ID: 1131406141

View in Genome Browser
Species Human (GRCh38)
Location 15:92166542-92166564
Sequence GTGAGTGAGGGGAAGCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 754
Summary {0: 1, 1: 0, 2: 8, 3: 65, 4: 680}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131406141 Original CRISPR GTGAGTGAGGGGAAGCTGGA GGG (reversed) Intronic
900581411 1:3411707-3411729 GTGAGTGCGGGGAACGTGGGAGG - Exonic
900738661 1:4316915-4316937 GTGAGTGGGTGGTGGCTGGAGGG + Intergenic
901215151 1:7550846-7550868 GTGAGAGAGGGTCAGCTGGGTGG - Intronic
901646713 1:10720805-10720827 GAGGGTGAGTGGAAGCTGGAGGG + Intronic
901653067 1:10754190-10754212 GGGAGTGAGAGGCAGGTGGATGG - Intronic
901774665 1:11552074-11552096 GTGAATGAAGGGAAGATGGAAGG + Intergenic
902122752 1:14181676-14181698 GGGAGAGAGGAGAAGCTGAATGG - Intergenic
902770078 1:18640806-18640828 GAGAGGGAGGGGGCGCTGGAGGG + Intronic
903033148 1:20477537-20477559 GTGAGGGAGGGCAGGCTGAAGGG - Intergenic
903184851 1:21623081-21623103 GTGAGGCATGGGAAGCAGGATGG - Intronic
903320038 1:22537585-22537607 GTGTGTGATGGGAAGTGGGAGGG - Intergenic
903929860 1:26855963-26855985 CTGAGGCAGGGGAAGGTGGAGGG - Exonic
904190358 1:28737997-28738019 ATGGGGGAGGGGAAGCGGGAGGG + Intronic
904380948 1:30110514-30110536 GTGAGTGATGGGAGGATGGGAGG - Intergenic
904464962 1:30702159-30702181 ATGAGTGATGGGAAAGTGGAGGG - Intergenic
904487818 1:30839309-30839331 ATGAGTGAATGGAAGATGGAAGG + Intergenic
904609364 1:31716589-31716611 CTGAGGGAGGTGGAGCTGGATGG - Intergenic
904752510 1:32749742-32749764 GTGAGGGAGAGAGAGCTGGAAGG - Intronic
904975735 1:34454881-34454903 CTGAGTGAGAGGGTGCTGGAGGG - Intergenic
905387163 1:37612999-37613021 GGGAGTGTGAGGAAGCCGGAAGG + Intronic
905861614 1:41355633-41355655 GTGGGAGGAGGGAAGCTGGAAGG + Intergenic
906035519 1:42748177-42748199 GTGAGTGCGGGGCAGGTGCAGGG - Intronic
906244950 1:44266974-44266996 GTAAGAGAAGGGAAGCTGAAGGG + Intronic
906277030 1:44524098-44524120 GTGAATGGGGGGATGCTGGAGGG + Intronic
906917338 1:50024930-50024952 GTGAGAGAGTTCAAGCTGGAAGG - Intergenic
907284779 1:53372648-53372670 GTCAGTGTGGGGGTGCTGGAGGG - Intergenic
907470732 1:54671805-54671827 GTGAGTGTGGGGGAGATGGATGG + Intronic
907474438 1:54695999-54696021 GTGAGTCAGGAGAAGTTGGTGGG + Intronic
908486296 1:64597079-64597101 GTGAGTGGGGGGGTGCTGGAGGG + Intronic
911417710 1:97596803-97596825 GAGATTCAGGGGATGCTGGATGG - Intronic
911463743 1:98224245-98224267 TAGAGTGAGGAGAAGCGGGAAGG + Intergenic
911694242 1:100870529-100870551 ATGAGGGAGGGGAAGAAGGAGGG + Intergenic
912212739 1:107572389-107572411 GTGTGTGCGGGGGAGGTGGATGG + Exonic
912227825 1:107755388-107755410 GGGGGTGAGGGGAAGCTGGATGG + Intronic
912439547 1:109687910-109687932 GTGAGCGAGGGTCCGCTGGACGG + Intronic
912904833 1:113693357-113693379 GTAAAGGAGGTGAAGCTGGAAGG + Intergenic
913298333 1:117343978-117344000 CAGAATGATGGGAAGCTGGAGGG + Intergenic
913432061 1:118806098-118806120 GTGATTGAGGGAAAGAGGGAGGG + Intergenic
914417714 1:147499220-147499242 ATGACTGAGGGGAAGATGAATGG - Intergenic
914686298 1:149982819-149982841 GTAAGAGAGGAGAAGCTGGAAGG - Intronic
915226696 1:154417021-154417043 GTCAGGGAGGGGAAGCTGGGGGG + Intronic
915562283 1:156694242-156694264 GGGTGGGAGGGGAAGCTGGAGGG + Intergenic
