ID: 1131400943

View in Genome Browser
Species Human (GRCh38)
Location 15:92125230-92125252
Sequence TCTACCATGTAGATGATGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 116}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131400943 Original CRISPR TCTACCATGTAGATGATGCA TGG (reversed) Intronic
900926278 1:5708271-5708293 TCTACCAGGGAGATGACGGATGG + Intergenic
902467800 1:16628901-16628923 TCTACCACGTAGAAGAGGCCAGG + Intergenic
903503086 1:23812714-23812736 TGTACCATGAAGAGGAAGCAGGG + Intronic
904017825 1:27436640-27436662 TCTTCCTTGTAGTTGCTGCATGG - Intronic
906414206 1:45607309-45607331 TTAACCATGTAGAGGAAGCAAGG + Exonic
906869950 1:49467149-49467171 TCTACCATGAAGGTGAGTCAAGG + Intronic
907412016 1:54289796-54289818 CCTACCCTGGAGATGGTGCAGGG - Intronic
907567332 1:55447660-55447682 TGTACTATGAAGATGATGTAAGG + Intergenic
907925708 1:58953529-58953551 TCTTCCATGCACATGGTGCAAGG - Intergenic
908607918 1:65820694-65820716 TCTACTTTGTAGATGAAGAAAGG - Intronic
908703698 1:66928487-66928509 TATACCATGGAGATGAAGGAGGG - Intronic
910438159 1:87226486-87226508 TTTTAAATGTAGATGATGCAAGG - Intergenic
912743975 1:112229444-112229466 TCTTCCAAGTAGATGTTGCTGGG - Intergenic
914424616 1:147563673-147563695 TCTACCAAGTAGATGATCTCAGG - Intronic
919634953 1:199994869-199994891 TCTACAATCTAGATAATGCCTGG - Intergenic
920081847 1:203380368-203380390 TCTACCACGTAGATGCAGTAGGG + Intergenic
1064310527 10:14208439-14208461 TCTACCGCGTGGATGCTGCAGGG + Intronic
1064320820 10:14303070-14303092 TCTACCATGCAGCTGAGGCCAGG - Intronic
1064638170 10:17389542-17389564 TCTTCCATGTAGATGAGGCATGG + Intronic
1065247240 10:23770689-23770711 TCTAGCATCTCTATGATGCACGG + Intronic
1065746091 10:28843839-28843861 TCTACCAAGAAGAGGATGAAAGG + Intergenic
1065882389 10:30047799-30047821 TCTACACTGTACATGATGCCTGG + Exonic
1067374280 10:45713049-45713071 TCAACCATTTAGAAAATGCACGG + Intergenic
1072203569 10:93182342-93182364 TCTACTATATACATGATGTAGGG + Intergenic
1072888977 10:99304552-99304574 TTTACAATGTATCTGATGCAGGG - Intergenic
1074066465 10:110019142-110019164 TCTAATATGTGGATGATGGATGG + Intronic
1074527126 10:114272387-114272409 TGTAACAAGAAGATGATGCAGGG + Intronic
1077537086 11:3129579-3129601 GCTTCCATGGAGAAGATGCACGG + Intronic
1079571326 11:21946766-21946788 TTTAACATGCAGATGATTCAAGG - Intergenic
1081095941 11:38935356-38935378 TCAACCATGTGTATGATGCTTGG + Intergenic
1085263342 11:75221438-75221460 TCTATCAGCTAGATGATGCTTGG + Intergenic
1088254393 11:107889274-107889296 TCTACAATGTAGATTTTACACGG - Intronic
1090262765 11:125333381-125333403 TCTACCATGCAGGTGATGGCAGG - Intronic
1093240336 12:16663023-16663045 TCTACAATGTACTTGATGCTGGG + Intergenic
1094095207 12:26696228-26696250 TCAACCAGCCAGATGATGCAAGG - Intronic
1095985560 12:47997330-47997352 TGTACCACGTAGTTGATGCTGGG - Intronic
1100192756 12:92210136-92210158 TCTACCATCTAAATGATGGTCGG - Intergenic
1100692425 12:97052783-97052805 CTTACCATGTAGATATTGCAAGG - Intergenic
1108386142 13:49901271-49901293 TCTACCATGTGGGTCAGGCAGGG + Intergenic
1113238067 13:108303857-108303879 TCTACCTTGTACATAATACATGG + Intronic
