ID: 1131398497

View in Genome Browser
Species Human (GRCh38)
Location 15:92105754-92105776
Sequence GCTGGGATGCAGAAGGGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 833
Summary {0: 1, 1: 0, 2: 4, 3: 87, 4: 741}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131398488_1131398497 11 Left 1131398488 15:92105720-92105742 CCAGGAGCAAGGTCAGGCACTAC 0: 1
1: 0
2: 0
3: 5
4: 138
Right 1131398497 15:92105754-92105776 GCTGGGATGCAGAAGGGAGATGG 0: 1
1: 0
2: 4
3: 87
4: 741

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131398497 Original CRISPR GCTGGGATGCAGAAGGGAGA TGG Intronic
900171413 1:1270936-1270958 GCTGGGAAGCAGCTGTGAGAAGG - Intronic
900582225 1:3414893-3414915 TCTGGGCTCCAGGAGGGAGAAGG + Intronic
900605875 1:3523304-3523326 GCAGGGGTGCCGAAGGGTGAGGG + Intronic
900610889 1:3544226-3544248 GCTGCGATGCTGGGGGGAGAGGG - Intronic
900610898 1:3544262-3544284 GCTGTGATGCTGAGGGGAGAGGG - Intronic
900870158 1:5296672-5296694 GCTGGGAATCTGCAGGGAGATGG - Intergenic
900961399 1:5923370-5923392 GCTGGGAAACAGAAGAGGGAAGG + Intronic
901115508 1:6840716-6840738 CCTGGGATGCAGAAGATAGATGG + Intronic
901735034 1:11306810-11306832 GCTGGGATGCAGTGAGGACAGGG - Intergenic
901756104 1:11442500-11442522 GTTGGCATGCAGCAGGGACATGG - Intergenic
901760661 1:11469145-11469167 GCTGGGAGGCAGGAAGGAGCCGG + Intergenic
902219171 1:14953993-14954015 GATGGGCTGCAGAAGGGCAAGGG + Intronic
902238743 1:15074404-15074426 GCTGTGATCAGGAAGGGAGAGGG + Intronic
902353148 1:15873680-15873702 ACTTGGATGAAGAAGAGAGAAGG + Intronic
902770435 1:18642724-18642746 GCTGGGGTGGAGCAGGGGGAGGG + Intronic
903084346 1:20841930-20841952 GAACTGATGCAGAAGGGAGAAGG + Intronic
903179496 1:21598102-21598124 GCGGGGAGGCACCAGGGAGACGG + Intronic
903269114 1:22176785-22176807 GCTGGGAGGCAGCAGGGTGCAGG + Intergenic
903548553 1:24142135-24142157 GCTGGGAAGCAGACTGGAGGGGG + Intronic
903875736 1:26472171-26472193 GCTGGGTTGCATAAGGTGGAAGG + Intergenic
904247429 1:29197740-29197762 GCAGGGATACAGAAGAGAGAGGG - Intronic
904624474 1:31794235-31794257 CCTGGGAGGCAGAAGACAGAGGG + Exonic
905184732 1:36188141-36188163 ACTGGGATGAAGAGGGGAGGAGG - Intergenic
905299343 1:36975866-36975888 GCTGGGATACAGAAAGGAATGGG - Intronic
905869282 1:41394039-41394061 GCTGGGAGGCAGAAAGGTGAGGG - Intergenic
905972630 1:42153396-42153418 GCAGGGACACAGATGGGAGACGG + Intergenic
906639722 1:47434411-47434433 TCTGGGCTGCACGAGGGAGATGG + Intergenic
906677510 1:47703660-47703682 CCTGGGATGCAGAAGGGCCTGGG - Intergenic
906825239 1:48972232-48972254 GTAGGGAAGCTGAAGGGAGATGG + Intronic
907222340 1:52916086-52916108 GCTGGGCTGCAGTCGGGAGTTGG - Intronic
907255681 1:53177023-53177045 GCTGGCACACAGAAGGGAGAGGG - Intergenic
907515872 1:54993190-54993212 GTAGGGATGCAGAACGGAGCTGG - Intergenic
907627435 1:56043816-56043838 TCTGGGAAGCAGAACTGAGAAGG - Intergenic
907628481 1:56055635-56055657 GGTGGAATGCAGAAGGGTAAAGG - Intergenic
907664081 1:56418726-56418748 GATGGTATACAGAAGAGAGATGG - Intergenic
907855897 1:58303245-58303267 GCTGGGCTGAGGAAGGGAGGAGG - Intronic
908748702 1:67399584-67399606 GGTGGGGGGCAGAGGGGAGAAGG - Intergenic
908865263 1:68541716-68541738 GCTAGGTTGCTGAAGGAAGATGG - Intergenic
910707416 1:90144608-90144630 ACTGGAGTGCAGAAGTGAGATGG - Intergenic
911266698 1:95752786-95752808 CCCGGGATGCGGCAGGGAGAGGG - Intergenic
912246796 1:107968324-107968346 GCTGGGGAGGACAAGGGAGAGGG + Intergenic
912370530 1:109170746-109170768 GCTGGGCTGCAGCATGCAGAGGG + Intronic
912402393 1:109405917-109405939 GTAGGGATGGAGAAGGGACATGG + Intronic
912629341 1:111233546-111233568 GCTGGCATCCAGGAGGGAGGTGG + Intronic
912739339 1:112179110-112179132 CCTGGAATGCAGAAGTGACAAGG + Intergenic
912860416 1:113209208-113209230 GATGGCATGCAGAAGGAAGAGGG + Intergenic
913038136 1:114994569-114994591 GGAAGGATGTAGAAGGGAGAAGG - Intronic
913322918 1:117601949-117601971 GTAGGGATCCAGAAGGGGGATGG - Intergenic
913448669 1:118976640-118976662 GCTGGCATACAGTAGGAAGAGGG - Intronic
914228479 1:145742584-145742606 GCAGGGATACAGAAGAGAGCTGG - Exonic
914978684 1:152392436-152392458 GATGTGGTGCAGATGGGAGAAGG + Intergenic
915551666 1:156638773-156638795 GCTGGGCTGCACGTGGGAGAGGG + Intergenic
915552876 1:156645337-156645359 GCTGGGAAGAAGAAGGGAGGAGG + Intronic
915602906 1:156933447-156933469 ACGGGGAAGCAGAAGGGAGCGGG - Intergenic
917626951 1:176855911-176855933 ACTGGAAGGAAGAAGGGAGAGGG + Intergenic
918424395 1:184393338-184393360 GGTGGGAGGAAGAAGGGAGGAGG - Intronic
918548978 1:185718031-185718053 GCTGTGCTAGAGAAGGGAGATGG + Intergenic
918584578 1:186170992-186171014 ACTGGGATGCTGAAGACAGAGGG - Intronic
919656235 1:200200179-200200201 GCTGTGATTCAGAAAGGAAATGG - Intergenic
919926937 1:202196355-202196377 GCTGGCATGCAGAAGAGCCAGGG + Intronic
920177777 1:204113866-204113888 GCTGGGCTGCATAGGGGAGCAGG - Intronic
920203543 1:204275504-204275526 GCCAGGAAGCAGAAGGGAGCAGG + Intronic
920307761 1:205030054-205030076 GCTGGGACTCGGTAGGGAGAAGG - Intergenic
920340038 1:205269896-205269918 GCTGGGCTGCAGGAGGGGGTGGG - Intronic
920363217 1:205433640-205433662 GCTGGGCTGCAGACAGCAGAGGG + Intronic
920402017 1:205681882-205681904 GGTGGGAGGCAGGAGGAAGAGGG - Intergenic
920492889 1:206431755-206431777 GAGGGGATGGAGAAGGAAGAGGG + Intronic
922364435 1:224850972-224850994 GCTGGGGTGCAGAGGTGAAATGG - Intergenic
922776968 1:228219302-228219324 TCTGGGATGCATAAGGGGGGAGG - Exonic
922934261 1:229411438-229411460 GGTGGGGGGGAGAAGGGAGACGG - Intergenic
922987552 1:229877640-229877662 GTTGGGGTGCACAAGGGAGAGGG + Intergenic
923204015 1:231740474-231740496 GCTGGCATGGAGAAGAGACAGGG + Intronic
923791251 1:237113018-237113040 TCTTGGATGCAGAAAGGAGAAGG - Intronic
923860337 1:237886506-237886528 GCTGAAATGTAGAATGGAGAAGG + Intronic
924020028 1:239771213-239771235 GATGAAATGAAGAAGGGAGAGGG - Intronic
924658572 1:245995646-245995668 TCTGGGATGCAGTAGGGGGTGGG + Intronic
1063819700 10:9820007-9820029 GGTGGGATGCTGATGGGAGTTGG - Intergenic
1064161365 10:12949387-12949409 GCTGGAATGCAGACGTGATATGG + Intronic
1064247821 10:13683269-13683291 GCCGGGAGGCAGAAGAGAGCAGG + Intronic
1064417065 10:15159125-15159147 ACTGTGATGGAGAAGGGAAAGGG - Intronic
1064741547 10:18439804-18439826 ACTGGCATGCAGTAGGCAGAAGG - Intronic
1067057805 10:43062436-43062458 GCTGAGATGAAGAGGAGAGAGGG + Intergenic
1067071013 10:43132080-43132102 GCTGCCATGGAGAAGGGACAGGG - Intergenic
1067511287 10:46896988-46897010 GCTGGGAAACAGAAAGAAGAAGG + Intergenic
1067523642 10:47026010-47026032 GCAGGGAGGCAGAGGGCAGATGG - Intergenic
1067552758 10:47246916-47246938 GCTGGGATGCAGCTGAGACAAGG + Intergenic
1067852140 10:49761052-49761074 GCTGGGATGCAGGTGGGGGTGGG - Intronic
1067972998 10:50992523-50992545 GTTGGGATGAAGAAGGCGGAGGG + Intronic
1068315701 10:55338683-55338705 GCTTGGACCCAGGAGGGAGATGG + Intronic
1069222642 10:65903569-65903591 GATGGGAACCAGAAGGGTGATGG - Intergenic
1069736266 10:70656726-70656748 GCTGGGATGCAGAGAGCGGAAGG + Intergenic
1070666738 10:78350412-78350434 GCTGTGGGGCAGAGGGGAGAGGG - Intergenic
1070750398 10:78960837-78960859 GCTGGGATGTGGAAGGGAGGTGG - Intergenic
1071146117 10:82574376-82574398 GCTGGGAAGCATAGGGCAGAAGG + Intronic
1071149789 10:82620488-82620510 GCTGGGCTTCAGAGGAGAGATGG - Intronic
1071230858 10:83582902-83582924 GGTGAGATGAAGAAGGCAGAGGG + Intergenic
1071268262 10:83983614-83983636 GCTGGAATGGAGAAGGAGGAGGG - Intergenic