916046679 1:161005282-161005304 GGGAGGGAGGGGAAGGAGGAAGG - Intronic
916051885 1:161042174-161042196 GTGTCTGAGGGGCAGCTGGATGG - Exonic
916863975 1:168836748-168836770 GAGAGGGAGGGGAAGGGGGAGGG - Intergenic
917050127 1:170913535-170913557 GTGAAGGAGGAGAAGCTGTAGGG - Intergenic
917436953 1:175031636-175031658 GTGAGTGAGAGGAAGAAGGTAGG + Intergenic
918313622 1:183304618-183304640 ATGAGGGCGGGGCAGCTGGAGGG - Intronic
919588740 1:199472348-199472370 GTGAATGAGTTGAAGCTGAAAGG + Intergenic
919679797 1:200423178-200423200 GTGAGTGAGGTAAAGCTTGTTGG - Intergenic
919841082 1:201609870-201609892 GGGAGAGAGGGAAACCTGGATGG + Intergenic
919856748 1:201711383-201711405 GTCAGGGAGGGGAGGCTGGGTGG - Intronic
922272147 1:224043837-224043859 GTGGGGGAGGGGATGCTGGTGGG - Intergenic
922424749 1:225482458-225482480 GTAAGTGTGGGGAGGATGGAGGG - Intergenic
922462339 1:225823472-225823494 CTGAGTCTGGGGAAGCTTGATGG - Intronic
923524342 1:234760505-234760527 GTGGGGGAGGGGGAGCTGGGAGG + Intergenic
923759584 1:236828855-236828877 GTGGATGTGGGGAAGATGGAAGG + Intronic
924169060 1:241318004-241318026 GTGAGTGAGGGGCACCAAGATGG - Intronic
924268612 1:242308934-242308956 GTGTGGGAGGGGAGGATGGAAGG + Intronic
924883390 1:248187685-248187707 GAGAGTGAGCAGAAGCAGGATGG + Intergenic
1062798251 10:360243-360265 GAGAGTGAGGTGCAGCTAGAAGG - Intronic
1063767317 10:9157589-9157611 ATGAGTGAAGGAATGCTGGAGGG - Intergenic
1063929126 10:11011407-11011429 GTGGGTGAGGGGGAGAGGGAAGG + Intronic
1064587235 10:16851656-16851678 GTGAGGGAGGGAAAGATAGAGGG - Intronic
1064587248 10:16851712-16851734 GGGAGGGAGGGAAAGATGGAGGG - Intronic
1064587255 10:16851732-16851754 GTGAGGGAGGGAAAGATAGAGGG - Intronic
1064587267 10:16851790-16851812 GGGAGGGAGGGAAAGATGGAGGG - Intronic
1064587290 10:16851884-16851906 GTCAGGGAGGGAAAGATGGAGGG - Intronic
1064587305 10:16851940-16851962 TTGAGGGAGGGAAAGATGGAGGG - Intronic
1064587358 10:16852127-16852149 GTGAGGGAGGGAAAGATGGAGGG - Intronic
1064587396 10:16852267-16852289 GTGAGGAAGGGAAAGATGGAGGG - Intronic
1064587410 10:16852323-16852345 GGGAGGGAGGGAAAGATGGAGGG - Intronic
1064587430 10:16852399-16852421 GTGAGGGAGGGAAAGATGGAGGG - Intronic
1064587448 10:16852463-16852485 GTGAGGGAGGGAAAGATAGAGGG - Intronic
1064600753 10:16990057-16990079 GTGAGTGAAGGAAAGGAGGAGGG - Intronic
1065421778 10:25552734-25552756 GTGAGTCAGGGGAATATGAATGG - Intronic
1065593760 10:27292673-27292695 GGGAGAGAGAAGAAGCTGGAAGG - Intergenic
1065696828 10:28388114-28388136 GGAAGGGAGGGGAAGGTGGAAGG + Intergenic
1066716293 10:38289834-38289856 GTGTGGGAGGGGAGGATGGAAGG - Intergenic
1067177966 10:43963508-43963530 GTGAGTGTGGGGTAGCGGCATGG - Intergenic
1067390338 10:45857556-45857578 GTTAGTGAGGGGATGGTGTAGGG + Intergenic
1067501135 10:46806310-46806332 GTTAGTGAGGGGATGGTGTAGGG - Intergenic
1067593445 10:47533605-47533627 GTTAGTGAGGGGATGGTGTAGGG + Intronic
1067640554 10:48041709-48041731 GTTAGTGAGGGGATGGTGTAGGG + Intergenic
1067809795 10:49417891-49417913 GTGGGTGGGGGGGAGATGGAGGG - Intergenic
1069224748 10:65929017-65929039 GTGGGTGAGGGGAGGGGGGAGGG - Intronic
1070050646 10:72886332-72886354 GTCAGTAAAGGGATGCTGGAAGG - Exonic
1070145901 10:73773042-73773064 GTGAGTGAGGGCGGGCCGGAGGG + Intronic
