ID: 1131399703

View in Genome Browser
Species Human (GRCh38)
Location 15:92114482-92114504
Sequence GTTGCTAATGTGCCCCGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 48}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131399703 Original CRISPR GTTGCTAATGTGCCCCGTGC AGG (reversed) Intronic
906043896 1:42812504-42812526 GTTGCTACTGTCCCCAGTGATGG - Intronic
906514110 1:46428941-46428963 GTGGCTAATGTGACCTCTGCAGG - Intergenic
912282205 1:108327739-108327761 GCTGCCACTGTGCCCCGTCCAGG - Intergenic
915563999 1:156703929-156703951 GTTTTTAATCTGCCCCCTGCAGG + Intronic
921968990 1:221124066-221124088 GTTGATAATGTGCCACATGCAGG + Intergenic
922238247 1:223737341-223737363 GTTCCTAAGCTGCCCCGTGAAGG - Intronic
922518950 1:226229662-226229684 ATTGCAAATGTGCCAAGTGCTGG + Intergenic
922565652 1:226600025-226600047 GATGCTGATGTGCCCCATCCTGG - Intronic
1065781971 10:29177509-29177531 GCTGCGAATGAGCCCTGTGCAGG - Intergenic
1075588979 10:123677822-123677844 GTTGCTGGTGGCCCCCGTGCTGG - Intronic
1083367072 11:62147819-62147841 GTAGCTAATGTGCAGGGTGCTGG + Intronic
1084594877 11:70110937-70110959 TTTTATAATGTGCCCAGTGCAGG + Intronic
1086590583 11:88509579-88509601 GTTGCTCATGGGCCCCGGACTGG + Intronic
1111502384 13:89138796-89138818 CTTGCTAATGTTTCCCCTGCTGG + Intergenic
1119575352 14:75716075-75716097 GATGCAAAGGGGCCCCGTGCTGG - Intronic
1130223691 15:82043126-82043148 GCTGCTAGTGCGCACCGTGCTGG - Exonic
1131399703 15:92114482-92114504 GTTGCTAATGTGCCCCGTGCAGG - Intronic
1133738731 16:8635253-8635275 GATGCTAGCGAGCCCCGTGCCGG - Exonic
1147122589 17:38344224-38344246 GTTGCTATGGTGCCCCATCCTGG - Intergenic
1150584770 17:66507547-66507569 GTTGCTAATCTGCCTTGTGAAGG - Intronic
1158863547 18:61616284-61616306 TATGCTAATGTGCCCTGAGCAGG - Intergenic
1160874104 19:1289441-1289463 GTTGCCATTGTGGACCGTGCTGG - Intronic
1161119588 19:2518082-2518104 GGTGCCAAGGTGCCACGTGCTGG - Intronic
1161399380 19:4060652-4060674 GTTCCTGATGCTCCCCGTGCTGG - Intronic
1162382056 19:10337078-10337100 CTTGCTATTGTCCCCCATGCTGG - Intronic
1168701037 19:58439758-58439780 GTTGCTGATGGGCCCGGCGCAGG - Exonic
926334061 2:11850107-11850129 GTTCCTAATGTGTCCACTGCAGG - Intergenic
927182459 2:20456281-20456303 GTGGCTAGTGTGCTCAGTGCTGG + Intergenic
935038624 2:99404115-99404137 GTTGTTACTGTCCCCCATGCAGG + Intronic
943646292 2:190409921-190409943 ATTGTTAATGAGCCCAGTGCAGG + Intronic
1173855161 20:46245625-46245647 TTTGGTGCTGTGCCCCGTGCTGG - Intronic
1175385294 20:58591072-58591094 TTTGATAATTTGCCCTGTGCTGG - Intergenic
1178316772 21:31573347-31573369 GGTGGTAATGTGCCCAATGCAGG + Intergenic
1182289520 22:29267298-29267320 CTTGCTAAGGTGCCCAGAGCTGG - Intronic
950054979 3:10017239-10017261 CTTGCTATTGTGCCCCGGGCTGG + Intergenic
956094408 3:65701006-65701028 GTTGGTAATGAGCCCCCTGATGG - Intronic
967420031 3:189262462-189262484 CTTGCTTATGTGCCAGGTGCTGG + Intronic
969676557 4:8617644-8617666 GTTGCTGCTGAGCCCCGTGCAGG + Intronic
984511365 4:180682933-180682955 GTTGGGAATGTGCCATGTGCTGG + Intergenic
987247849 5:16067008-16067030 GATGCTCTTGTGCCTCGTGCTGG - Intergenic
992670034 5:79050216-79050238 TTTGCTCTTGTGCCCCGGGCTGG - Intronic
1001013385 5:168118547-168118569 TTTGCTAATGAGCCCAGTCCTGG + Intronic
1001565581 5:172697302-172697324 GAAGCTGATGGGCCCCGTGCTGG + Intergenic
1003317857 6:5027843-5027865 GGTGCTTAAGTGCCCCGGGCTGG + Intergenic
1008967520 6:57328090-57328112 GTTCCTAATGGGCCATGTGCTGG + Intronic
1012252423 6:96993488-96993510 TTTGCTAATGTCCCCCCTGCTGG + Intronic
1013192823 6:107818293-107818315 GTTGCCACTGTGGCCTGTGCTGG - Intronic
1019450008 7:1092636-1092658 GTTGACAATGTGGCCCGTGAGGG - Exonic
1042626385 8:70762352-70762374 GTTGCTAATATGCCACGAACTGG - Intronic
1044006196 8:86940158-86940180 GTTGCTCTTGTGCCCCAGGCTGG + Intronic
1049681511 8:143920614-143920636 GTCGATGATGTGCCCGGTGCCGG + Exonic
1060604212 9:124899607-124899629 GTTGCTGAGGTCCCCCCTGCAGG + Intronic
1193112158 X:77740919-77740941 CTTGCTAATGTTCCCCAAGCTGG - Intronic