1071880526 10:89892186-89892208 GTGGGTAAGCAGAAGGGAGAAGG - Intergenic
1072316379 10:94207223-94207245 GCAAGGATGCAGAATGGAGAAGG + Intronic
1072316746 10:94210920-94210942 ACTGGGCTACAGAAGGGAAAGGG - Intronic
1072526902 10:96279953-96279975 CATGGGAGGCAGAAGGGAGCTGG + Intergenic
1072622190 10:97087405-97087427 GCAGGGATGGAGACGGGGGAGGG - Intronic
1073265768 10:102227604-102227626 CCTGGCAAGCAGAAGGCAGAGGG - Exonic
1073779888 10:106825612-106825634 GCTGGGATGCAGAAGGTGATGGG - Intronic
1074290446 10:112134223-112134245 GCTGAAAAACAGAAGGGAGAGGG + Intergenic
1074532171 10:114305345-114305367 ACTGGGCTGCAGGAGGGAGCGGG + Intronic
1074902612 10:117832122-117832144 GTTGGGATAGAGAAGGGAGGCGG + Intergenic
1075086798 10:119419114-119419136 GGTGGGCTGGAGAAGGGAGAGGG - Intronic
1075302300 10:121335695-121335717 GGTGGGAGGCAGTAGGGAAAAGG + Intergenic
1075602212 10:123778043-123778065 GTTGGGGTGGAGAAGGGAGGAGG - Intronic
1075648083 10:124109502-124109524 GCTGGGAGGCAGGATGAAGAGGG + Intergenic
1075683917 10:124350876-124350898 GTAGGGATGGAGAAGGGAGCTGG - Intergenic
1075717784 10:124566907-124566929 GCAGGGGTGCAGAAGAGAAATGG + Intronic
1075810331 10:125220417-125220439 GGAGGGATGAAGAAGGAAGAGGG - Intergenic
1075822295 10:125325241-125325263 GGTGGGATGAGGAAGTGAGAAGG + Intergenic
1075911213 10:126127175-126127197 GGGAGGAAGCAGAAGGGAGAAGG + Intronic
1076278785 10:129227414-129227436 TATGGGTAGCAGAAGGGAGAAGG + Intergenic
1076555420 10:131318129-131318151 GCAGGGAGGTAGAAGGGAGAGGG + Intergenic
1076647076 10:131961008-131961030 GCTGGGATCGCCAAGGGAGAGGG + Intergenic
1076719760 10:132387923-132387945 ACTGTGCTGCAGAAGGCAGATGG + Intergenic
1076736740 10:132462397-132462419 GCTGGGCTCCAGGAGGGAAAGGG + Intergenic
1076983260 11:216718-216740 GCTGGAATACAGAAGACAGAGGG + Exonic
1077140468 11:1022059-1022081 GCGGGGCTGCAGAGGGCAGAGGG - Intronic
1077140476 11:1022096-1022118 GCGGGGCTGCAGAGGGCAGAGGG - Intronic
1077147567 11:1052860-1052882 CCGGGGAAGCAGAAGGGAAAGGG - Intergenic
1077237132 11:1487156-1487178 GCTGGGCCGGACAAGGGAGAGGG - Intronic
1077373963 11:2196719-2196741 GCAGGGAGACAGAAGAGAGATGG - Intergenic
1077841219 11:5976857-5976879 GGTGGGTGGCAGAAGGGTGAGGG - Intergenic
1078898096 11:15615928-15615950 GTGGGGATGCAGAAGGCAGAAGG - Intergenic
1078987950 11:16613153-16613175 GCTGGGATGCAGACGGGCTATGG + Intronic
1079036652 11:17025987-17026009 GCTAGGATACAGAGGGGAGCTGG - Intergenic
1079621923 11:22566374-22566396 GCTGGGAGGCAGCAGGGGAAGGG + Intergenic
1080525782 11:33115830-33115852 TTTGGGAGGCCGAAGGGAGAGGG + Intronic
1081144557 11:39546683-39546705 GCTGGGAAGCAGAAAGCAGGTGG - Intergenic
1081232882 11:40607609-40607631 GATGGGAGCCAAAAGGGAGATGG - Intronic
1081620901 11:44618738-44618760 CCTGGGATGGAGAAGGGATGGGG - Intronic
1081651778 11:44828705-44828727 GCTGGGCTACAGAAGGGGGAAGG - Intronic
1081931674 11:46875774-46875796 CCTGGGAAGCAGCAGGGACACGG + Intronic
1083103255 11:60332481-60332503 GCTGAGATGCAGATGGGACCTGG - Intergenic
1083103357 11:60333606-60333628 GCTGAGATGCAGATGGGACCTGG + Intergenic
1083254312 11:61486873-61486895 GCAGGGATGGAGAGGGGAGCAGG - Intronic
1083261564 11:61525880-61525902 GATGGGATGCAGAAGGGAAGAGG + Intronic
1083414045 11:62513808-62513830 GGTAGGATGGAGAAGGGACAAGG - Intronic
1083724494 11:64621207-64621229 GCAAGAATGCAGAAGGGAGCTGG - Intronic
1083815766 11:65131588-65131610 GATGGCATACTGAAGGGAGAGGG + Exonic
1084327718 11:68411414-68411436 GCTGGAAGGCACAAGGGAGAAGG - Exonic
1084665914 11:70576190-70576212 GCTGGGATGCAGACGAGGAAAGG + Intronic
1084927041 11:72522278-72522300 TCAGGGAGCCAGAAGGGAGATGG + Intergenic
1084954193 11:72682915-72682937 GCTGGGGGGCAGAGGGGAGAGGG - Intergenic
1085400372 11:76232425-76232447 GCTGTGATGCAGAGAGGAGAGGG - Intergenic
1086167470 11:83796458-83796480 GAAGGGATGCGGAAGGGAGTGGG - Intronic
1086388440 11:86335063-86335085 GCTGAGAAGCAGATGGGACAAGG - Intronic
1087174248 11:95081640-95081662 GCTGGAATGAAGACGGGGGAAGG - Intergenic
1089187681 11:116631309-116631331 GGTGGGCTGCAGCAGAGAGAGGG - Intergenic
1089696329 11:120218455-120218477 GCTGGGCTGGGGAGGGGAGAGGG - Intronic
1090130943 11:124141623-124141645 GCTGAGATGCAGAAGGAGGACGG - Exonic
1090411685 11:126513631-126513653 GCTGTGATGAGGATGGGAGATGG + Intronic
1091223393 11:133944111-133944133 GGTGAGATGCAGTTGGGAGAAGG + Intronic
1091441061 12:512027-512049 GGTGGAAGGCAGAAGGTAGAAGG - Intronic
1091441177 12:512496-512518 GGTGGAAGGCAGAAGGTAGAAGG - Intronic
1091950209 12:4586479-4586501 GCTGGGAGGCAAAAGGAAGCGGG - Intronic
1092256901 12:6931192-6931214 TCTGTGATGGGGAAGGGAGATGG + Intronic
1092461680 12:8692709-8692731 GCTGAGATGGAGCAGGGAAAAGG + Intronic
1093846397 12:23977296-23977318 GCTGGGAGGTGGAAGGGTGATGG - Intergenic
1094361734 12:29638400-29638422 ATGGGGATCCAGAAGGGAGATGG - Intronic
1094541121 12:31364007-31364029 GCAGGGAGGCAGGAGGGAGTTGG + Intergenic
1094712746 12:32981836-32981858 GATGGGAGGTAGGAGGGAGAAGG + Intergenic
1095170286 12:39026879-39026901 ACAGGGAAGCAGAAGAGAGATGG + Intergenic
1095649732 12:44593235-44593257 ACTGAGATCCAGAAAGGAGATGG + Intronic
1095898620 12:47305496-47305518 TGGGGGATCCAGAAGGGAGACGG + Intergenic
1096258612 12:50077468-50077490 GGTGAGATGCTGGAGGGAGAGGG - Intronic
1096580071 12:52579473-52579495 GCTGGGCTGCAGCAGAGAGGAGG - Intergenic
1096842010 12:54385462-54385484 GCAGGGTCGCAGAAGGGAGCTGG - Intronic
1097262675 12:57728264-57728286 GCTGGGGTGCAGAAGGGTGGGGG - Intronic
1097725184 12:63067070-63067092 GCTTGAAAGCAGAAGGGAGAAGG - Intergenic
1098071650 12:66682230-66682252 GCTGTGCTTCAGAGGGGAGAAGG - Intronic
1098521514 12:71439628-71439650 GCTGGGAGGCAGCAGGCAGCAGG - Intronic
1098751065 12:74293551-74293573 GCTGGAAAGCAGGAGGGACAAGG + Intergenic
1099054989 12:77828310-77828332 GCTGGGAAGCATAAGAGTGAGGG - Intergenic
1100002277 12:89851527-89851549 GAAGGTAGGCAGAAGGGAGAAGG - Intergenic
1101564896 12:105895860-105895882 GCTGTGATCCAGTAGGGGGAAGG - Intergenic
1101640561 12:106583399-106583421 GGAGGGAAGGAGAAGGGAGAGGG + Intronic
1101698477 12:107149450-107149472 GCTGAGATGGAGAAGGGACATGG - Intergenic
1102344641 12:112151855-112151877 GCTGGGAGGCAGACAGGAGGTGG - Exonic
1102383083 12:112483977-112483999 GGTGGGATGCGGAGGGGAGGTGG + Intronic
1102990445 12:117311890-117311912 CATGGAATGAAGAAGGGAGAGGG - Intronic
1103016701 12:117500232-117500254 ACCGGAATGCAGAAGGGGGATGG + Intronic
1103450626 12:121026104-121026126 CCTGGGAGGCAGAGGGGAGCCGG + Intronic
1104060983 12:125268116-125268138 GCTGCTATGCCAAAGGGAGATGG + Intronic
1104182692 12:126398104-126398126 GCTTGGGTGTAGAAGGGAGATGG + Intergenic
1104190637 12:126479262-126479284 GGTAGGATGAAGGAGGGAGAAGG + Intergenic
1104210756 12:126685977-126685999 TTTGGGATGCAGAAGGGAGAGGG - Intergenic
1104252956 12:127113311-127113333 GCTGGGAGGCAGAAGGAGGCTGG + Intergenic
1104298754 12:127543198-127543220 GCTGGGGAGGAGAAGGGAGAGGG + Intergenic
1104676721 12:130716153-130716175 GCTCGGGTGCAGAAAGGCGAGGG + Intronic
1104735495 12:131133637-131133659 GCTGGGTTGCACAATGGAGAGGG - Intronic
1104960225 12:132485061-132485083 AGTGGAATGCAGAAGGCAGAGGG - Intergenic
1105356655 13:19665092-19665114 AGTGGGGTGCAGAGGGGAGATGG + Intronic
1106019396 13:25900113-25900135 GCTGGGAGGCAGAGCTGAGAGGG + Intronic
1106081201 13:26501410-26501432 ACTGGGAGGGAGAAGGGAGCTGG + Intergenic
1107506674 13:41041150-41041172 GCTAGAATGCAGAGAGGAGAGGG + Intronic
