ID: 1131396751

View in Genome Browser
Species Human (GRCh38)
Location 15:92092345-92092367
Sequence GGGAAGAAGGGCTATGATTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 221}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131396751 Original CRISPR GGGAAGAAGGGCTATGATTA TGG Intronic
903042128 1:20538859-20538881 GTGAAGATTGGCTATGATAAAGG + Intergenic
904407787 1:30304645-30304667 GGGAAGAAGGACGATCATCAAGG + Intergenic
905369889 1:37477326-37477348 GGGAGGAGGGGCTGTGATGAGGG + Intronic
907641170 1:56191847-56191869 GGGGAGAAAGGCTATTATTTGGG - Intergenic
907699742 1:56773963-56773985 AGGGTGAAGGGCTATGAGTAGGG - Intronic
909724564 1:78818825-78818847 GGGAAGAATGGAAATCATTATGG - Intergenic
910604549 1:89068595-89068617 GGGAAGAAGGGGTTTTATTTTGG + Intergenic
910717166 1:90244736-90244758 GGGAAGAGGGGCCGTGATGAAGG - Intergenic
912933399 1:113983272-113983294 GGGAAGGAGGGCTGTGCTTTGGG - Intergenic
913964254 1:143362138-143362160 GGGAAGAAGGGAAAGGAATAGGG - Intergenic
914058623 1:144187741-144187763 GGGAAGAAGGGAAAGGAATAGGG - Intergenic
914120526 1:144778630-144778652 GGGAAGAAGGGAAAGGAATAGGG + Intergenic
914343191 1:146777169-146777191 GGGAGGAAGGGCTGAGATTTGGG - Intergenic
914450647 1:147788373-147788395 GGGAAAGAGGGATATGAATATGG + Intergenic
914764007 1:150622228-150622250 GGGAAGAAGGGCAGTGAGTGTGG - Intronic
918081589 1:181211829-181211851 GGGCTGAAGGGCTTTGATGAAGG - Intergenic
918081806 1:181213627-181213649 GGGAAGAAGGACTAACAGTAAGG + Intergenic
920452255 1:206068352-206068374 GGGAAAAGGGGCTAAAATTATGG + Intronic
924202724 1:241676285-241676307 AGAAAGAAGGTCTATGATTCGGG - Intronic
924417003 1:243866122-243866144 GGGGAGAGGGGCTATGATTGGGG - Intergenic
1063235152 10:4106628-4106650 TGGAACAAGGGCTATCCTTATGG - Intergenic
1064865350 10:19872766-19872788 GGCAAAGAGGGCTATGATCATGG + Intronic
1065370253 10:24976989-24977011 TGGAAGAGGGGCTATGGATATGG - Intergenic
1065442949 10:25771182-25771204 GCGAAGAAAGGCTGGGATTAAGG + Intergenic
1067980535 10:51079394-51079416 TTGAAGAAGGGCTATGATTTAGG + Intronic
1069795018 10:71046450-71046472 GGGATGAAGGGAGAAGATTAGGG - Intergenic
1072975521 10:100054192-100054214 GGAAAGAAGGGCAATGAAAATGG - Intronic
1073603238 10:104867259-104867281 TGGAAGCAGGGCTGGGATTAGGG + Intronic
1076363187 10:129904373-129904395 GGGATACAGGGCTATGAATATGG + Intronic
1076435366 10:130437590-130437612 GGGAAGAAGGGATGTAAGTAGGG - Intergenic
1077038428 11:506689-506711 GGGAATAAGGTCAAGGATTACGG + Intronic
1077798959 11:5519057-5519079 AGGAAGATGGGCTATGGTGATGG - Intronic
1077943829 11:6873189-6873211 GGGAAGTAGGGCTAGGGTTAGGG + Intergenic
1078080536 11:8201580-8201602 GAGAAGGAGGGCTTTGTTTAGGG - Intergenic
1079470932 11:20776712-20776734 GGGAAGAAGGGATATTAGTTAGG + Intronic
1081503217 11:43687689-43687711 GGCAAGAAGGGCAATGAGCAGGG + Intronic
1081550459 11:44107047-44107069 GGGAAGGAGGGCTCTGACCAAGG - Intronic