1070675088 10:78406736-78406758 GTGAGGCCGGGGAAACTGGATGG + Intergenic
1070891359 10:79944166-79944188 GTGAGTGAATGGAAGCTGGAAGG - Intronic
1070984037 10:80672859-80672881 GTGAGTGAGGGGGATGTGGATGG + Intergenic
1071094389 10:81956522-81956544 GTGAATGAGAGGAATCAGGATGG - Intronic
1071568037 10:86681559-86681581 GCGAGTGAGGAGAAGGCGGAGGG - Exonic
1071798520 10:89031641-89031663 GTCAGTGAGGGGAAGAAGCAAGG + Intergenic
1071946653 10:90653485-90653507 GTGTGTGAGGGGAAGCTGCAAGG - Intergenic
1072631730 10:97151236-97151258 GTGGGTGAGTAGAAGATGGAAGG + Intronic
1072679271 10:97494402-97494424 GGAAGTGAGGGGAAGCGGGTAGG + Intronic
1072802781 10:98404992-98405014 GTGAGGGAGGGGAGGGAGGATGG + Intronic
1073059273 10:100723892-100723914 GAGATTGATGGGAAGTTGGAGGG + Intergenic
1073075486 10:100823626-100823648 GAGAATAAGGGGAATCTGGAGGG + Intronic
1073097170 10:100986992-100987014 GAGAGTGGGTGGAAGCTGGCCGG + Intronic
1073102650 10:101014870-101014892 GTGTGTGAGGGCGAGCTGGGGGG - Intronic
1073104955 10:101027257-101027279 GTGAGGGAGGGGAGGGTGGAGGG - Intronic
1073144645 10:101272552-101272574 GTGGTTGAGGGCAAGCTGGAAGG + Intergenic
1073148433 10:101295513-101295535 ATGTGTGTGGGGCAGCTGGAGGG - Intergenic
1073258571 10:102171606-102171628 GTTAATTAGGGGAAGCTAGAGGG + Intergenic
1073442100 10:103558249-103558271 GTGAGTGAGGGGAGGGTGACAGG + Intronic
1073607409 10:104910173-104910195 GTGAGTGACAGGTAGCTGGCAGG + Intronic
1073682196 10:105716760-105716782 GGGAGGGAGGGGAAGAAGGAAGG - Intergenic
1073943938 10:108729846-108729868 GGGAGAGAGAGGAAGATGGAGGG + Intergenic
1074627721 10:115211753-115211775 GTGGGTGAGGGGAGGGGGGAGGG - Intronic
1074783310 10:116817980-116818002 GAGAGGAAGAGGAAGCTGGAGGG - Intergenic
1075571728 10:123551297-123551319 GTGACTGAAGCTAAGCTGGATGG + Intergenic
1075672191 10:124270349-124270371 GTGAGTGAGGTCAGCCTGGAAGG - Intergenic
1076175845 10:128367193-128367215 ACGAATGAGGGGCAGCTGGAGGG + Intergenic
1076558744 10:131347184-131347206 GAGAGGGAGGGGAGGCAGGAAGG - Intergenic
1076597152 10:131630933-131630955 GTGAGTGAGTGGTAGCAGGGAGG - Intergenic
1076729283 10:132430149-132430171 GTGTGTGAGGGAGAGCAGGAAGG + Intergenic
1077319104 11:1933073-1933095 GTGAGTGAGTGGATGATAGATGG - Intronic
1077533146 11:3106663-3106685 GTGAGTGACGGGAGGGAGGATGG - Intronic
1080144825 11:28968693-28968715 AAGAGTGAGGGGAAACAGGAAGG + Intergenic
1080214592 11:29826862-29826884 GAGAGTGAGGGAAAGCAGGGTGG + Intergenic
1080767036 11:35306677-35306699 GTGAGTGGGGGGAAAGGGGAAGG - Intronic
1080824281 11:35834865-35834887 GTGAGCAGGGGGAAGGTGGAGGG - Intergenic
1081385147 11:42463327-42463349 GGGAGGGAGGGGAAGGTGGAAGG + Intergenic
1081497700 11:43632005-43632027 GTGAGGGAGGGGGAGGAGGAGGG + Intronic
1081623763 11:44634722-44634744 GGGAGGGAGGGGAAGGAGGAGGG - Intergenic
1081735995 11:45404665-45404687 GAGAGTCAGGGGGAGCAGGAGGG - Intergenic
1084358092 11:68652628-68652650 ATCAGTGAGTGGAAGCTGGGGGG + Intergenic
1085511125 11:77088667-77088689 GTGACTAGGGTGAAGCTGGATGG + Intronic
1085619956 11:78030605-78030627 GTGAGTGAGGGGAGGGCAGAAGG - Intronic
1086142234 11:83512052-83512074 GGGAGCCAGGGGAAGCTGGGTGG + Intronic
1086734078 11:90283872-90283894 GTGGGTGAGGGGATGGAGGAAGG + Intergenic