1108274003 13:48789668-48789690 GTTGGGATCCAGGAGAGAGATGG + Intergenic
1109152430 13:58860916-58860938 TCAGGGAGCCAGAAGGGAGATGG + Intergenic
1109325263 13:60859590-60859612 GCTGGGAAGCAAAAGGGAGCTGG + Intergenic
1111097640 13:83535587-83535609 TGGGGGAGGCAGAAGGGAGATGG - Intergenic
1112800248 13:103102502-103102524 TCTGGGATGCAAAATGGAAAAGG - Intergenic
1112812651 13:103236009-103236031 GCAGTGAATCAGAAGGGAGAGGG + Intergenic
1113596906 13:111539996-111540018 GCTGGGATGGTGAGGGTAGAGGG - Intergenic
1113633683 13:111905418-111905440 GCGGGGACGCAGAAGGGGGCGGG - Intergenic
1113633714 13:111905490-111905512 GCGGGGACGCAGAAGGGGGCGGG - Intergenic
1113677064 13:112214756-112214778 GCTGGAAGGGAGGAGGGAGATGG + Intergenic
1113677254 13:112215311-112215333 GCTGGAGGGGAGAAGGGAGATGG + Intergenic
1113932099 13:113973988-113974010 GCTGGGCTGGAGGATGGAGAAGG - Intergenic
1114149142 14:20015390-20015412 GCTGGGAAGGAGAAGGGTGAGGG + Intergenic
1114622952 14:24108965-24108987 GCTGGGCTGCTGAGGAGAGAAGG - Intronic
1115302447 14:31899681-31899703 GGTGGGATATAGAAGGGAGAAGG + Intergenic
1116795418 14:49384773-49384795 GCTTGGATGCAGCAGGGGCAGGG - Intergenic
1117331171 14:54713327-54713349 GCTGGGGTGGGGATGGGAGATGG - Intronic
1119062034 14:71484986-71485008 GCTGGGATGGAGTAAGGGGAGGG - Intronic
1119442495 14:74637672-74637694 GATGAGGGGCAGAAGGGAGACGG - Intergenic
1119643898 14:76334879-76334901 GCTGGTCTGCAGCAGGGACAGGG + Intronic
1119901481 14:78264255-78264277 GTTGGGAAGCAGAAGCTAGAAGG - Intronic
1119904967 14:78293448-78293470 GGTGGGATGGAGTAGGGGGATGG - Intronic
1120000432 14:79296954-79296976 GCTGGAATCAAGAAGGCAGAAGG - Intronic
1120000610 14:79298955-79298977 GCTGGAATCAAGAAGGCAGAAGG + Intronic
1121015500 14:90546495-90546517 GCTGGGAGGCAGGAGGGGGCTGG - Intronic
1121236460 14:92394888-92394910 GCTGGGAAGCAGAAGAGCCAGGG - Intronic
1121475501 14:94197692-94197714 GCTGGGTTACAAAAGGGACATGG - Intronic
1121478489 14:94238044-94238066 GCAGGCCTGCAAAAGGGAGAGGG + Intronic
1121641213 14:95486023-95486045 GATGCCAGGCAGAAGGGAGAAGG + Intergenic
1122225549 14:100275715-100275737 GCTCACAGGCAGAAGGGAGAGGG - Intronic
1122637215 14:103135792-103135814 CCTGGGCTGCAGAGGGCAGATGG - Exonic
1123164773 14:106315675-106315697 CCTGGGAAGCAGCAGGGAGAGGG - Intergenic
1202852581 14_GL000225v1_random:30708-30730 GCTGGGCTGGAGCAGGGGGACGG - Intergenic
1202856518 14_GL000225v1_random:54594-54616 GCTGGGATGCTGCAGGGGCATGG - Intergenic
1123793269 15:23745803-23745825 GCTGGGAAGGAATAGGGAGAGGG - Intergenic
1124675962 15:31686142-31686164 GCTGCTATGCAGAAGGGAACAGG + Intronic
1125462486 15:39920231-39920253 ACTGGGATCCAGGAGGGAGTGGG - Exonic
1125751722 15:42033751-42033773 GCGGGGCGGCAGCAGGGAGAGGG - Intronic
1126112207 15:45181976-45181998 GCTGGGTGGCAGGAAGGAGAGGG - Intronic
1126170532 15:45691828-45691850 GCTAGGAAGCATAAAGGAGACGG - Intergenic
1127055225 15:55124724-55124746 GCTGGGATGCAGAAGATGCAGGG + Intergenic
1127553645 15:60065892-60065914 GCTGGCCTGTAGAAGGCAGAAGG - Intergenic
1127982324 15:64044519-64044541 GCTGAGATCCAGAAAGGGGAAGG + Intronic
1128087452 15:64895784-64895806 GGTGGGAGGAAGAAGGGTGAAGG + Intronic
1128355359 15:66922718-66922740 GCTGGGCTGGAGGAGGGAGAGGG + Intergenic
1128510002 15:68307541-68307563 GCTGGAAGGAAGAAGGGAAAGGG - Intronic
1128690474 15:69720979-69721001 GGTGGGAAAAAGAAGGGAGAAGG + Intergenic
1128781062 15:70359010-70359032 GCTGGGAGCCGGGAGGGAGAGGG + Intergenic
1128891183 15:71333095-71333117 GCTGGGATGCTTAGGTGAGAAGG + Intronic
1129976518 15:79826696-79826718 GCTTTCATGCAGAAGGCAGAGGG - Intergenic
1130223660 15:82043041-82043063 GCCGGGAAGGAGAAGGGAGAGGG + Exonic
1130431333 15:83850234-83850256 GCTGGAATGCAGAACACAGATGG - Intronic
1130562432 15:84969168-84969190 GCAGGGAATCAGAAAGGAGAAGG - Intergenic
1130603613 15:85295434-85295456 GCTGATCTGCAGCAGGGAGAGGG - Intergenic
1130815378 15:87426579-87426601 GCTGATATGCAGATGGCAGAAGG - Intergenic
1131152225 15:90054298-90054320 GATGGGATGGAGAAGGCGGAGGG + Intronic
1131392078 15:92057793-92057815 ATTTGGTTGCAGAAGGGAGAGGG + Intronic
1131398497 15:92105754-92105776 GCTGGGATGCAGAAGGGAGATGG + Intronic
1131400344 15:92120440-92120462 GCAGGGAGACAGAAGGCAGATGG - Intronic
1131442249 15:92467830-92467852 GCTGGGTTGCAGAGAGGAGCTGG - Exonic
1131766551 15:95682004-95682026 GCTGAGAGGCAGAAGAGAGCTGG - Intergenic
1132093896 15:98967854-98967876 GCTGGGAGGAAGAAGGAATAGGG + Intergenic
1132226159 15:100143050-100143072 CCTGGGAAGCAGTAGGGAAAGGG + Intronic
1132284716 15:100654523-100654545 GCAGGGAGGCTGAAGGGAGGCGG - Intergenic
1132573325 16:653503-653525 CCTAGGAGGCAGAAGGGTGAGGG - Exonic
1132716100 16:1290553-1290575 GCTGAGGGGCAGAAGGCAGAAGG + Intergenic
1132760668 16:1507206-1507228 GCTGGGCAGCAGCAGGGACAGGG - Intronic
1132879120 16:2153556-2153578 GCTGGGAGGAGGAAGGGACAAGG - Exonic
1133241142 16:4415401-4415423 ACTGGGATGGAGAATGGAGGGGG - Intronic
1133601340 16:7343007-7343029 GCTGGGTTGCAGGACGGGGAGGG + Intronic
1133798633 16:9066907-9066929 GCGGTGATGGAGAGGGGAGATGG - Intergenic
1133865519 16:9638365-9638387 TCTGGGAAGCAGAAGGTAGCAGG - Intergenic
1133932672 16:10244957-10244979 GCTGGGCTGCAGACTGGTGAAGG + Intergenic
1133976075 16:10600710-10600732 GGTGGGATGCATAAGGCAGCTGG - Intergenic
1133982412 16:10642825-10642847 GCTGGGAAGGGGAAGGGAAAGGG + Intronic
1134084850 16:11349316-11349338 GTGGGGATGCAGGAAGGAGAGGG + Intronic
1134346652 16:13397930-13397952 GCGGGGAGCCAGAAGGGAGATGG + Intergenic
1135010892 16:18877672-18877694 GTTGGGATGAAGAAGGTATATGG + Intronic
1135042653 16:19129890-19129912 GCTGAGGGGCAGAAGGCAGAAGG - Intronic
1135317777 16:21465257-21465279 GTTGGGATGAAGAAGGTATATGG + Intergenic
1135370672 16:21897056-21897078 GTTGGGATGAAGAAGGTATATGG + Intergenic
1135441114 16:22473663-22473685 GTTGGGATGAAGAAGGTATATGG - Intergenic
1135899238 16:26441514-26441536 GCTGGAAGGCAGAAGGGAGATGG - Intergenic
1135977497 16:27118610-27118632 GATGGAATGCAAAAGGGAGCTGG + Intergenic
1136043349 16:27597674-27597696 GCTGGATTGCAGGAGGGAAATGG + Intronic
1136314548 16:29444939-29444961 GTTGGGATGAAGAAGGTATATGG + Intronic
1136327990 16:29546707-29546729 GTTGGGATGAAGAAGGTATATGG + Intergenic
1136397546 16:30001379-30001401 GCGGGGATGGAGATGGGAGGCGG - Intronic
1136442675 16:30286708-30286730 GTTGGGATGAAGAAGGTATATGG + Intergenic
1136560919 16:31038835-31038857 GGTGCTATGCAGAAGGGAGTGGG - Intronic
1136756466 16:32689015-32689037 GCGGGGAGGCAGCAGGGAGGAGG + Intergenic
1136811645 16:33181358-33181380 GCGGGGAGGCAGCAGGGAGGAGG - Intergenic
1136818121 16:33291438-33291460 GCGGGGAGGCAGCAGGGAGGAGG - Intronic
1136824685 16:33347967-33347989 GCGGGGAGGCAGCAGGGAGGAGG - Intergenic
1136829751 16:33446738-33446760 GCGGGGAGGCAGCAGGGAGGAGG - Intergenic
1137486991 16:48899758-48899780 CCTGGGAGGCAGAAGAGAGCAGG - Intergenic
1137670667 16:50276370-50276392 CATGGGGTGCAGAAGTGAGAGGG - Intronic
1137707450 16:50545370-50545392 GCTGGGAGGCACCAGGGTGAAGG + Intergenic
1138589591 16:57992481-57992503 GCTGGGAAGAAGAAGGAAGGAGG - Intergenic
1138840147 16:60491757-60491779 TCTCTGATGCAGAAGGGAGAAGG + Intergenic
1138935959 16:61723500-61723522 GGTGGGATGCTGAAGGGAGAAGG - Intronic
1139267864 16:65656679-65656701 GCTGGGAGGCTGCAGTGAGATGG + Intergenic
1139295805 16:65899573-65899595 GAAGGGATGCAGCAGAGAGAAGG + Intergenic
1139889421 16:70239196-70239218 GTTGGGATGAAGAAGGTATATGG + Intergenic
1139920077 16:70454413-70454435 GCTGCAATCCAGAAGGGAGATGG - Exonic