1117408226 14:55425896-55425918 ACTACCATGTAGCAGATGCTAGG - Intronic
1122280092 14:100616902-100616924 TCTCCCAGGTAGATGATTGACGG + Intergenic
1131400943 15:92125230-92125252 TCTACCATGTAGATGATGCATGG - Intronic
1140348605 16:74239598-74239620 TGTACCATTTAGATGATGTTGGG + Intergenic
1142342474 16:89532516-89532538 TCATCGATGTAGACGATGCAGGG - Exonic
1147563567 17:41523064-41523086 TCTACCATGTAGTTGCTGTGTGG + Intergenic
1148526603 17:48344033-48344055 CTTACCATACAGATGATGCAAGG + Intronic
1152873605 17:82772846-82772868 TCTCCCATGGAGATGATGGGTGG + Intronic
1156587567 18:38448247-38448269 TCTACCAGGGAAATGAAGCATGG - Intergenic
1159482952 18:69014478-69014500 TCTACTTGGTAGATGTTGCAAGG - Intronic
1160760604 19:782346-782368 TCAACCCTGGAGATGAAGCAGGG + Intergenic
1162222753 19:9192127-9192149 TCTGCCATGCAGCTGCTGCAGGG - Intergenic
1162742159 19:12779392-12779414 TCCTCCATGGTGATGATGCATGG - Intronic
1162841482 19:13359591-13359613 TCTACAATGTAAGTGATGCTGGG - Exonic
1163509844 19:17727893-17727915 TCCACCATGCAGATGCTGGATGG - Exonic
925230403 2:2227767-2227789 TCTAAAAAGTACATGATGCAGGG - Intronic
925242398 2:2343161-2343183 TCCACCATGCAGATAATGTATGG - Intergenic
928385671 2:30865855-30865877 TAGACCATGTAGGTGAGGCAGGG + Intergenic
935072022 2:99703131-99703153 GCTAACATTAAGATGATGCAGGG + Intronic
937092053 2:119212968-119212990 TCCACCATGTTGATGGTGCATGG + Intergenic
937790768 2:125958670-125958692 TCTACCATGTAGAAGGTTGATGG + Intergenic
939258136 2:139771571-139771593 TCCACCATGTTGAGGATACAAGG + Intergenic
939735389 2:145837938-145837960 GTTACGCTGTAGATGATGCAAGG - Intergenic
941234231 2:162948965-162948987 TCAACCATGAAGTTGATGTATGG - Intergenic
943558911 2:189437837-189437859 TCTCCTATGTACATTATGCAGGG + Intergenic
945657875 2:212647396-212647418 TAAACCTTGTAGAGGATGCAAGG + Intergenic
1169558211 20:6770461-6770483 TCCACCATGAAGGTGAGGCATGG + Exonic
1169830231 20:9816866-9816888 ATTACTATGCAGATGATGCAAGG + Intronic
1170341552 20:15333595-15333617 TCTGCCACTTAGATGATGCAGGG + Intronic
1174879665 20:54265260-54265282 TCTGCTGTGTAGATGATACAGGG + Intergenic
1174993418 20:55538933-55538955 TTTAACAGGTAGATGCTGCAGGG - Intergenic
1177398663 21:20571935-20571957 TCTACTATCTAGATTATGTATGG + Intergenic
1178395594 21:32240170-32240192 TCAACCAATTACATGATGCATGG + Intergenic
951584091 3:24197493-24197515 TGTACCATTTACATGATACAAGG - Intronic
952356193 3:32586731-32586753 TATATAATGTACATGATGCAGGG + Intergenic
954740099 3:52742612-52742634 TCTTGCCTGTAGATGATGTAGGG - Intronic
958642952 3:96832013-96832035 TCTACCCTTTCTATGATGCAGGG - Intronic
960629260 3:119712587-119712609 TCTAACATGTAGATAATATATGG - Intronic
961138205 3:124532118-124532140 TCTACACAGTAGATGATGCATGG + Intronic
961919765 3:130413632-130413654 TCTCCCATGTAGGTGGTGCTGGG + Intronic
963332966 3:143936603-143936625 TCTAAAATGTAAATAATGCATGG + Intergenic
966213184 3:177474037-177474059 TGTAGCATTTAGATGGTGCATGG - Intergenic
967371174 3:188748032-188748054 TCTACCTTGTGGATTTTGCATGG + Intronic
971308768 4:25506191-25506213 TCTACCTTGGAGCTGATGCTGGG + Intergenic
974449922 4:62041166-62041188 GCTACATTGTAGATAATGCAGGG + Intronic