1087100255 11:94356960-94356982 TTGATTGAGGGGAGGCTAGATGG + Intergenic
1088755809 11:112884319-112884341 GAGAGTGTGGAGAACCTGGAAGG - Intergenic
1088995072 11:114989110-114989132 GGGAGTGTAGGGAAGCGGGAGGG - Intergenic
1089161325 11:116439740-116439762 GTGGGTGAGGCCAAGGTGGATGG + Intergenic
1089190107 11:116647583-116647605 GTGAGTGAGTTGAAGAAGGAAGG + Intergenic
1089417762 11:118306723-118306745 CTGAGTGAGGGCATCCTGGAGGG + Intronic
1089539576 11:119181831-119181853 GGGAGTCAGGGGAAGAGGGAAGG + Intronic
1089606220 11:119643107-119643129 GGGAGTGAGGGCAATTTGGAGGG - Intronic
1090057935 11:123439278-123439300 GTGGGAGAAGGGAAGCAGGATGG + Intergenic
1090114079 11:123947665-123947687 GTAAGGGAGGGGAAGGTTGAAGG + Intergenic
1090602546 11:128388293-128388315 GGGAGGGAGGGGCAGCTGGAAGG - Intergenic
1091667074 12:2426877-2426899 GTGTGAGAGGAGAAGCTGCAAGG + Intronic
1092056535 12:5512381-5512403 GAGAATGAGGGGAAGCCAGAGGG + Intronic
1092281730 12:7102522-7102544 GGGATGGAGGAGAAGCTGGATGG - Intronic
1092322095 12:7487082-7487104 GAGAGAGAGGGGAAGGTGGATGG + Intronic
1092984337 12:13831092-13831114 GTGGGAGAGCGGAAGCAGGAAGG - Intronic
1093111799 12:15161512-15161534 GTGAGTGAAGGGGATCTGGCTGG - Intronic
1093944972 12:25098266-25098288 GTGATTGAGGGGAAGCCCCAAGG - Intronic
1094492264 12:30968311-30968333 GTGCCTGTGTGGAAGCTGGATGG - Intronic
1095282705 12:40374605-40374627 GTCAGTGAGTAGAAGGTGGACGG - Intergenic
1095376418 12:41534437-41534459 AGGAGTGAGGGGAAGGGGGAAGG - Intronic
1095426086 12:42076005-42076027 GTGAGAGAGGGCAAGGTTGAGGG + Intergenic
1095991374 12:48036908-48036930 GTGAGTGAGGGGATGTGAGATGG + Intergenic
1096127107 12:49128067-49128089 GTGGGTGAGGGGATGGAGGAAGG - Exonic
1096145080 12:49273102-49273124 GTGGGTGAGGGGATGGAGGAAGG + Exonic
1096522245 12:52191096-52191118 GTGAGTGCGGGGCTGCTGGAAGG - Intronic
1096792027 12:54051469-54051491 GTGAGTGAGGGGGCGGAGGAAGG - Intronic
1097086886 12:56475479-56475501 GGGACTCAGAGGAAGCTGGAGGG + Exonic
1097188539 12:57208671-57208693 GTGAGTGTGGGCAGGCCGGAGGG - Intronic
1098184711 12:67883906-67883928 GGCAGTGAAGGGAGGCTGGAAGG - Intergenic
1098377924 12:69837270-69837292 GTGAGTGAGAGGAGGATAGAAGG - Intronic
1100306229 12:93352448-93352470 GTGGGTGAGAGGAAGCTTGAAGG + Intergenic
1100466553 12:94850654-94850676 GTGAGAGAGAGGAAGCAAGAGGG + Intergenic
1101049386 12:100845253-100845275 GTGAATGGGCGGAACCTGGAGGG + Intronic
1101315524 12:103625501-103625523 GTGGGTGGGGGGAAGGAGGAGGG - Intronic
1101527647 12:105546233-105546255 GTGGGTGAGGGGAATGAGGAAGG + Intergenic
1102559717 12:113753646-113753668 GTGGGGGAGGGGATGCTGTAAGG + Intergenic
1102763287 12:115408290-115408312 GTTTCTGAGGGGAAGGTGGAAGG + Intergenic
1102973404 12:117189501-117189523 GTGAGTGAGTGAATGCTGGTGGG - Intronic
1103123369 12:118399574-118399596 TTGAGGGAGGGGAGGATGGATGG + Intronic
1103437466 12:120937820-120937842 GTGAGGGAGAGGAAGCAGGATGG - Intergenic
1104516640 12:129433081-129433103 GTAAGTGATGGGAATCTAGATGG - Intronic
1104606962 12:130196931-130196953 GTGAGAGTGGGGGAGATGGAGGG + Intergenic
1104765152 12:131325675-131325697 ATGTGTGAGGGGGAGCTGGCAGG - Intergenic
1104814211 12:131636726-131636748 GTGTGTGAGGAGGAGCTGGCAGG + Intergenic
1105265339 13:18809984-18810006 GTGAGTCAGGGCACCCTGGAGGG - Intergenic