1082627937 11:55506778-55506800 GGGAAGAAGGGTGATTTTTAAGG - Intergenic
1082962994 11:58936931-58936953 AGGAAGAAGGGGGATGTTTAGGG - Intronic
1083484608 11:62975477-62975499 GGGAGGAAGGGAGATGATCATGG - Intronic
1083735456 11:64677713-64677735 GGGAACAAGGGCTGTGAGGAGGG + Intronic
1083991754 11:66250451-66250473 GGGAAGATGGGATCTGAGTAGGG - Intergenic
1084057705 11:66647274-66647296 GGGAAGTTGGGTTATGATGATGG + Intronic
1084559178 11:69893105-69893127 GGGAAGAAAGGCTCTGAGTTGGG + Intergenic
1086138107 11:83463114-83463136 GGCAAGAAGGGATGTGCTTAAGG + Intronic
1088174174 11:107032297-107032319 GGGAAGAAGGGACAAGATCAAGG + Intergenic
1090627165 11:128617446-128617468 GGGAGAAAGGGTGATGATTAGGG + Intergenic
1093181880 12:15976164-15976186 GGGAAGAAGGGGTATAAATATGG - Intronic
1093864452 12:24208280-24208302 GGAAAGTAGGGTGATGATTAGGG - Intergenic
1094313600 12:29113547-29113569 TGGAACAAGGGCCACGATTAGGG + Intergenic
1094638919 12:32254279-32254301 GGGAATATGGGCAGTGATTATGG - Intronic
1096982809 12:55738073-55738095 AGGAAGAAGAGATAGGATTAGGG + Intergenic
1098044724 12:66388712-66388734 GGAAAGAAGGGATATGTTTAAGG - Intronic
1098868182 12:75785782-75785804 GGGCAAAAGGGATATGATCAGGG + Intergenic
1100480204 12:94970602-94970624 GGAAAGAAATGCTAGGATTATGG - Intronic
1101862647 12:108495517-108495539 GGGATGCAGGGATATGAGTAGGG + Intergenic
1102925424 12:116822284-116822306 GGGAAGCAGGGCCATCATTTTGG + Intronic
1103364423 12:120370889-120370911 GGGAAGGAGGGCTATCAAGAGGG - Intergenic
1104162481 12:126193070-126193092 GGTAAGCAGGGCTGTGATCATGG + Intergenic
1107241964 13:38247098-38247120 GTGAAGAAGGGCAATGATCTGGG - Intergenic
1111875660 13:93891441-93891463 TGGATGAAGGGCTATGAAGAAGG - Intronic
1112657024 13:101462191-101462213 GGTAAGAAGGGATGTGATGATGG - Intronic
1112798206 13:103080754-103080776 GGGAAGAAGAGCTATGAGAAAGG - Intergenic
1114319308 14:21533957-21533979 GGGAGGAAGGGCTCTTATTTAGG - Intronic
1115141014 14:30170658-30170680 GGAGGGAAGGGCTATGATAAGGG + Intronic
1115511093 14:34138668-34138690 GGGAAAACAGGCTAAGATTATGG + Intronic
1119288745 14:73477441-73477463 GGGAAGAAAGGATGTGATTAGGG + Intergenic
1202928399 14_KI270725v1_random:15291-15313 GATAAGAAGGGGTAGGATTATGG + Intergenic
1123983238 15:25622380-25622402 GGGAACATGGGCTGTGATTCAGG - Intergenic
1125248178 15:37666900-37666922 GGAAAGAAGTGCCATGATTCTGG + Intergenic
1125591404 15:40856743-40856765 GGGAAGAAGGGGTAGAATAAGGG - Intronic
1129032868 15:72630870-72630892 GGGCAGAAGGGGCATGATTGGGG + Intergenic
1129407667 15:75329690-75329712 GGGCAGAAGGGGCATGATTGGGG + Intergenic
1129737583 15:77974802-77974824 GGGAAGAAGGGCAAAGGTGATGG - Intergenic
1130253439 15:82315133-82315155 GGGAAGAAGGGCAAAGGTGATGG - Intergenic
1131014896 15:89050133-89050155 GGGCAGAGGGGCTATGAGGAGGG + Intergenic
1131396751 15:92092345-92092367 GGGAAGAAGGGCTATGATTATGG + Intronic
1133492439 16:6283362-6283384 GGAAAGAATGGCTAGGCTTAAGG - Intronic