1140545677 16:75806358-75806380 GTTGGGAAGCACAAGGGACACGG + Intergenic
1140569293 16:76084528-76084550 GTGGGGATGAAGATGGGAGAGGG - Intergenic
1140963912 16:79945181-79945203 GCTGAGAGGCATAAGGGAGGAGG + Intergenic
1141413106 16:83849655-83849677 CCTGGGGTGCAGATGGAAGAGGG + Intergenic
1141440346 16:84025918-84025940 GCGGGGGTGCAGGAGGCAGAGGG - Intronic
1141920580 16:87132992-87133014 GCTGGGACCAAGGAGGGAGAAGG - Intronic
1142341541 16:89526307-89526329 GCTGGGGGGCAGAAAGGAGAGGG - Exonic
1202990223 16_KI270728v1_random:4327-4349 GCGGGGAGGCAGCAGGGAGGAGG - Intergenic
1203058610 16_KI270728v1_random:949369-949391 GCGGGGAGGCAGCAGGGAGGAGG + Intergenic
1203141663 16_KI270728v1_random:1771309-1771331 GCTGGGATGGAGGAGGAGGAGGG - Intergenic
1203141710 16_KI270728v1_random:1771452-1771474 GCTGGGATGGAGGAGGAGGAGGG - Intergenic
1142619327 17:1154827-1154849 GCTGGAATGGGGAAGGGAGCGGG - Intronic
1142725529 17:1810910-1810932 GTTGGGAGCCAGAAGGGAGATGG - Intronic
1143420709 17:6789552-6789574 GCTGGGTGGAGGAAGGGAGAGGG - Intronic
1143632560 17:8147376-8147398 GACGGGCTGCAGCAGGGAGAGGG + Exonic
1143732831 17:8890662-8890684 GCTGAGATGAAGCAGGGAGAGGG + Intronic
1143761619 17:9108367-9108389 GATGTGAAGCAGTAGGGAGAGGG - Intronic
1144132415 17:12259747-12259769 GGTGGGATAAAGCAGGGAGAAGG + Intergenic
1144626035 17:16844931-16844953 GGTGGGAGGCAGAAAGGAGGGGG - Intergenic
1144880399 17:18427789-18427811 GGTGGGAGGCAGAAAGGAGGGGG + Intergenic
1144887828 17:18475951-18475973 GATAGGCTGCAGAGGGGAGAGGG - Intergenic
1145017709 17:19410043-19410065 GCTAGGATGCAGAAGGGTTGGGG - Intergenic
1145144385 17:20468350-20468372 GATAGGCTGCAGAGGGGAGAGGG + Intergenic
1145151836 17:20516598-20516620 GGTGGGAGGCAGAAAGGAGGGGG - Intergenic
1145175831 17:20699753-20699775 GATAGGCTGCAGAGGGGAGAGGG + Intergenic
1145297328 17:21601816-21601838 GCTGGGAGCCAGAGGAGAGATGG + Intergenic
1145366629 17:22271085-22271107 GCTGGGAGCCAGAGGAGAGATGG - Intergenic
1145410396 17:22655810-22655832 ACTGGGATGCATAAGAGAAAAGG + Intergenic
1145904095 17:28506971-28506993 CCTGGGTTGCAGAAAGGAGATGG + Intronic
1145942362 17:28749324-28749346 GCTCTGATCCAGCAGGGAGAAGG - Exonic
1146471479 17:33128435-33128457 ACTGGGAAGCAGAATGGGGATGG + Intronic
1147413408 17:40270441-40270463 GCTGGGATGAGGGAGGGAGCTGG + Intronic
1147453376 17:40519802-40519824 GCTGGGATGCAGGGGGCAGGTGG - Intergenic
1147595991 17:41717805-41717827 CCGGGGATACAGAAGGGAGGAGG - Intronic
1147998914 17:44376277-44376299 CCAGGGGTGGAGAAGGGAGATGG - Intronic
1148550343 17:48546538-48546560 GCTGGGAAACAGATGGGAAATGG + Intergenic
1148682149 17:49480458-49480480 GCTGGGAAGCAGAGGGGAGAAGG + Intergenic
1148683987 17:49490521-49490543 GATGGGATGCAGCTGGGGGAGGG + Intergenic
1148737549 17:49873292-49873314 GGTGGGATGCTGAGGGGGGAGGG + Intergenic
1148740765 17:49891044-49891066 GCCTGGATGGAGAAGGGAGGCGG - Intergenic
1148838839 17:50481961-50481983 GCTGGAAGGCAGGAGGGGGAAGG - Intronic
1149109137 17:53005855-53005877 GTTGGAAGGGAGAAGGGAGATGG + Intergenic
1149592450 17:57841482-57841504 GCTGGGGTGCAGAAGTGGGAGGG - Intronic
1149607733 17:57936562-57936584 GCTGGGATGCAGATGGGCAGCGG + Intronic
1149656104 17:58310312-58310334 GCAGGGTGGGAGAAGGGAGATGG + Intronic
1150206840 17:63415441-63415463 GCTGAGAAGAAGAAGGGAGTGGG + Intronic
1150721897 17:67620504-67620526 GCAGGGATAGAGAAGGGTGAGGG - Intronic
1150823974 17:68457881-68457903 GCTGGGAGGGAGAGGGAAGAAGG + Intergenic
1151420525 17:73994095-73994117 GCTGGGAGGAAGATGGAAGAGGG + Intergenic
1151517378 17:74605219-74605241 GTTGGGCTGGAGAAGGGAGCCGG - Intergenic
1152268879 17:79312232-79312254 GCTGGGAAGAAAAAGGGAGCAGG + Intronic
1152294909 17:79461405-79461427 GCTGGGAAGGAGGAGGAAGATGG + Intronic
1152353661 17:79796847-79796869 GCTGGGCTGCAGCAGGGGGAGGG + Intronic
1152468482 17:80478106-80478128 GCTGAGATGCTGAACGCAGACGG - Intergenic
1152678302 17:81652982-81653004 GCAGGGATGGAGGAGGGGGAAGG - Intronic
1152708661 17:81859312-81859334 GCTGGGAAGCTGAAGGCAGAAGG - Exonic
1152941855 17:83176990-83177012 GCTTGGATGCAGGAGGGAAGTGG + Intergenic
1153119800 18:1708029-1708051 GCTGGGATGCATAATGGAGTTGG + Intergenic
1153219340 18:2847787-2847809 CCTGGGGTGCAGGAGAGAGAGGG - Exonic
1153416037 18:4846651-4846673 GCTGAGTTGCAGAAGGAAGCAGG - Intergenic
1153773756 18:8435286-8435308 GATGGGAGCCAGAAGGGAGATGG - Intergenic
1154261559 18:12838549-12838571 CCTGGGAGGCAGTAGGGAGGAGG + Intronic
1156395893 18:36699642-36699664 GCAGGGCTGCTGAAGGGAAAGGG - Intronic
1156474723 18:37398249-37398271 GTTTGGAGTCAGAAGGGAGAGGG + Intronic
1157331189 18:46704962-46704984 GCTGGGAAGGAGAGGGGAGGAGG + Intronic
1157466519 18:47951518-47951540 TCTAGGATGGAGAAGGGACAAGG + Intergenic
1157519369 18:48334811-48334833 GCTGGGAGGCAGGAGACAGAGGG + Intronic
1157579605 18:48765643-48765665 GCAGGGTGGGAGAAGGGAGAAGG + Intronic
1157856212 18:51107955-51107977 GCTGCGTAGGAGAAGGGAGAAGG + Intergenic
1158033922 18:53001459-53001481 TCTGGGATACAGAAGAGAAAAGG - Intronic
1158564017 18:58538939-58538961 GATGGGAGGCAGAGGGGAGCTGG - Intronic
1158753260 18:60291141-60291163 GGTGAGATGTAGAAGGGATATGG + Intergenic
1158934127 18:62349041-62349063 GATGGAAGGCAGAGGGGAGAGGG + Intronic
1159615738 18:70577614-70577636 GCTGTGTTGCAAAAGGGAGCTGG + Intergenic
1160354913 18:78219003-78219025 CCTGGGATGCTGGAGGGAGCAGG - Intergenic
1160782990 19:886061-886083 GCTGGGCTTCAGCAGGGACACGG + Exonic
1160968198 19:1755792-1755814 GCTGGGAGGGAGGAGGGAGGAGG - Intronic
1161003446 19:1922785-1922807 GCTGCGATGGTGAAGGGATAAGG + Intronic
1161202963 19:3025961-3025983 GCTGGGAAGGAGAAGGGGGTGGG - Intronic
1161284961 19:3464119-3464141 GCTGGGAGGCACCAGGGAGGGGG - Intronic
1161438598 19:4278641-4278663 GCTGGCTTGGGGAAGGGAGATGG - Exonic
1162327423 19:10007385-10007407 GCTGGGATGAAAGAGGGAGAGGG - Intronic
1162600567 19:11665308-11665330 GCTGGGATGAAAAGGAGAGAAGG - Intergenic
1162982527 19:14248727-14248749 GCTGGGATGAAGGAAGGAAAGGG - Intergenic
1163203824 19:15787771-15787793 ACTGGGAGGTGGAAGGGAGAAGG + Intergenic
1163324966 19:16597598-16597620 GCTGGGAACCAGGAGAGAGAGGG - Intronic
1164428501 19:28166368-28166390 GGTGGGATGCAAAGGGGAGTGGG + Intergenic
1164704415 19:30309796-30309818 ACAGGGATGCAGAAGGGAGGAGG - Intronic
1164782199 19:30901888-30901910 GCTTAGATGAGGAAGGGAGATGG + Intergenic
1165391522 19:35541928-35541950 GCTGGGAAGCAGAAAGCAGCCGG + Intronic
1165423763 19:35734545-35734567 GCTGGGATGGAAAAGGCAGTGGG + Intronic
1165823752 19:38693778-38693800 TGTGGGCTGCAGGAGGGAGACGG - Intronic
1166044566 19:40222467-40222489 TCGGGGCTGCAGCAGGGAGATGG + Exonic
1166290982 19:41863385-41863407 GCTGTGGTGCAGACGGGCGAAGG + Intronic
1166349702 19:42190403-42190425 GTAGGGATGCTCAAGGGAGAAGG + Intronic
1166387631 19:42391047-42391069 GATGGGAGACAGAAGAGAGACGG + Intergenic
1167123280 19:47531845-47531867 CCTGAGATGCAGGAGAGAGAAGG - Intronic
1167377488 19:49119671-49119693 GCTGGGCTGCAGGAGGGACGTGG - Exonic
1167763976 19:51468219-51468241 GAAGGCATGCAGAAGGGACAGGG + Intergenic
1168149013 19:54435122-54435144 GCCGGGAGGGAGAAGGGAAACGG + Intronic
1168416748 19:56174239-56174261 GCTGGGAAGGAGAAAGGAGGAGG - Intergenic
1168456844 19:56518646-56518668 TCTGAGATGCATAAGTGAGAAGG - Intronic
925149006 2:1601734-1601756 GCTGGGCTGCAGAGGGGTCAAGG + Intergenic
925793809 2:7521383-7521405 GTTGGAATGCAGAACGGAGGTGG + Intergenic