1106382336 13:29252450-29252472 GTGAGTGAGGCGTTGCTGCAGGG + Intronic
1106408726 13:29496426-29496448 GGGAGTGAGAGGGAGCTGGCTGG + Intronic
1106823309 13:33490629-33490651 GTGGTGGATGGGAAGCTGGAAGG - Intergenic
1107243355 13:38264499-38264521 GAGAGTGAGGAGAAGCAGGGTGG + Intergenic
1108115257 13:47120502-47120524 GGGTGTGCGGGGAAGCTGCAAGG + Intergenic
1108212492 13:48152328-48152350 GGGTGTGAGGGGATGCAGGAGGG + Intergenic
1108276980 13:48820942-48820964 GTGAGTGAGGGGAAGTGGGCTGG + Intergenic
1112336983 13:98524104-98524126 GGAAGTGAGGAGATGCTGGATGG + Intronic
1112362119 13:98727797-98727819 GTGAGTGAGGGGGAAGGGGATGG - Intronic
1112986656 13:105458273-105458295 GTGAGGAAGGGGGAGCTGGGGGG - Intergenic
1113692371 13:112320325-112320347 GTGGGTGAGTTGAGGCTGGAGGG - Intergenic
1113879311 13:113614752-113614774 GTGAGCGACGGGAACCTGGGTGG + Intronic
1113934096 13:113984335-113984357 GTGAGTGATGGGTAGGTGGACGG - Intronic
1113934123 13:113984470-113984492 GTGAGTGATGGGTGGATGGACGG - Intronic
1113934137 13:113984524-113984546 GTGAGTGATGGGTGGATGGATGG - Intronic
1113934146 13:113984555-113984577 GTGAGTGATGGGTGGATGGATGG - Intronic
1113934200 13:113984798-113984820 GTGAGTGATGGGTGGATGGATGG - Intronic
1113934456 13:113986390-113986412 GTGAGTGATGGGTGGATGGACGG - Intronic
1113934479 13:113986475-113986497 GTGAGTGATGGGTGGATGGATGG - Intronic
1113934800 13:113988380-113988402 GTGAGTGATGGGTGGATGGACGG - Intronic
1113934814 13:113988434-113988456 GTGAGTGATGGGTGGATGGATGG - Intronic
1113934823 13:113988465-113988487 GTGAGTGATGGGTGGATGGATGG - Intronic
1113934882 13:113988733-113988755 GTGAGTGATGGGTGGATGGATGG - Intronic
1113935034 13:113989440-113989462 GTGAGTGACGGGTGGATGGACGG - Intronic
1113935086 13:113989673-113989695 GTGAGTGACGGGTGGATGGATGG - Intronic
1114146210 14:19980746-19980768 GTGGGTAGGTGGAAGCTGGATGG - Intergenic
1114288494 14:21268890-21268912 GTGGGGGAGGGGAAGGGGGAAGG - Intronic
1116950697 14:50875964-50875986 GTGAGTGAGGGGAGCTTAGAAGG + Intronic
1117422673 14:55562340-55562362 TTGGGTGAGATGAAGCTGGATGG + Intronic
1117516052 14:56502287-56502309 CTGAGTGATGGGAACCTGGGAGG - Intronic
1117608947 14:57462960-57462982 GTGACAGAGGGGAAATTGGAGGG + Intergenic
1117756150 14:58976124-58976146 AGGAGTGAGGAGAAGCTGGAGGG + Intergenic
1118635733 14:67747420-67747442 GAGACTGAAGGGAAGCAGGAGGG + Exonic
1118748081 14:68788701-68788723 GGGAGGAAGGGGAAGCTAGATGG - Exonic
1119341905 14:73886641-73886663 GTGAGTGAGTGGGAGCGGGGCGG + Exonic
1119391776 14:74295863-74295885 GTGCATCAGGAGAAGCTGGAGGG - Exonic
1119643209 14:76329972-76329994 GGGAGGGAGGGGAAGAGGGAAGG + Intronic
1119806635 14:77486465-77486487 GTGGATGAGTGGAAGGTGGAAGG + Intronic
1119847787 14:77843450-77843472 GTGATTAAGGGGCAGATGGAGGG + Intronic
1121057736 14:90874326-90874348 GGGAGTGAGGGCATCCTGGAAGG + Intronic
1121686008 14:95835740-95835762 GTGAGAGATGCCAAGCTGGAAGG + Intergenic
1121885855 14:97542174-97542196 GTGTGTTAGCAGAAGCTGGAGGG - Intergenic
1122257583 14:100490286-100490308 GGGAGGGAGGGGAGGCAGGAAGG + Intronic
1122353521 14:101110864-101110886 GGGAGTGACGGGAAGCAGGAGGG + Intergenic
1122553183 14:102561090-102561112 CTGAGTGAGGTGAGGCAGGATGG + Intergenic