1137880124 16:52037333-52037355 GGGAAAAAGGGCAAAGAGTAAGG + Intronic
1138068253 16:53964398-53964420 AGGAGGAAGGGTTATGTTTAAGG + Intronic
1139990800 16:70938158-70938180 GGGAGGAAGGGCTGAGATTTGGG + Intronic
1140406246 16:74713500-74713522 GGGGAGAAGGGCTGTGATTCTGG + Exonic
1140819044 16:78646375-78646397 GGAAAGAAGGGCTAAGATGGAGG - Intronic
1141041129 16:80673642-80673664 GGGAAGAAAGGGTATGCATATGG - Intronic
1141427974 16:83955930-83955952 GGCAAGAAAGGCTATGCTCAAGG + Intronic
1143873397 17:9974089-9974111 GGGAACAAGGGATTGGATTAGGG - Intronic
1146267273 17:31461088-31461110 GGCAGCAAGGGCTATGAGTAGGG - Intronic
1147216283 17:38900978-38901000 GGGAAGATGGTCTTAGATTATGG + Intronic
1148606450 17:48932798-48932820 GGGAAGATGGCATATGCTTAAGG + Intronic
1148770025 17:50061179-50061201 GGGATGTAGGGCTGGGATTAGGG + Intronic
1148871797 17:50662809-50662831 GGGAGGCCTGGCTATGATTATGG + Intronic
1151124283 17:71828187-71828209 GGGAAGTAGGGCTCTCCTTAGGG - Intergenic
1153144520 18:2015450-2015472 GGTACGAGGGGTTATGATTAGGG - Intergenic
1153465764 18:5386457-5386479 GGGAAGGAGGGTTGTGATAAGGG - Intergenic
1156916623 18:42469795-42469817 GGGCAGAAGGGCCAAGATTGAGG - Intergenic
1159712993 18:71786451-71786473 GGGAAGAAAGGCTATTGTTGAGG - Intronic
1159788818 18:72750824-72750846 GGGAGGGAGGGCTATTTTTAAGG - Intronic
1159889487 18:73940484-73940506 GGGAGGAAGGGCTAAGAGTAAGG - Intergenic
1162904709 19:13816875-13816897 GGGAATAAGGGCAATGAGGAGGG + Intronic
1167685115 19:50951082-50951104 GGAAAGAAGGGCTCAGCTTAGGG + Intronic
1168283995 19:55321424-55321446 GGGAAGAAGGGCTGGCATTCGGG + Intronic
1168284291 19:55322701-55322723 GGGAAGAAGGGCTGGCATTCGGG + Exonic
1202698025 1_KI270712v1_random:139629-139651 GGGAAGAAGGGAAAGGAATAGGG - Intergenic
927090294 2:19705498-19705520 GGGAACCAGGGCAATGATAAAGG - Intergenic
928756046 2:34526829-34526851 GGGAGGAAGGGAGAAGATTAGGG + Intergenic
929432285 2:41897418-41897440 GGGTAGAAGGGCTGTGATTCAGG + Intergenic
929541121 2:42823073-42823095 GGGGAGAAGGGCAAGGATTCAGG - Intergenic
929733005 2:44515642-44515664 GGGAAGAAGGATTATCATTTCGG + Intronic
929826557 2:45313445-45313467 GGTAAGAAGGGTTAGGATTTGGG + Intergenic
929858962 2:45659207-45659229 AGGAAGAAGGGCTTAGATTGAGG - Intronic
931711778 2:64993995-64994017 GGGAAGAAGAGGAATGTTTAGGG + Intronic
933365948 2:81354119-81354141 TGGAAGAAGGGAAAGGATTAGGG + Intergenic
933591514 2:84238149-84238171 AGGAGGAAGGGCTATGACAAGGG - Intergenic
934279279 2:91597409-91597431 GGGAAGAAGGGAAAGGAATAGGG - Intergenic
935222936 2:101030451-101030473 GGTAAGAAGTGGTATAATTATGG - Intronic
935808996 2:106776953-106776975 GGTAAGAAGAACTATGATGATGG - Intergenic
936116542 2:109707404-109707426 GGGAAGCAGTGCTAAGATTATGG + Intergenic
938888868 2:135682284-135682306 GGGAAGAGGGGCTTTCATAAGGG + Intronic
940285741 2:152031631-152031653 GGGGAGAAAGCCTAGGATTAAGG - Intronic
944005774 2:194903394-194903416 GGGTAGAAAGTCTATGATGAAGG - Intergenic