974468814 4:62292778-62292800 TCTCCCATGCAGAGGAGGCAGGG - Intergenic
974734336 4:65910174-65910196 TCTACCATGCAGGTGATTGATGG - Intergenic
975850476 4:78566764-78566786 TCTTACATGCAGATGGTGCATGG - Intronic
982034703 4:151334301-151334323 TCTACCATGGATAAGATCCATGG + Intergenic
983313567 4:166097413-166097435 TCTACCATTTGGAAGATGGAGGG + Intronic
983606391 4:169590756-169590778 TCTATCATGTACATGTTTCAGGG + Exonic
983764441 4:171460252-171460274 TCAACCCTGTGGTTGATGCAGGG - Intergenic
986628866 5:9749629-9749651 TCTTCCATGTAGCTGTTGAAGGG + Intergenic
987955032 5:24728088-24728110 TCTGCCATGCAGACCATGCATGG - Intergenic
993256971 5:85604424-85604446 CCTGCCATGTAGCTGCTGCAGGG - Intergenic
993476246 5:88368666-88368688 TCCACCCTAGAGATGATGCATGG + Intergenic
994643635 5:102442569-102442591 TATACCATGTAGATAATTCAAGG - Intronic
998655925 5:144179582-144179604 TCTACCATGTTGGTGAAGGAAGG - Intronic
1006463107 6:34175373-34175395 TGCACCATGTAGCTGCTGCAGGG + Intergenic
1007023198 6:38543383-38543405 TCTAGAATGTAAATGATGCAGGG + Intronic
1007315797 6:40987780-40987802 TCTACAATGTAGAAGGTGCTTGG - Intergenic
1011706457 6:90005856-90005878 TCGAGGATGTAGATGATGCAGGG + Intronic
1013914911 6:115324961-115324983 AATACCATGTAGATGAGCCAAGG + Intergenic
1014693620 6:124592106-124592128 TCAACTATGTTGATGATGAAGGG + Intronic
1014818983 6:125964834-125964856 TGAACCATGTAAATGATGCCTGG + Intronic
1017713737 6:157192680-157192702 TCAACCATGTAAATGATCCCCGG + Intronic
1018666331 6:166141715-166141737 TCTACCATGGAGATTCTTCATGG + Intergenic
1019212455 6:170417518-170417540 TAAACAATGTAGATGAAGCAGGG - Intergenic
1020455267 7:8366004-8366026 TCTACCACTTAGAAGATGCATGG - Intergenic
1024862251 7:53858207-53858229 TCTCCCATGTATAAGATGCTAGG - Intergenic
1025795290 7:64733927-64733949 TCTGCCATGGAGAGGATCCATGG - Intergenic
1034083626 7:148303262-148303284 TCTTCCAGGTAGAGAATGCAAGG + Intronic
1036966252 8:13301510-13301532 TCTGCCATGTTGTTGATGTAAGG - Intronic
1041360778 8:57051622-57051644 GCTACCAGGTAGAGGAGGCAGGG - Intergenic
1043105025 8:76097673-76097695 TCTACCATATACATGCTGAAAGG - Intergenic
1044482713 8:92711446-92711468 TCTACCTTGTAGATGATGCCTGG - Intergenic
1044497490 8:92905055-92905077 TCTACTAGGTATATGTTGCAGGG + Intronic
1046125955 8:109908838-109908860 TTTACCATGTATAAGATGCATGG + Intergenic
1047672753 8:127166245-127166267 TCTACTAAGTACATGATGCAAGG - Intergenic
1051541707 9:18227263-18227285 CCTACCATGTATATGATGCTTGG + Intergenic
1058576970 9:106414211-106414233 TTTTTCATGCAGATGATGCACGG - Intergenic
1061257867 9:129463281-129463303 TCTACCATGTTGATGTTGGGTGG + Intergenic
1185948946 X:4408767-4408789 TTTCCCATGGAGATGATGGAAGG - Intergenic
1187276987 X:17824879-17824901 TCTACCGTGCAGGTGATGAAGGG + Intronic
1189501954 X:41569355-41569377 TCCAGCATGTAGATAATGAAGGG - Intronic
1191881858 X:65850385-65850407 TCCAGCATGTAGCTGATTCAAGG + Intergenic
1194239013 X:91421158-91421180 TCCACCACCTAGGTGATGCAGGG - Intergenic
1201736044 Y:17262710-17262732 TTTCCCATGGAGATGATGGAAGG - Intergenic
1202054402 Y:20814679-20814701 TCTGCCATCTAGATGTTTCATGG - Intergenic