1122931224 14:104933766-104933788 CTGAGTGAGGGGAGGGTGGGAGG + Exonic
1122931307 14:104933971-104933993 CTGAGTGAGGGGAGGGTGGGAGG + Exonic
1123001853 14:105300142-105300164 GACAGTGAGGGGCAGCTTGAGGG + Intronic
1123706570 15:22955269-22955291 ATGAGTGGAGGGAGGCTGGATGG + Intronic
1124841649 15:33247629-33247651 GTGGGTGAGGGTAAGCAGGGGGG + Intergenic
1125397711 15:39268367-39268389 CTGGGTGAGGGGAAGGGGGAGGG + Intergenic
1125463161 15:39925281-39925303 GTGTGTGATGGGGAGCAGGAGGG - Intergenic
1126100630 15:45116315-45116337 GTGTGTCAGGGATAGCTGGAGGG + Intronic
1126379503 15:48031379-48031401 AGGAGTGAGGGGAAGTGGGAGGG + Intergenic
1126408714 15:48349794-48349816 GGGAGAGAAAGGAAGCTGGATGG - Intergenic
1127075314 15:55319414-55319436 GTGAGTGAGGGGACACTGTCTGG + Intronic
1127187181 15:56492008-56492030 AAGAGTGAGGAGTAGCTGGAAGG + Intergenic
1127586920 15:60387318-60387340 GTGAGTGTGGGGGAAGTGGAAGG - Intronic
1127760614 15:62135919-62135941 GTGTGGGAGGAGACGCTGGAGGG + Intergenic
1127884644 15:63189019-63189041 GTGACTGAGGGGCTGCGGGAGGG + Intergenic
1128369030 15:67025855-67025877 GAGAGAGAGGGCAAGCGGGAAGG + Intergenic
1128406930 15:67351231-67351253 GGGGGTGGGGGGAAGCAGGAGGG - Intronic
1128515505 15:68339468-68339490 CAGAGTGAGGGGAGGCTGGCGGG - Intronic
1129184794 15:73899485-73899507 CTGTGTGAGGGGAACCTGAAAGG + Intergenic
1129200315 15:73994750-73994772 GTGCGTGAAGAGAAGCTGAAGGG - Exonic
1129234268 15:74214345-74214367 GTGAGTGGAGGGAGGCAGGAAGG - Intergenic
1129602981 15:77011020-77011042 GTGAAGGAGGGGAAGCAGGCGGG + Intronic
1129712186 15:77826042-77826064 GTGAGTGGGGTGGGGCTGGAGGG + Intergenic
1130624874 15:85503910-85503932 GTGAGGGAGATGATGCTGGAGGG + Intronic
1130850543 15:87789409-87789431 GTGAGTGGGGGGAGGGGGGAGGG + Intergenic
1131013744 15:89040798-89040820 GTGAGAGAGAGGATACTGGATGG + Intergenic
1131406141 15:92166542-92166564 GTGAGTGAGGGGAAGCTGGAGGG - Intronic
1131467625 15:92668102-92668124 GGGAGGGAGGGGGAGCGGGAGGG + Intronic
1131545663 15:93313670-93313692 GGGAGAGAAGGGAAGCGGGAGGG - Intergenic
1131630262 15:94168635-94168657 GTGAGTGAGGGCTATCTGGTTGG + Intergenic
1131986987 15:98052461-98052483 GTGAATGAAGGGAAGCATGAGGG - Intergenic
1132240391 15:100253349-100253371 GTGAGGGAGGGGAAGGTAGAGGG + Intronic
1132385346 15:101396496-101396518 GAGAGGGTGGGTAAGCTGGAGGG - Intronic
1132478865 16:155926-155948 GGGATGGAGGGGAAGGTGGAAGG + Intronic
1132981464 16:2740438-2740460 GTGAGGAAGGTGAGGCTGGAGGG - Intergenic
1133017813 16:2952694-2952716 GTGAGTGAGGGGCTGAGGGATGG - Intergenic
1133378239 16:5307366-5307388 GGGAGGGAGGGGAAGATGGCAGG - Intergenic
1133729074 16:8563973-8563995 GTGAGTGAGGGAGGGCGGGAGGG + Intergenic
1134291804 16:12907385-12907407 GGGAGGGAGGGGAAGAGGGAAGG - Intronic
1134411458 16:14005718-14005740 TTGAGTGTGGGGAACCTGAAAGG + Intergenic
1134745858 16:16587726-16587748 GAGAGAGAGGGGAAGGAGGATGG + Intergenic
1134846335 16:17443986-17444008 TTGAGTGAGGGGAGCCTGGTGGG - Intronic
1134999621 16:18766016-18766038 GAGAGAGAGGGGAAGGAGGATGG - Intergenic
1135033908 16:19060651-19060673 GTGAGTGATGGGAAGAGGCAAGG + Intronic
1135726537 16:24858440-24858462 ATGAGTGAGTGGATGGTGGATGG + Intronic
1135737206 16:24941662-24941684 GTGAGTGGGGGGAAACAGAAAGG - Intronic