925839810 2:7980506-7980528 TGGGGGAGGCAGAAGGGAGATGG - Intergenic
926387459 2:12351151-12351173 GCTGGGATGAACAAGTGATAAGG + Intergenic
926622983 2:15063988-15064010 GCTGGGACACAGAAGAAAGAGGG + Intergenic
927837022 2:26407285-26407307 GCTGGGAAGCACAAGATAGATGG + Intronic
927864410 2:26579534-26579556 CCTGGGATCCAGAGGAGAGATGG - Intergenic
927997394 2:27495362-27495384 GCTGGGAGAGAGAAGGGATAAGG - Intergenic
928321911 2:30290687-30290709 GCTGGGAGGCAGAAGTGACTTGG - Intronic
929011308 2:37447752-37447774 GCAGGGAGGCAGAAGGCAGGTGG + Intergenic
929151256 2:38751059-38751081 GGCGGGGTGCTGAAGGGAGACGG - Intronic
929460434 2:42099135-42099157 GCTCGGAAGCAGAACAGAGATGG - Intergenic
930180266 2:48349120-48349142 GCTGGAATGCAGTGGTGAGATGG - Intronic
931034746 2:58227440-58227462 TGTGGGAGACAGAAGGGAGACGG + Intronic
931940438 2:67246092-67246114 TCTGGGATGCAGAACTGTGAGGG + Intergenic
932261364 2:70330461-70330483 TCTGGGGTGCAGAGGAGAGAGGG - Intergenic
932434679 2:71695964-71695986 GGTGGGATGCAGGAGGCAGGTGG + Intergenic
932494721 2:72140671-72140693 GTTGGGATGGAGAAGCGAGGAGG - Intronic
932847864 2:75153762-75153784 CCAGGGATGCAAAAGGGAGGAGG + Intronic
932887569 2:75561018-75561040 GCTGGCTTGCAGAAGGGGGCGGG - Intronic
933848989 2:86350273-86350295 GCTGGCCTGCAAAAGGCAGAGGG + Intergenic
934573143 2:95384571-95384593 GCTGGGGGGCAGGGGGGAGAGGG + Exonic
934715349 2:96539727-96539749 GCTGGGCAGCAGCGGGGAGAGGG - Intronic
934775088 2:96932269-96932291 GCTGGGTAGGAGAGGGGAGAAGG - Intronic
935063291 2:99626539-99626561 GAGGGGAGGGAGAAGGGAGAAGG - Intronic
935573220 2:104684268-104684290 ACTGGAATGCAGAAAGGAGCAGG + Intergenic
936247133 2:110837965-110837987 GCAGGGATCCAGAAGAGAGAGGG - Intronic
936344507 2:111665123-111665145 GCTGTGAGGCAGAGGGGAGTGGG - Intergenic
937036958 2:118790121-118790143 GTTGGGATGAAAAGGGGAGAAGG - Intergenic
937237497 2:120439572-120439594 GCTTGAATGCAGATAGGAGAAGG - Intergenic
937708558 2:124950484-124950506 CCAGGGATGCAGAATGGAGAAGG - Intergenic
938108277 2:128547860-128547882 CCTGGGAAGCAGAAGGGGAAAGG + Intergenic
938164450 2:129014575-129014597 GCTGGGAGGGAGGAGGAAGAGGG - Intergenic
938213490 2:129488305-129488327 ACTGGGAGGCAGCTGGGAGAAGG - Intergenic
938501061 2:131831529-131831551 GGTGGGATGGAGGGGGGAGATGG - Intergenic
938960062 2:136332896-136332918 GCTGGGGTCCAGGAGGAAGAGGG + Intergenic
940557870 2:155255326-155255348 GCTGGGAAGGGGCAGGGAGAGGG - Intergenic
942538211 2:176988023-176988045 CAGGGGATGCAGAAGAGAGAAGG - Intergenic
943529778 2:189064889-189064911 GCTCAGATCCAGAAAGGAGATGG - Intronic
943809025 2:192161111-192161133 GCTGGTATGCAAACGGGAGGGGG - Intronic
944607265 2:201363411-201363433 GCCGGGGTGCAAAATGGAGAGGG - Intergenic
945837472 2:214849841-214849863 AATGGGATGCAACAGGGAGAGGG + Intergenic
946053205 2:216880819-216880841 GTGGGGAAGCAGAAGGGGGAGGG - Intergenic
946176956 2:217928064-217928086 GCTGGGAGGCCCAGGGGAGAGGG + Intronic
946182695 2:217958477-217958499 GCTGGGATGGAGAATGACGATGG + Intronic
946301808 2:218828486-218828508 GCTGGGGAGGTGAAGGGAGATGG - Intronic
946408320 2:219504389-219504411 ACTGGGATGGATAAGGAAGAGGG - Intronic
948227023 2:236319115-236319137 GCTGCGATGAAGAAGGAGGAGGG - Intergenic
949007541 2:241658278-241658300 GCTGGGCTGGAGATGGGAGGAGG + Intronic
949045794 2:241872169-241872191 GCTGGTACCCACAAGGGAGAAGG - Exonic
1168895335 20:1319990-1320012 GCTGGGATGGAGGAGGAAGGGGG + Intronic
1169149708 20:3279780-3279802 GCTGGGAGGCAGCAGGGCTAAGG + Intronic
1170342428 20:15344336-15344358 AGTGGGATGGAGAAGGGAGAAGG + Intronic
1171249623 20:23638056-23638078 GCGGGGAGGGAGAAGGGAGGTGG - Intronic
1171346763 20:24471058-24471080 GCTGGGCTGTAGGAGGGAGACGG - Intronic
1171727916 20:28642767-28642789 TCTGTGATACAGAAGGGAAAAGG + Intergenic
1171780237 20:29410938-29410960 GCTGGGCTGGAGCAGGGGGACGG + Intergenic
1171824201 20:29879202-29879224 GCTGGGCTGGAGCAGGGGGATGG + Intergenic
1172016863 20:31880788-31880810 GCTGGGATTAAGAAGTAAGATGG - Intronic
1172292206 20:33784321-33784343 GATGGGAAGGAGGAGGGAGAAGG - Intronic
1172897053 20:38307553-38307575 GCTGGCTGGCTGAAGGGAGAAGG - Exonic
1172949824 20:38715779-38715801 GGTGAGATGCAGGAGGGGGAGGG - Intergenic
1173185307 20:40835940-40835962 CCTGGCATGGAGAAGGGTGATGG + Intergenic
1173274993 20:41572647-41572669 GTAGGCATGCAGAAGGGAGTTGG - Intronic
1173884013 20:46440897-46440919 ACTGGGATGGAGAAGGGAAGAGG - Intergenic
1174510433 20:51047419-51047441 GCTGGGAGGCCGAAGAAAGAGGG + Intergenic
1174597182 20:51693378-51693400 GCTGGTAGGCAGAGGAGAGAGGG + Intronic
1175515381 20:59566780-59566802 GCCGGGGTGCAGCAGGGAGGAGG - Intergenic
1175517709 20:59579420-59579442 GCTGGGATGCTGCGGGGAGCAGG + Intronic
1175553904 20:59834252-59834274 GCTCGGAAGCAGGAAGGAGATGG - Intronic
1175575134 20:60055380-60055402 CCTGGGACGCAGCAGTGAGAGGG - Intergenic
1175921334 20:62451802-62451824 GGAGGGATGGAGAAGAGAGAGGG + Intergenic
1176314490 21:5229299-5229321 TCTGTGATACAGAAGGGAAAAGG + Intergenic
1178535071 21:33403896-33403918 GCTGGGCAGCAGCAGGAAGACGG + Intronic
1179056998 21:37945329-37945351 GCTTGCACGCAGAAGGGAAATGG - Intergenic
1179162294 21:38908575-38908597 GCTGAGAGGCATAAGGCAGATGG - Intergenic
1179286703 21:39983816-39983838 GATGTGGTGCAGAAGGGGGAAGG - Intergenic
1179317244 21:40254687-40254709 GCTGGGATGCAGATGCAAGCAGG - Intronic
1179332849 21:40422166-40422188 CCTGGAATGCAGAACTGAGAAGG - Intronic
1180392278 22:12295273-12295295 TCTGTGATACAGAAGGGAAAAGG + Intergenic
1180407467 22:12569499-12569521 TCTGTGATACAGAAGGGAAAAGG - Intergenic
1181033915 22:20160932-20160954 GCTGGGCTGCACCAGGGAGGAGG + Intergenic
1181223979 22:21380198-21380220 GCAGGGATGCAATAGGGACAAGG + Intergenic
1181254654 22:21554619-21554641 GCAGGGATGCAATAGGGACAAGG - Intronic
1181292019 22:21802468-21802490 ACTGGGAGGCAGCAGGAAGAAGG - Intronic
1181688387 22:24544392-24544414 GCTGGGGTGCAGTAGGAGGATGG - Intronic
1182446513 22:30392809-30392831 GCTGGACTGCAGAAGTGAGGAGG + Intronic
1183134363 22:35872543-35872565 TGTGGGAGCCAGAAGGGAGATGG + Intronic
1183217273 22:36489190-36489212 GCAGGGAGACAGAAGGGAGTAGG + Exonic
1184206451 22:43007036-43007058 TCAGGGATGCAGATGGGGGAGGG - Intronic
1184422324 22:44389353-44389375 CCTGGGGTACAGAAGGGAGGTGG + Intergenic
1184445791 22:44546024-44546046 GCTGGGATGCCGAGAGGTGAGGG - Intergenic
1184670189 22:46008179-46008201 GCTGGGCTGCAGCAGGCAGGTGG + Intergenic
1185398999 22:50606335-50606357 GCTGGGGGGCAGTAGGGAGCAGG + Intronic
949573063 3:5311923-5311945 GCTGGGATACAGAACAGAGCAGG + Intergenic
949617521 3:5770319-5770341 GATGGGAGCCAGAAGGGGGATGG + Intergenic
949940312 3:9149631-9149653 GCTGGCCTGCAGGAGGGTGAGGG + Intronic
950413064 3:12851454-12851476 TGTGGGGTGCAGAAGGCAGAGGG - Intronic
950716758 3:14853260-14853282 GCTGGGGTGCTGAGGGGTGAAGG + Intronic
952101322 3:30016546-30016568 TTTGGGAGGCAGAATGGAGATGG + Intergenic
952744357 3:36763827-36763849 GTGAGGCTGCAGAAGGGAGAAGG - Intergenic
952901379 3:38114167-38114189 GCTGGGAGGGAGAGTGGAGATGG + Intronic
952932485 3:38370985-38371007 GCTGGTGTGAAGAAGGGACAAGG + Intronic
953415792 3:42715836-42715858 GGTGGAAGGCAGAAGGGAAATGG - Intronic
953681154 3:45039367-45039389 GCTGGGGTGAGGAAGGGTGAAGG - Intergenic
954460176 3:50622026-50622048 CCTGGGAACCAGAAGGAAGATGG - Intronic
954933014 3:54300478-54300500 GCTGTGCTGCTGAACGGAGAGGG + Intronic
955117601 3:56021274-56021296 TCTAGGAGGCAGAAGGAAGAAGG + Intronic