944595939 2:201260654-201260676 GGGAGGAAGGCCTTTGATTCTGG + Intronic
945802608 2:214451564-214451586 GCCAAGAAGGGCTATTCTTAAGG + Intronic
946443609 2:219718619-219718641 GGGAAGCAGGGTTCTCATTAAGG + Intergenic
948614944 2:239192330-239192352 GGGAAGAAAGGAAATGAATAGGG - Intronic
1170018270 20:11807722-11807744 GGGAAAAAGGTCATTGATTATGG - Intergenic
1172945216 20:38682273-38682295 GGGAGGAAGGGACATGATTGGGG + Intergenic
1173343236 20:42173755-42173777 AAGAAGAAGGGATATAATTATGG + Intronic
1173558659 20:43985945-43985967 GGGAAGGAGGGCTCTGAGGAAGG + Intronic
1173892947 20:46527456-46527478 GGGAACCAGTGCTAGGATTAGGG + Intergenic
1174540082 20:51282338-51282360 GGGAAGACCGGCTAGGATGAAGG - Intergenic
1174797291 20:53532827-53532849 GTGATTAAGGGCTAAGATTAGGG + Intergenic
1175710044 20:61212336-61212358 AGGAACATGGGCTATGACTATGG + Intergenic
1176590427 21:8643934-8643956 GATAAGAAGGGGTAGGATTATGG + Intergenic
1180273255 22:10620967-10620989 GATAAGAAGGGGTAGGATTATGG + Intergenic
1183011496 22:34950478-34950500 GGCAAGAAGGTCTAAGATTAAGG - Intergenic
1183054240 22:35292770-35292792 AAGAAGATGGGCTAGGATTACGG + Intronic
1183659178 22:39208317-39208339 GGGGACAAGGGCTCTGATGAGGG + Intergenic
949136855 3:577741-577763 GATAAGAAGGGGTAGGATTATGG - Intergenic
949233832 3:1784538-1784560 GGGAAGAAGGGAAAGGAATATGG + Intergenic
949387348 3:3517792-3517814 GGAAAGAAGGATTATGGTTAGGG + Intergenic
950105323 3:10384891-10384913 GGGAAGAAGGCCTGGGATCAGGG - Intronic
951320640 3:21240363-21240385 GGGAAGATAAGCTATGATGAGGG - Intergenic
951484231 3:23194092-23194114 GGGAAGAAGGTCTATGACTAAGG - Intergenic
953666171 3:44927993-44928015 GGGAAGAACGGCTAGGACTGGGG + Intronic
956388936 3:68751083-68751105 GGGGAGGAGGGCAATGATTCAGG + Intronic
957050260 3:75406242-75406264 GGGAAGAAGGGCAATAATCTTGG + Intergenic
959255696 3:104010048-104010070 AGGAATAAGGGATATGACTATGG - Intergenic
960608346 3:119531421-119531443 GGGACAAAAGGCTATGGTTATGG - Intronic
960884183 3:122377428-122377450 GCGAAGGAGGCCAATGATTAAGG + Intronic
962975572 3:140442969-140442991 GGGATGAATGGCTTTGATTTGGG - Intronic
964852187 3:161106318-161106340 GTGAAGAATGGCTGTGATAAAGG - Intronic
966254642 3:177904017-177904039 GGGCAGGAGAGCTATAATTAAGG + Intergenic
966266711 3:178054842-178054864 GGGGAGAAGGGAAGTGATTAGGG - Intergenic
967390581 3:188950265-188950287 GAGAAGAAGGGGTAGGATTGTGG - Intronic
967561554 3:190923389-190923411 GTGAAGAGAGGCTGTGATTAAGG - Intergenic
967624478 3:191668914-191668936 GCGAAGAGAGGCTGTGATTAAGG + Intergenic
967727017 3:192871584-192871606 GGGAAGAAGGTCAAAGAATAAGG + Intronic
969031476 4:4218484-4218506 GGGAAGAAGGGAAAGGAATAGGG + Intronic
969048840 4:4358244-4358266 GGGAAGAAGAGCAAGGATTCTGG + Intronic
969715039 4:8864247-8864269 GGAGAGAAGGGGTGTGATTACGG + Intronic
970867859 4:20779743-20779765 AGGAGGAAGGGATATGATGATGG + Intronic
971643871 4:29171038-29171060 GGCAAGAAGCTCTATGATAAAGG + Intergenic