1136067862 16:27770877-27770899 GGAAGTGAGAGGAGGCTGGAAGG - Intronic
1136510604 16:30736309-30736331 GTGAGGGAGAGGAAGCTGGCCGG + Exonic
1136771524 16:32845743-32845765 GTGCGTGATGGGAACTTGGATGG - Intergenic
1138579404 16:57930546-57930568 GAGAGAGAGGGGAAGGAGGAGGG + Intronic
1138752511 16:59440788-59440810 GGGAGGGAGGGGAAGGGGGAGGG - Intergenic
1138824087 16:60297761-60297783 GTGGATGAGGGAAAGCTGGTGGG - Intergenic
1139431805 16:66914767-66914789 ATGAGTGATGGGAGGTTGGATGG + Intronic
1139547049 16:67654250-67654272 GTGAGTGAGGGGCATCTGCTGGG + Intronic
1139591644 16:67936365-67936387 GGGAGGGACGGGGAGCTGGAGGG - Intronic
1140440619 16:74984903-74984925 GTGGGGGAGGGGAAGCGGGGAGG + Intronic
1140655157 16:77132406-77132428 GAGAGGGAGGGGAAGGGGGAGGG - Intergenic
1141045870 16:80715767-80715789 GAGAGTGAGGAGGAGATGGAAGG - Intronic
1141672666 16:85500859-85500881 GAGACTGTGAGGAAGCTGGAAGG - Intergenic
1142254508 16:89007182-89007204 GGGAGTGGGGAGAAGATGGAGGG - Intergenic
1142353120 16:89588814-89588836 GGGGGTGAGGGGAAGGTGGTGGG - Intronic
1203073948 16_KI270728v1_random:1107854-1107876 GTGCGTGATGGGAACTTGGATGG - Intergenic
1142641441 17:1288267-1288289 GTGGGGGATGAGAAGCTGGAGGG - Intronic
1142641553 17:1288521-1288543 GTGGGGGATGAGAAGCTGGAGGG - Intronic
1142641582 17:1288593-1288615 GTGGGGGATGAGAAGCTGGAGGG - Intronic
1142641605 17:1288647-1288669 GTGGGGGATGAGAAGCTGGAGGG - Intronic
1142641673 17:1288792-1288814 GTGGGGGATGAGAAGCTGGAGGG - Intronic
1143007316 17:3845723-3845745 GTGAGTGAGGAGGGGCTGGAAGG - Intronic
1143385620 17:6528609-6528631 GAGAGTGAGAGGGAGCAGGAGGG - Intronic
1143463212 17:7117297-7117319 ATTAGTGAGGGGAAACAGGATGG - Intergenic
1143474034 17:7192864-7192886 GAGAGTTAGAGAAAGCTGGAGGG + Intronic
1143902679 17:10185856-10185878 GTGAGTGTGGAGAAACAGGATGG + Intronic
1144584197 17:16478028-16478050 GTGAGAGCAGGGACGCTGGATGG - Intronic
1144789200 17:17848080-17848102 GTGGGGCAGGGTAAGCTGGAGGG + Intronic
1145076164 17:19856490-19856512 GAGAATGAGGGGAACCTGGGAGG + Intronic
1145398090 17:22511864-22511886 GTGAGTGAGGGAGAGGAGGAAGG - Intergenic
1145863318 17:28225481-28225503 GCCAGGGAGAGGAAGCTGGAAGG + Intergenic
1145994357 17:29096990-29097012 GTGAGTGAGGGGAAGACCCAGGG + Intronic
1147056243 17:37837539-37837561 GTGGGGGTGGGGGAGCTGGAGGG - Intergenic
1147927633 17:43955237-43955259 GCCAGGGAGAGGAAGCTGGAAGG - Intronic
1148144563 17:45354788-45354810 GTGAGAGAGGGAAGGCAGGAAGG - Intergenic
1148214174 17:45825412-45825434 GTGGGTGGGGGAAGGCTGGACGG - Intronic
1148462307 17:47845809-47845831 GGGAGCGAGGGGAAGGGGGAGGG + Exonic
1148677202 17:49452319-49452341 TTCAGTCAGGGGAAGCAGGAAGG - Intronic
1148679478 17:49465541-49465563 GGGCGGGCGGGGAAGCTGGACGG - Intronic
1149498288 17:57132646-57132668 GTGAGGGAGGGTGGGCTGGAGGG + Intergenic
1150979812 17:70128403-70128425 CTGAGAGAGGGGAAGTTAGAAGG - Intronic
1151367428 17:73626553-73626575 GTGGGGGATGGGGAGCTGGAGGG - Intronic
1152742133 17:82023026-82023048 GTGAGGGAGGGGCTGCTGGAGGG - Intronic
1152797176 17:82314206-82314228 GTGAGTGAGGGGCAGGTGTGAGG + Intergenic
1154002516 18:10494521-10494543 GTCAGTGTGGGGAAGGAGGATGG - Intergenic
1154423055 18:14251545-14251567 GTGAGTCAGGGCACCCTGGAGGG + Intergenic
