGGGAGGCTGAGGCAGGAGGG + Intronic
1190676573 X:52787989-52788011 CATGGGAGGCTGAGGCAGGAGGG - Intronic
1192368562 X:70495351-70495373 GACGGGGAGAAGAGGGGGGAAGG - Intronic
1192546670 X:72019961-72019983 CAGAGGAAGCAGATGGAGAAGGG - Intergenic
1196063601 X:111438156-111438178 CATGGGAGGCTGAGGCAGGAGGG + Intergenic
1196900307 X:120375858-120375880 CTCGGGAGGCTGAGGAAGGAGGG + Intronic
1196922641 X:120600427-120600449 CCCGGGAAGCAGAGGGTGCAGGG + Intronic
1197112109 X:122788809-122788831 CTCGGGAGGCAGAGGCAGGAGGG - Intergenic
1197775485 X:130116225-130116247 CTCGGGAGGCTGAGGTAGGAGGG - Intergenic
1198069133 X:133130518-133130540 CTGGGGCAGGAGAGGGAGGAGGG + Intergenic
1198801552 X:140452791-140452813 CAGGGGTAGCAGAGGCAGGAAGG + Intergenic
1198827117 X:140711128-140711150 CACTGGAAGCACAGAGAGGAAGG - Intergenic
1199846718 X:151697024-151697046 GAAGGGAAGGGGAGGGAGGAAGG - Intronic
1200039533 X:153355473-153355495 CACAGGGAGCCCAGGGAGGAGGG - Intronic
1200149256 X:153943316-153943338 CACAGGGAGCCCAGGGAGGAGGG + Intronic
1200210555 X:154345053-154345075 CGCGGGAAGAACAGCGAGGAGGG + Intergenic
1200220297 X:154387039-154387061 CGCGGGAAGAACAGCGAGGAGGG - Intergenic
1200419563 Y:2950157-2950179 CTTGGGAAGCTGAGGTAGGAAGG - Intronic
1201290701 Y:12419663-12419685 CTAGGGAAGCTGAGGTAGGAGGG - Intergenic
1201382097 Y:13392058-13392080 CAGGGGCTGAAGAGGGAGGATGG + Intronic
1201551598 Y:15222703-15222725 CTCAGGAAGCTGAGGTAGGAAGG - Intergenic
1201782220 Y:17736203-17736225 CACGGGAGGCTGAGGCAGAATGG - Intergenic
1201819333 Y:18169785-18169807 CACGGGAGGCTGAGGCAGAATGG + Intergenic
1201897177 Y:19004376-19004398 CTGGGAAAGCAGAGTGAGGAGGG + Intergenic