972298380 4:37761954-37761976 AGGAATAAGGGGAATGATTATGG - Intergenic
975627283 4:76362684-76362706 TAGAAGCAGGGCTATGACTAGGG + Intronic
975800698 4:78057176-78057198 GGGTAGAGGTGCAATGATTACGG - Intergenic
976486013 4:85606001-85606023 GGGAAGAAGGGAGATGAAGATGG - Intronic
977725972 4:100297429-100297451 TGGAAGATGGGCTTTGATAAAGG - Intergenic
980694365 4:136336808-136336830 GGGAGGGAGAGCAATGATTAGGG + Intergenic
981477602 4:145203319-145203341 GGGTAGGAGTGGTATGATTACGG - Intergenic
983587985 4:169376089-169376111 GGGAAGAAGGGCTACTCTAAAGG - Intergenic
984112957 4:175643089-175643111 GGGAAGAATCGGTCTGATTATGG - Intronic
984361545 4:178741314-178741336 GGGAAGAGGGCCTATGAAGAGGG + Intergenic
984555300 4:181206675-181206697 GGTAAAAAGAGCTATGATCAAGG - Intergenic
985427367 4:189843889-189843911 GGGAAGAAGGGAAATGAGCAAGG - Intergenic
985668233 5:1192873-1192895 GGGAGGAAAGGCTGTGAGTAGGG + Intergenic
985668339 5:1193288-1193310 GGGAGGAAAGGCTGTGAGTAGGG + Intergenic
993503380 5:88685414-88685436 GGGACCAGGGGCTATGACTAAGG - Intergenic
996728807 5:126697482-126697504 GGCTAGAAGGTCTAAGATTAAGG + Intergenic
998722005 5:144963201-144963223 GGGAAGAAGGCCTCTCAATAAGG - Intergenic
998868032 5:146524972-146524994 GGGAAGAAGGGGCATGCTTTAGG + Intergenic
999363059 5:151002430-151002452 GGGAAGACAGGCTAAGATTTAGG + Intergenic
1000925176 5:167185217-167185239 GGAGAGAAGGGCCATAATTAGGG + Intergenic
1001010131 5:168089996-168090018 CAGCAGAAGGGCTATGATGAGGG - Intronic
1001436889 5:171706117-171706139 GAGAAGCAGGGCTATGACTAGGG - Intergenic
1003223910 6:4187902-4187924 GAGAAGAAGGGATAAGATTAAGG + Intergenic
1004246043 6:13977058-13977080 TTGAAGAATGGCTTTGATTAAGG - Exonic
1004791331 6:19029592-19029614 GGGAAGAGATGCTATGATTCAGG + Intergenic
1006179503 6:32146116-32146138 GGGAAGGAGGTCTAAGATTTGGG + Intergenic
1006459562 6:34150497-34150519 GGGCAGAAGGGCTGTGAGTGGGG + Intronic
1008086460 6:47250339-47250361 GGGAAGAATAGCTATGATTCTGG + Intronic
1008301751 6:49849474-49849496 GGGAAGAAAGGCTTTCATGAGGG - Intronic
1011534639 6:88363015-88363037 GGAAAGAATGGCCATGAATATGG + Intergenic
1011559330 6:88598991-88599013 TGGAAGAAGGGCCATCATCATGG - Intergenic
1013159499 6:107528072-107528094 GGGAAGAAGGGCTGAGGATAGGG - Intronic
1013632259 6:111996999-111997021 GGGAAGAAGTGATATGGTTGGGG + Intergenic
1013763623 6:113548759-113548781 GGGAAGATGGTCTTTGTTTATGG + Intergenic
1013964052 6:115934501-115934523 GGGAAGGAGGGCAATGCTGATGG + Exonic
1015568161 6:134595104-134595126 GGGAAGGAGGGCAAGGCTTAGGG + Intergenic
1015646346 6:135393169-135393191 GGGAAAGAGGGATATGATAAAGG - Intronic
1015716906 6:136202331-136202353 GGGACGAAGGCCTGTGATGATGG - Intergenic
1016829428 6:148418858-148418880 TGGAAGAAGGGTTATGATTTGGG - Intronic
1022382765 7:29875547-29875569 GGAAAGAGGGGCTATGATTTAGG + Intronic
1022552783 7:31257361-31257383 GGAAAGAAGAGCTATGAAGAGGG + Intergenic
1023292941 7:38686635-38686657 AGAAAGAAGGGCTATGAGGAGGG + Exonic