955369103 3:58335573-58335595 GCTTGGTAGCTGAAGGGAGATGG + Intronic
955883282 3:63570557-63570579 GCTGGGAGGGAGAAGGGAGGAGG - Intronic
956147840 3:66210123-66210145 GCTGGAATAGAAAAGGGAGAAGG - Intronic
956194113 3:66635087-66635109 TCGGGGAGCCAGAAGGGAGATGG - Intergenic
959587325 3:108037005-108037027 GTTTGGAGGCAGAAGCGAGAGGG + Intergenic
959682022 3:109106771-109106793 GTTGTGATCCAGAAAGGAGATGG - Intronic
959894951 3:111594960-111594982 GCTGGGATGCACAGAGGAGAAGG + Exonic
960725290 3:120663684-120663706 GCTGGGATGTAGAGGAGAAAAGG + Intronic
960955167 3:123026632-123026654 AGAGGGATGCAGACGGGAGAGGG - Intronic
961002827 3:123385372-123385394 GAGGGGATGGAGAAAGGAGAGGG + Intronic
961805221 3:129484276-129484298 CCTGGGGTGCAGAAGGTGGAGGG - Intronic
961864316 3:129942517-129942539 GGTGGGAAGCTGAAAGGAGATGG + Intergenic
962396416 3:135018547-135018569 GCTGGGAAGCTGTAGGGAGCTGG - Intronic
962935359 3:140075695-140075717 GTTGGGATGCAGAAGGAACGTGG + Intronic
963119668 3:141765368-141765390 GCTGAGATACACCAGGGAGAAGG - Intergenic
963842707 3:150123871-150123893 GCTGGGAGGGAGAAGGGACTGGG + Intergenic
964781058 3:160338387-160338409 GCTGTAATCCACAAGGGAGAAGG + Intronic
965185275 3:165454898-165454920 ACTGGGAGCCAGAAGGGGGATGG + Intergenic
965342391 3:167506147-167506169 GAAGGGAGGCAGAAGGAAGAGGG - Intronic
965810964 3:172591730-172591752 GCTTGGAGGCAGCAGAGAGAAGG + Intergenic
967088684 3:186116579-186116601 GGTGGGATGAGGAAGGGAGCCGG - Intronic
967477787 3:189941201-189941223 GCTGGGCTGCCGCTGGGAGAAGG - Intergenic
968075607 3:195814523-195814545 GCTGGAAAGCAGAAGGGAAACGG - Intergenic
968232912 3:197014997-197015019 GCTGAGATTCAGAAAGGGGAAGG + Intronic
968292673 3:197550786-197550808 GCTGGGGGGCAGATGGGAGGCGG - Intronic
968531382 4:1093778-1093800 GCTGGGATGGAGCAGGGTGAGGG + Intronic
968588949 4:1448301-1448323 GCTGGGTCTCAGAAGGGAGGAGG + Intergenic
968737435 4:2304648-2304670 GCAGGAATGCAGAAGGCAGTTGG + Exonic
969605674 4:8201196-8201218 GGTTGGAAGAAGAAGGGAGAGGG - Intronic
969642117 4:8405216-8405238 GCTGGGATGCAGGCGGGGTAGGG - Intronic
969780150 4:9395026-9395048 GGGGGGAGGCAGAAGGGAAAAGG + Intergenic
970249903 4:14103239-14103261 GCTGTGCTGTAGAAGGGAGGTGG - Intergenic
972082532 4:35171663-35171685 GCTGGAAAGCAGAAGGGCAAGGG - Intergenic
973067245 4:45811044-45811066 GCTGGGAAGAAGAAGGGGAAGGG - Intergenic
973259526 4:48148077-48148099 GCTGGGCTGGTGAAGGGGGATGG + Intronic
975157778 4:71090851-71090873 CCAGGGATGCAGAAGGAAGTTGG + Intergenic
976857486 4:89622287-89622309 GATGGGATGCAGTAGAGGGATGG + Intergenic
978536655 4:109770035-109770057 CCTGGGGTGCAGGTGGGAGATGG + Intronic
978926451 4:114251697-114251719 GCTGGGATGCAGAAAAGCAAAGG + Intergenic
980355308 4:131728530-131728552 GCAGGGATGGAGAAGGAAGCCGG + Intergenic
980603134 4:135052251-135052273 TTTGGGAGGCAGAAGGGGGACGG - Intergenic
981051124 4:140310571-140310593 GCAGGAATGCACGAGGGAGAAGG - Intronic
982086507 4:151841618-151841640 GCTGGGCTGCAGTGGGGAGAGGG - Intergenic
982325554 4:154125483-154125505 GCTGGGATTGAGAAGGGCCAAGG + Intergenic
982405553 4:155016003-155016025 GCAGAGATGCAGCAGGAAGATGG + Intergenic
982753767 4:159194176-159194198 GCTGGGACGCAGAGAGGTGACGG + Intronic
983496830 4:168451454-168451476 GATATGAGGCAGAAGGGAGAAGG - Intronic
983512045 4:168619323-168619345 GCTGGAATGTGGAAGGGAGCTGG + Intronic
984760077 4:183356361-183356383 GGAGGGAGGCAGAAAGGAGAAGG - Intergenic
984911277 4:184676515-184676537 GAAGGGATGGGGAAGGGAGAAGG - Intronic
984933183 4:184866679-184866701 GCAGGCAGGAAGAAGGGAGAGGG + Intergenic
984951269 4:185009477-185009499 GCGGGCATGCAAAAGGGAGAAGG + Intergenic
985150704 4:186944320-186944342 GCTGGGAAGAGGAAGGGAAAAGG + Intergenic
985432624 4:189896099-189896121 TCTGTGATACAGAAGGGAAAAGG - Intergenic
985779680 5:1863737-1863759 ACTGAGAGGCAGAAGGCAGAAGG + Intergenic
985800254 5:2001142-2001164 CCTGGGATGGAGCAGGGAGGGGG + Intergenic
986256458 5:6104871-6104893 TTTGGGATGCAGATGTGAGAAGG + Intergenic
986668589 5:10124446-10124468 GCTGGGCTGGAGAAGAGAGTGGG + Intergenic
986850526 5:11807363-11807385 TCTGGGAGGCAGAAGGTAGTAGG - Intronic
987254174 5:16132245-16132267 GCTGAGAAGGAGAAGGGACACGG + Intronic
988629672 5:32915304-32915326 GCTGAGGGGCAGAAGGTAGATGG - Intergenic
988713328 5:33800246-33800268 GCAGGATTGCAGAAGGGAAAAGG + Intronic
989456363 5:41648767-41648789 AATGGGATGCAGAAGGCAGAAGG - Intergenic
990487252 5:56271312-56271334 TCTGGGGTGCTGCAGGGAGAGGG - Intergenic
991017689 5:61949182-61949204 TGTGGGATGCTGAAGAGAGAGGG - Intergenic
992226265 5:74622062-74622084 GCTGGGATGTTGATAGGAGAGGG - Intergenic
992655129 5:78901290-78901312 GTTTGGAGGCAGGAGGGAGACGG + Intronic
992773469 5:80070041-80070063 GCAGAGCAGCAGAAGGGAGATGG - Intronic
992849712 5:80794643-80794665 GGTGGGTAGCAGAAGGGAGAAGG + Intronic
993063745 5:83073670-83073692 TCTGGGATGTAGAAGGGAACTGG + Intronic
993966933 5:94370527-94370549 GATGGGAAGGAGAAGAGAGATGG + Intronic
995228401 5:109729906-109729928 GCTTGGACCCAGAAGGCAGAGGG + Intronic
995281687 5:110342799-110342821 GCTAGGCTGCAGAGGGGAGCTGG - Intronic
995596002 5:113748324-113748346 GCTGGGATGCAGTGGTGGGATGG - Intergenic
997008052 5:129843505-129843527 GATGGGAGCTAGAAGGGAGATGG + Intergenic
997642382 5:135457742-135457764 GCTGCGCTGGAGGAGGGAGAGGG + Intergenic
998134651 5:139668347-139668369 GCTGGGAGGCGGCAGGGAGCCGG - Intronic
998164725 5:139836484-139836506 CCTGGGATGGAGAGAGGAGAAGG + Intronic
998172939 5:139883085-139883107 GCTGGGAGTGAGGAGGGAGAAGG - Intronic
998306543 5:141083250-141083272 GCTGGAACCCAGAAGGCAGAAGG - Intergenic
998617087 5:143752240-143752262 GCTCTGATCCAGCAGGGAGAAGG + Intergenic
999262166 5:150244949-150244971 GTTGGGGGGCAGATGGGAGAGGG - Intronic
999331718 5:150677989-150678011 GGTGTTCTGCAGAAGGGAGAAGG + Exonic
999577914 5:153000783-153000805 GCTGAAATGTAGAATGGAGAAGG - Intergenic
999696843 5:154194679-154194701 GCTTAGATTCAGAAGGGAAAAGG + Intronic
1000248625 5:159471374-159471396 GCTGGGATGCAGAACTCATAAGG + Intergenic
1000958581 5:167571984-167572006 GCTCAGATGTAGAAGGGAAAAGG - Intronic
1001087894 5:168714774-168714796 GCTGGGAGGCATCAGGGAGAAGG - Intronic
1001098152 5:168792178-168792200 GCTGGAAGGCAGATGGGAGATGG + Intronic
1001270052 5:170304282-170304304 GCTGAGTTGCAGATGGGAGGTGG + Intergenic
1001543169 5:172553317-172553339 GCTGGAATCCAGAAAGGAGTGGG + Intergenic
1001586714 5:172837877-172837899 GCTGGTGTGCAGAAGGCAGCAGG - Intronic
1002211946 5:177604558-177604580 GCAGGGGTGCCGAGGGGAGAGGG - Intronic
1002401157 5:178992194-178992216 CCTGGGACACAGATGGGAGATGG + Intronic
1002679184 5:180948097-180948119 GTGGGGATGGAGATGGGAGAAGG - Intronic
1002685057 5:181003598-181003620 GTGGGGATGGAGATGGGAGAAGG - Intronic
1002805859 6:573381-573403 GGTGGGAGGCAGCAGGGCGAAGG - Intronic
1003502747 6:6715671-6715693 GCAGGAATGCAGAAGGGGGCTGG + Intergenic
1003770287 6:9291560-9291582 TCAGGGATCTAGAAGGGAGAGGG - Intergenic
1004107906 6:12683595-12683617 GCTGGAATGCAGGAGTGTGATGG + Intergenic
1004167565 6:13270390-13270412 GCTGGGAAGCAGGAGGGTGGGGG - Intronic
1004328129 6:14695744-14695766 GCTGGGATGCAAGAAGGAGCTGG - Intergenic
1004947998 6:20636676-20636698 GGTGGGATGGGGGAGGGAGATGG + Intronic
1005284981 6:24315686-24315708 GCTGGAGTGCAGTAGGGAGAAGG + Intronic
1005667051 6:28068357-28068379 CCTGGGAGGCACAAGGGTGAGGG - Intergenic
1006457786 6:34141897-34141919 TCTGGGAGGCAGCAGGGAGAGGG + Intronic