1025023419 7:55497370-55497392 GGGAAGAAGAGCTCTGCTTCTGG - Intronic
1026157035 7:67835212-67835234 AGGAAGAAGGGCTAGCACTAAGG - Intergenic
1028154068 7:87409495-87409517 GGGGAGAAAGGGGATGATTAAGG - Intronic
1028874016 7:95800391-95800413 GAGAACAAGGGCTATGATGTGGG + Intronic
1031155846 7:118111224-118111246 GGGGAGAAGTGGTAGGATTATGG - Intergenic
1031306643 7:120135917-120135939 GGGAAGATAGTCTATGTTTATGG + Intergenic
1031427211 7:121620287-121620309 GGAAAAAATGGCTAGGATTAAGG + Intergenic
1032473742 7:132198424-132198446 GGGAAGACGGGTTAGTATTAGGG - Intronic
1034135237 7:148761853-148761875 GGGAAGAAGGGGGATGGTTTTGG + Intronic
1038954384 8:32451412-32451434 GGGAAGGAGGGCTCTGAATTTGG - Intronic
1039105719 8:33987218-33987240 GGGGTAAAGGGATATGATTAAGG + Intergenic
1039710156 8:40047954-40047976 GGGAAAAAAGGCTATAAATATGG + Intergenic
1045763109 8:105634115-105634137 GGGAATAAGGACTTGGATTATGG + Intronic
1045900399 8:107272236-107272258 GGGAATCTGTGCTATGATTAAGG + Intronic
1046444358 8:114297390-114297412 GGCAAGAAGGGGTGGGATTAAGG - Intergenic
1047294472 8:123558953-123558975 GGAGAGAAGGGCTATGATATAGG + Intergenic
1049203878 8:141354426-141354448 GGGAAGGAGTGCTAAGATGAGGG - Intergenic
1050301079 9:4259560-4259582 AGGACGAAGGGATAGGATTATGG - Intronic
1055712393 9:79077396-79077418 GGGAATAAGGGCCATGATGATGG - Intergenic
1057988009 9:99737428-99737450 GGGAAGAAGTGGTAAGATTCTGG - Intergenic
1058323304 9:103661113-103661135 GGGAAGAAGGATTATGATTTAGG - Intergenic
1059428503 9:114236158-114236180 GGGAAAAAGGGCTCTGAGCAGGG - Intronic
1062138561 9:134943032-134943054 GGGACAAACGGCTATGAATACGG + Intergenic
1203620433 Un_KI270749v1:122599-122621 GATAAGAAGGGGTAGGATTATGG + Intergenic
1185963742 X:4576549-4576571 GGGAGGAAGGGATATCAATAAGG + Intergenic
1187267722 X:17750787-17750809 GGGAAGAAAGGGTATGTTTTTGG + Intronic
1187737084 X:22316022-22316044 AGGTAGAAATGCTATGATTAAGG + Intergenic
1187737994 X:22323913-22323935 GGGAACATGGTCTATGCTTAGGG - Intergenic
1187995908 X:24926310-24926332 GGGAAGATGGGGAATAATTAGGG + Intronic
1189058475 X:37726470-37726492 GGGAAGCAGGGCTATGAGTTAGG - Intronic
1189453071 X:41157573-41157595 GGAAATAAGGGCTATGGCTATGG - Intronic
1192264320 X:69528839-69528861 AGGAAGAAGGGCTTGGATCAAGG - Intronic
1192710043 X:73572097-73572119 GGGAAGAAGGGAGGTGAGTAAGG - Intronic
1192874308 X:75211633-75211655 GGGAAGCAGGGCTAGGAACAAGG + Intergenic
1194114894 X:89884129-89884151 GGGGAAAAGGACTATGATTTTGG + Intergenic
1195960624 X:110382753-110382775 GGGGAGAAGGGCTTTGATTCAGG - Intronic
1196087236 X:111697196-111697218 GGGAAGAAGGTGTTTGATAAAGG + Intronic
1197102984 X:122678526-122678548 GGGATAAAGGGCTATGAATATGG + Intergenic
1197969626 X:132101467-132101489 GGCAAGAAGTGCTATGCTTGAGG - Intronic
1198193866 X:134340232-134340254 TGGAAAAAGTGCTATGATAAGGG + Intergenic
1198494891 X:137182185-137182207 GGGAAAAAAGGCAATGTTTATGG - Intergenic