1006560745 6:34909939-34909961 CCTGGTATGTAGGAGGGAGAGGG + Intronic
1006878308 6:37317308-37317330 GCTGGGAGTAGGAAGGGAGAAGG + Intronic
1006964353 6:37967399-37967421 GCTGGGATGCAGAAAGTACAAGG - Intronic
1007298956 6:40851691-40851713 GCAGGGTTGGAGAAGGGAAAAGG - Intergenic
1007748419 6:44057180-44057202 GCTGGGCTGAGGAAGGGAAAAGG + Intergenic
1008543624 6:52566641-52566663 GGTGGGATGCAGTGGGGACAAGG - Intronic
1010141283 6:72617847-72617869 CCAGGGATGCAGAAAGGAGGTGG - Intergenic
1010369480 6:75090388-75090410 GAGGGGTTGCAGAATGGAGATGG - Intronic
1010832231 6:80544599-80544621 GCTTGGAAGCATGAGGGAGAAGG - Intergenic
1012211893 6:96529803-96529825 ACTGGGGTACAAAAGGGAGAAGG + Intronic
1012217059 6:96600166-96600188 ACTGGGATGGAGCAGGCAGAAGG - Intronic
1012440198 6:99255180-99255202 TGGGGGAGGCAGAAGGGAGACGG - Intergenic
1013348137 6:109282099-109282121 GAAGGGAGGGAGAAGGGAGACGG - Intergenic
1014246604 6:119077245-119077267 GTTGGTATGCTGAAGAGAGATGG - Intronic
1014684315 6:124477345-124477367 ATTGGGAGGGAGAAGGGAGATGG + Intronic
1015021986 6:128487525-128487547 GGAAGGATGGAGAAGGGAGAGGG - Intronic
1015455359 6:133421009-133421031 GCTTCGCTGCAGAAAGGAGATGG + Intronic
1016464095 6:144308746-144308768 ATAGGGATGCAGAAGAGAGAAGG - Intronic
1016642596 6:146366493-146366515 GCTGGGAAGGGGAAAGGAGAGGG - Intronic
1016854138 6:148649670-148649692 TCTGGGACACAGGAGGGAGAGGG - Intergenic
1017530330 6:155284011-155284033 TCTGAGATGCTGAAGGGAGGTGG + Intronic
1017777756 6:157692616-157692638 ACTGGGAGGCAGTAAGGAGATGG - Intergenic
1017809063 6:157971018-157971040 GCTGAGATGAAGGAGGTAGAGGG + Intergenic
1018181463 6:161226931-161226953 GCAGGGAAGAAGAAGGAAGAAGG + Intronic
1018640332 6:165898802-165898824 GCTGGGATGGAGCAGGGAGGAGG - Intronic
1018831089 6:167444128-167444150 AGTGGGATGGAGCAGGGAGAAGG + Intergenic
1018896221 6:168019497-168019519 GTTGGGATGCAGGAGAAAGACGG + Intronic
1019388743 7:773642-773664 GGAGGGATGCAGATGGGAAAGGG + Intronic
1019454763 7:1121082-1121104 GCAGGGATGAAGGAGGGAGCCGG + Intronic
1019600479 7:1880804-1880826 CCTGGGATCCAGAAAAGAGATGG + Intronic
1019830286 7:3321714-3321736 GATGGGAGGGAGAGGGGAGAGGG - Intronic
1020809132 7:12829985-12830007 ACTGGGATCAAGAGGGGAGAGGG + Intergenic
1020844141 7:13261507-13261529 GCTGGGATACAGGAGGCTGAGGG - Intergenic
1020918343 7:14227603-14227625 GGAGGGAGGCAGAAAGGAGAAGG + Intronic
1022321598 7:29293265-29293287 TCGAGGATGCAGGAGGGAGAAGG - Intronic
1022454502 7:30546497-30546519 GCTGGAATGGAGTTGGGAGAAGG + Intronic
1022469001 7:30670494-30670516 GGTGGGATGCAGAAGCGGGAGGG + Intronic
1023689315 7:42769949-42769971 GCTTGGAAGGAGAAGGTAGAGGG - Intergenic
1023981563 7:45073593-45073615 GCTGGGCTGCATGAGGGAGGGGG + Intronic
1024411254 7:49044961-49044983 GCTGGGATGAGGGAGAGAGAGGG + Intergenic
1025078637 7:55964336-55964358 GCGCGGGTGCAGAAGGGACAAGG - Intronic
1025625502 7:63217759-63217781 GCTAGGATACAGCAGAGAGAGGG - Intergenic
1026159095 7:67852960-67852982 GAGGGGATGCTGGAGGGAGAAGG + Intergenic
1026969811 7:74461043-74461065 TCTTGGATGTAAAAGGGAGATGG + Intronic
1027164200 7:75823136-75823158 GGTGTGATGCAGGGGGGAGAGGG + Intronic
1027733829 7:81907608-81907630 GCTTGTATGCAGAAGGGAGTTGG - Intergenic
1027775905 7:82463829-82463851 TCTGCCATGCAGAAAGGAGAGGG + Intergenic
1027868692 7:83678780-83678802 GCTGAGATGCAGAAAGCAGTAGG + Intergenic
1028424502 7:90671330-90671352 TCAAGGTTGCAGAAGGGAGATGG - Intronic
1029258054 7:99282720-99282742 GCTGGGAGGCTGAGGCGAGAGGG + Intergenic
1029465561 7:100722601-100722623 GCTGAGGGGCAGGAGGGAGAGGG + Intronic
1029664328 7:101985254-101985276 GCTGCTCTGCAGACGGGAGAGGG + Intronic
1030273441 7:107694345-107694367 GCTGGAAGACACAAGGGAGAAGG + Intronic
1030511822 7:110492261-110492283 GCTGGGATGCAGAAAGTAAGTGG + Intergenic
1030788591 7:113694910-113694932 CCTGGGATGCAGAAGAGGGAAGG + Intergenic
1032022935 7:128420067-128420089 GCTGGGATGAGGAGGGGTGAGGG - Intergenic
1032068992 7:128792248-128792270 GCTGGGGTGCAGAGGAAAGAAGG - Exonic
1032542907 7:132718536-132718558 GGTTGGAGACAGAAGGGAGAAGG - Intronic
1033229317 7:139584148-139584170 GGAGGGAGGCAGAGGGGAGAGGG + Intronic
1033606006 7:142928993-142929015 GCTGGGATGGGGAGGGGAGCTGG - Intronic
1033956923 7:146860913-146860935 GCTGGCATCCAGTAGGAAGAAGG - Intronic
1034299377 7:150001813-150001835 GCATGCATGCAGAAAGGAGATGG + Intergenic
1034785747 7:153924575-153924597 GCTGTGATCCAGAAAGCAGAAGG - Intronic
1034806634 7:154094960-154094982 GCATGCATGCAGAAAGGAGATGG - Intronic
1034815888 7:154171607-154171629 CCTGGGCTGCAGGTGGGAGATGG - Intronic
1034867286 7:154652642-154652664 GCAGGGACGCAGCAGGGACATGG - Intronic
1035067837 7:156121222-156121244 AGTGGGATGGGGAAGGGAGATGG + Intergenic
1035126019 7:156607997-156608019 ACCGGGCTGCAGACGGGAGACGG + Intergenic
1035262958 7:157673571-157673593 GCCAGGATGCACAAGGGAAATGG - Intronic
1035692683 8:1570619-1570641 GCTGGGATGGAGAGGAGAGAAGG + Intronic
1035692732 8:1570862-1570884 GATGAGATGGAGAAGAGAGAGGG + Intronic
1035692743 8:1570904-1570926 TCTGGGATGGAGAGGAGAGAGGG + Intronic
1035692794 8:1571151-1571173 TCTGGGATGGAGAGGAGAGAGGG + Intronic
1035692804 8:1571192-1571214 GATGAGATGGAGAGGGGAGAGGG + Intronic
1035692811 8:1571233-1571255 GATGAGATGGAGAAGAGAGAGGG + Intronic
1035692879 8:1571562-1571584 GATGAGATGGAGAGGGGAGAGGG + Intronic
1035692909 8:1571688-1571710 TCTGGGATGGAGAGGAGAGAGGG + Intronic
1035692945 8:1571851-1571873 GCTGGGATGGAGAGGAGACAGGG + Intronic
1035692963 8:1571933-1571955 GCTGGGATGGAGAGGAGAGAGGG + Intronic
1035693004 8:1572138-1572160 TCTGGGATGGAGAGGAGAGAGGG + Intronic
1035693046 8:1572343-1572365 TCTGGGATGGAGAGGAGAGAGGG + Intronic
1035693076 8:1572506-1572528 TCTGGGATGGAGAGGAGAGAGGG + Intronic
1035693103 8:1572627-1572649 GATGGGATGGAGAGGAGAGAGGG + Intronic
1035693113 8:1572668-1572690 TCTGGGATGGAGAGGAGAGAGGG + Intronic
1035693180 8:1573000-1573022 TCTGGGATGGAGAGGAGAGAGGG + Intronic
1035693229 8:1573249-1573271 TCTGGGATGGAGAGGAGAGAGGG + Intronic
1035696535 8:1602038-1602060 TCTGGGATGCAGCAGGCAGCAGG - Intronic
1036008282 8:4692151-4692173 GCTGGTTTCCAGAAGGGACAGGG - Intronic
1036184206 8:6610246-6610268 GCTGGGATGCAGACAGAAGGCGG + Intronic
1036648479 8:10626463-10626485 GCAGGCATGCAGCAGGGAGCTGG + Intronic
1037268048 8:17089936-17089958 ACTGTGATTCAGAAGGGAAAAGG + Intronic
1037529041 8:19756733-19756755 GCTGGGATGGAGAGGGTGGAGGG - Intronic
1037900525 8:22685626-22685648 TCAGGGATGAAGTAGGGAGAAGG - Intergenic
1037977298 8:23222851-23222873 GATGAGATCCGGAAGGGAGACGG - Intronic
1038349400 8:26762595-26762617 GATGGGATCAAGAAAGGAGATGG + Intronic
1038401820 8:27289464-27289486 GATTGAATGCTGAAGGGAGATGG - Intronic
1038408058 8:27336916-27336938 GCTTGAATCCAGAAGGCAGAGGG - Intronic
1039244930 8:35598177-35598199 GCTGGGATAAAGCAGGGAAAAGG - Intronic
1039611033 8:38919487-38919509 GTTGGGATGAAGAAGGGTGTGGG + Intronic
1039798168 8:40932994-40933016 GCTGAGTTGCATTAGGGAGATGG - Intergenic
1039958211 8:42223400-42223422 GCAGGGATGGGGAGGGGAGAGGG + Intergenic
1040376257 8:46827547-46827569 GCTGGGATTCAGAAGTGAAAAGG + Intergenic
1041552749 8:59119471-59119493 GCGGGGATCCAGAAGGGACAGGG + Intergenic
1042130773 8:65585113-65585135 GCTGGGATGCAGAGGGGCTCTGG - Intergenic
1042385798 8:68172763-68172785 GCTGGGATTCAAGAGGAAGAGGG + Intronic
1042788283 8:72573909-72573931 GATGGGATGCAGAGAGGAAAGGG - Intronic
1042854441 8:73252001-73252023 GCGGGGATGCAGAAAAAAGAGGG - Intronic
1043364579 8:79517798-79517820 GCTGAGAAGGAGAAGGCAGAGGG + Intergenic
1043420039 8:80088582-80088604 GCTGGACTGCCGAGGGGAGAGGG + Intronic
1043442620 8:80289636-80289658 CCTGGGAGGCTGAAGTGAGAGGG + Intergenic
1044206203 8:89494331-89494353 ACGGGGAGCCAGAAGGGAGATGG - Intergenic
1045519300 8:102889359-102889381 GCTTTGATGCAGTAGGAAGATGG - Intronic
1045634027 8:104161962-104161984 ACTGGAAGGCAGAAGGGATAAGG - Intronic
1047266247 8:123312162-123312184 GATTTTATGCAGAAGGGAGAAGG - Intergenic
1047343915 8:124009209-124009231 GCTGGAGTGCAGAAGGAGGATGG - Intronic
1047425448 8:124741376-124741398 GCTGTGATGCACTGGGGAGATGG - Intergenic
1047755769 8:127917374-127917396 GCTGGGATTCAGAAAGGTGCAGG + Intergenic
1048053355 8:130840231-130840253 GCTGGGGTTCAGAAGGCAGATGG + Intronic
1048054745 8:130852743-130852765 CATGGGGTGCAGAAGGGTGAGGG - Intronic
1048276721 8:133071624-133071646 GATGGCATGCAGCGGGGAGAGGG + Intronic
1048417627 8:134243939-134243961 GAAGGGAGGCGGAAGGGAGAAGG + Intergenic
1048440902 8:134458379-134458401 GCTGGGAGGCTGGAGGGAGGAGG + Intergenic
1048814683 8:138321339-138321361 GCTGGGATGAAGCTGGGAGAAGG + Intronic
1049031897 8:140044146-140044168 GCTGTGAAGCAGAAGAAAGAGGG - Intronic
1049292523 8:141812216-141812238 GCTAAGATGAAGAATGGAGAAGG - Intergenic
1049336897 8:142091442-142091464 TCTGGGATGGAGACGGGAGATGG + Intergenic
1049451542 8:142664706-142664728 GAAGGGAGGCAGAAGGGGGACGG - Exonic
1049643873 8:143727560-143727582 GCTGGGACGCGGAAGGCCGAGGG + Exonic
1050233496 9:3554202-3554224 GGTGGGAAGTGGAAGGGAGAAGG - Intergenic
1050324949 9:4490099-4490121 GCTGGTGTGGAGAACGGAGAGGG + Intergenic
1050479300 9:6073393-6073415 TCGGGGAGTCAGAAGGGAGACGG - Intergenic
1050900839 9:10947133-10947155 GCGGGGAGCCAGAAGGGAAATGG + Intergenic
1051868791 9:21713215-21713237 GCCAGAAAGCAGAAGGGAGAGGG + Intergenic
1052778402 9:32755813-32755835 GCGGGGAGCCAGAAGGGAGATGG + Intergenic
1053023733 9:34713976-34713998 GATGGGATGCAGAAGGCATGGGG + Intergenic
1053157781 9:35792259-35792281 GCTGGGATGCAGAAGGTGCTGGG - Exonic
1053614501 9:39749565-39749587 GCTGTGATGCACAAAGGTGAGGG - Intergenic
1053872534 9:42507503-42507525 GCTGTGATGCACAAAGGTGAGGG - Intergenic
1053900222 9:42788412-42788434 GCTGTGATGCACAAAGGTGAGGG + Intergenic
1054239017 9:62592827-62592849 GCTGTGATGCACAAAGGTGAGGG + Intergenic
1054261417 9:62869183-62869205 GCTGTGATGCACAAAGGTGAGGG - Intergenic
1054460212 9:65458504-65458526 GGTGTGAGGCAGACGGGAGAGGG - Intergenic
1054460317 9:65458878-65458900 GGTGTGAGGCAGAAGGGAGAGGG - Intergenic
1054553146 9:66627349-66627371 GCTGTGATGCACAAAGGTGAGGG + Intergenic
1055776864 9:79775781-79775803 TCTGAAATCCAGAAGGGAGAGGG + Intergenic
1056399012 9:86209105-86209127 GCTGGAACTCAGAAGGTAGAAGG - Intergenic
1056725379 9:89109742-89109764 GGTGAGATGAAGAAGGGAGCAGG - Intronic
1057272784 9:93660170-93660192 TCTGGGATACAGAAAGGAGAGGG - Exonic
1057837173 9:98454781-98454803 GCTGGGCTGCAGGATGGAGAGGG - Intronic
1058354424 9:104066071-104066093 GCTGAGGTGCAGAAGGATGAAGG - Intergenic
1059503225 9:114774427-114774449 GCTGGGAGTCAGCAGTGAGAAGG + Intergenic
1059901439 9:118930739-118930761 CCTAGGAGGCAGAAGGCAGAAGG - Intergenic
1060167292 9:121428968-121428990 GCTGGGAAGCCCAAGGGAGAGGG - Intergenic
1060449632 9:123724582-123724604 GCTAGGATGCAGACAGGAGGTGG + Intronic
1060484579 9:124039084-124039106 GCCGGGATGCAGCAGAGAGGGGG + Intergenic
1060561986 9:124553270-124553292 GCTTAGATACAGAAGAGAGAAGG - Intronic
1060736803 9:126071282-126071304 GCTAGGATGGAGAACGGAGGAGG - Intergenic
1060813832 9:126624608-126624630 GCTGGGGCGCAGGAGGGAGGGGG - Intronic
1060908273 9:127327529-127327551 GGTGGGATGCAGCAGAGAGCAGG + Intronic
1061064300 9:128267850-128267872 GCAGGGATTCACAAGAGAGAGGG - Intronic
1061246070 9:129401807-129401829 GGTGGGAGGGAGAAGGGAGAGGG - Intergenic
1061499717 9:130994861-130994883 GATGGGAGGCAGGATGGAGAGGG - Intergenic
1061514251 9:131079366-131079388 TCAGGGTTGCAGGAGGGAGAAGG + Intronic
1061584808 9:131558716-131558738 CCTGGGATGGGGAAGGGATAGGG - Intergenic
1061718664 9:132537740-132537762 GATGGGGTGGAGAAGAGAGAAGG + Intronic
1062028639 9:134352114-134352136 GCTGGGGTGCAGCAAGGGGAGGG + Intronic
1062284614 9:135767559-135767581 GTTGGGGTGCAGGAGGGAGGGGG - Intronic
1062340052 9:136090170-136090192 GCTGGGTGGTAGAAGGGAGATGG + Intronic
1203377274 Un_KI270442v1:385647-385669 GCTGGGCTGGAGCAGGGGGATGG + Intergenic
1203421066 Un_KI270448v1:6577-6599 TCTGTGATACAGAAGGGAAATGG - Intergenic
1203421637 Un_KI270521v1:6092-6114 TCTGTGATACAGAAGGGAAAAGG - Intergenic
1185550680 X:980847-980869 GCTGGGATGATGGAGGAAGAGGG + Intergenic
1185550843 X:981353-981375 GCTGGGATGGAGGAGGAAGAGGG + Intergenic
1185558756 X:1042514-1042536 GCTGTGATGCATAAGATAGACGG - Intergenic
1186079265 X:5912815-5912837 GATGTGATGGAGCAGGGAGAGGG + Intronic
1186107952 X:6226868-6226890 GCGGGGATGAGGTAGGGAGAGGG - Intronic
1186198111 X:7130152-7130174 GCTGGGATGAGAAAAGGAGAAGG + Intronic
1186285366 X:8038057-8038079 GCTGGCACGGAGAAGGCAGAGGG + Intergenic
1186711429 X:12201683-12201705 CCTGGGTGGGAGAAGGGAGAAGG + Intronic
1186927602 X:14352296-14352318 TCTGGGCAGCAGAATGGAGATGG + Intergenic
1187298254 X:18023665-18023687 GCTGTGACGGAGAAGGGAGAAGG - Intergenic
1187723119 X:22172630-22172652 AGTGGGTTGCAGAAGGGAAAAGG - Intronic
1187775685 X:22754054-22754076 GCTGGGATGGAAAAGGTAAATGG + Intergenic
1190114326 X:47616300-47616322 TCTGAGATGCAGAAGGGGAAGGG + Intronic
1190220108 X:48507468-48507490 GCTGTGACGTGGAAGGGAGAAGG - Intergenic
1190382404 X:49852310-49852332 GCTGGGCTGTAGGAGGGAAAAGG + Intergenic
1190742591 X:53299688-53299710 GCAGGGATGCAGCTGGGAGTGGG + Intronic
1192064350 X:67865011-67865033 CCTGGGAAGCACAAGGGATAGGG - Intergenic
1192434271 X:71133225-71133247 GCTGGGGAGAAGAAGGAAGAGGG + Intronic
1193150186 X:78116826-78116848 GCTGGGACAGAGAAGGCAGATGG - Intronic
1193358422 X:80551155-80551177 TCGGGGAGCCAGAAGGGAGATGG + Intergenic
1193846540 X:86479030-86479052 GTTGGGGAGCAGAAGGGGGATGG + Intronic
1194201690 X:90959204-90959226 GCTTGGAAGCAGCAGGGAAAGGG - Intergenic
1194238567 X:91414996-91415018 TTTGGAAGGCAGAAGGGAGACGG - Intergenic
1195026742 X:100885187-100885209 GCTGGGAGGCAGCAGGCAGGAGG + Intergenic
1196046054 X:111257706-111257728 GCTGAGATGCAGAGTGCAGATGG + Intronic
1196177136 X:112651545-112651567 GCTGGGATTGAGAAAAGAGAAGG - Intronic
1196864705 X:120060341-120060363 GCTGGGAGCCAGAGGGGAGAGGG - Intergenic
1196878396 X:120175990-120176012 GCTGGGAGCCAGAGGGGAGAGGG + Intergenic
1197735057 X:129844036-129844058 GTGGGCATGCAGCAGGGAGATGG - Intergenic
1198193562 X:134336332-134336354 GAGGGCATGCAAAAGGGAGAGGG + Intergenic
1198255093 X:134917380-134917402 GCTGGGAAGGGGAGGGGAGAAGG + Intergenic
1198567857 X:137923361-137923383 GCAGGGATGAAGTAGGGAGGGGG + Intergenic
1199596055 X:149506609-149506631 GCTGGGAGGAGGAAGGGAGATGG + Intronic
1200136715 X:153878846-153878868 GCTGGGATGGGGCAGGGAGCGGG - Intronic
1200175897 X:154116186-154116208 TCTGGGATGATGAAGGCAGAGGG - Intergenic
1200547529 Y:4534659-4534681 GCTTGGAAGCAGCAGGGAAAGGG - Intergenic
1201072956 Y:10166005-10166027 CCTGGGATGCAGAAGGGGTCAGG - Intergenic
1201727786 Y:17172570-17172592 TTTGGGAGCCAGAAGGGAGATGG + Intergenic
1202343101 Y:23889659-23889681 CCTGGGATGCAAAAGGGATCAGG + Intergenic
1202527667 Y:25780426-25780448 CCTGGGATGCAAAAGGGATCAGG - Intergenic