1155739682 18:29272687-29272709 GTGAATGAGAGGGAGCTGAAAGG - Intergenic
1156179260 18:34583848-34583870 GTGAGAGAGGGGTAGCTGTCAGG - Intronic
1156496836 18:37531248-37531270 CTCAGTGAGGAGTAGCTGGAGGG - Intronic
1157113505 18:44842715-44842737 GTGTGTGGGAGGAAGCTGAAAGG + Intronic
1157234697 18:45953515-45953537 GGCAGTGAAGGGAAGCTGGAGGG - Intronic
1157406434 18:47425770-47425792 ATGAGAGAGGGGAAGCAGGGAGG - Intergenic
1157557275 18:48621220-48621242 GGGAGTGAGGAGGAGCAGGAGGG + Intronic
1157775336 18:50390570-50390592 GTGAGTGACTGGAAGCTGCCTGG - Intronic
1158149822 18:54355836-54355858 TTCAGTTAGGGGAAGCTGGCAGG + Intronic
1158245739 18:55430304-55430326 GTAAGTGGGGGGAAGCAGAATGG + Intronic
1158406599 18:57165471-57165493 CAGAGTCAGGGGCAGCTGGATGG - Intergenic
1158425771 18:57338578-57338600 GAGAGAGAAGGGAAGGTGGAGGG - Intergenic
1159564798 18:70036543-70036565 GTGGGTGAAGGGTAGCAGGAGGG + Intronic
1160506039 18:79427387-79427409 GTGGGTTGGGGGGAGCTGGATGG + Intronic
1160506052 18:79427424-79427446 GTGGGTGGGGGGGAGCTGGACGG + Intronic
1160506073 18:79427494-79427516 GTGGGTCGGGGGAAGCTGGACGG + Intronic
1160506095 18:79427567-79427589 GTGGGTCGGGGGGAGCTGGATGG + Intronic
1160506147 18:79427744-79427766 GTGGGTGGGGGGGTGCTGGACGG + Intronic
1160791006 19:923793-923815 GGGGGTGAGGGGATGCAGGATGG - Intergenic
1160849246 19:1182174-1182196 GAGAGAGAGGGGACCCTGGAGGG + Intronic
1160965620 19:1745891-1745913 GGGAGGGAGAGGAGGCTGGAAGG + Intergenic
1161657652 19:5525793-5525815 GTGAGGGAGGGGAGGATGGATGG - Intergenic
1161756580 19:6138472-6138494 GAGAGAGAGGGGAAGGGGGAAGG + Intronic
1161821575 19:6533632-6533654 GAGAGGGAGGGGAAGGAGGAAGG - Intronic
1162117787 19:8442031-8442053 GTGATTGAGGGGCAGGTGGCTGG + Intronic
1162145902 19:8611850-8611872 GTGAATGAGGAGGACCTGGATGG + Intergenic
1162168124 19:8768289-8768311 GGGAGTGAGGGGGGGATGGAGGG - Intergenic
1162402611 19:10454923-10454945 GTGAGTGAGGGGAAGCACGTGGG + Intronic
1162582609 19:11540035-11540057 GTGAGTGGGGGGAGGTGGGAGGG - Intronic
1162751576 19:12833100-12833122 GTGAGGGAGGGGTCGCTAGAGGG + Intronic
1163501697 19:17680116-17680138 GTGAGGGAGGGGATTCGGGAAGG + Intronic
1163560859 19:18018625-18018647 GGGAGGGAGGGGGAGCTGGAGGG - Intergenic
1163609931 19:18295482-18295504 GTGGGTGAGTGGATGGTGGATGG - Intergenic
1164394597 19:27851744-27851766 GGGAGTGAGGAGCAGCTGGTGGG - Intergenic
1164598284 19:29544672-29544694 GGCAGTGTTGGGAAGCTGGAAGG + Intronic
1164721268 19:30433315-30433337 GGAAGTGGGGGGAAGATGGATGG - Intronic
1165016226 19:32882034-32882056 GTGAATGAGGGGACGCTGCCAGG + Intronic
1165300117 19:34963491-34963513 TTGAGTCAGGGGACCCTGGAAGG - Intronic
1165323869 19:35102793-35102815 GTGAGTGAGGGGCAGGTGGGAGG - Intergenic
1165349949 19:35269824-35269846 GTGACTGATGGTCAGCTGGACGG + Exonic
1165823783 19:38693929-38693951 GTGAGTGCGGGGAAGGGGGGTGG - Intronic
1165847404 19:38827084-38827106 GGGAGGGAGGGGAAGGAGGAAGG + Intronic
1166002468 19:39885968-39885990 GTGAGTGAGGGAGAGCCGGAGGG - Intronic
1166005253 19:39902220-39902242 GTGAGTGAGGGAGAGCCGGAGGG - Intronic
1166360456 19:42250933-42250955 GGGAGTGGGGGTAAGCTGGGGGG - Intronic
1167473041 19:49685970-49685992 GTGAGGGAGGGCTAGCAGGAAGG + Intronic
1167679036 19:50908336-50908358 GTGAGAGAGGGGAAAGGGGAGGG - Intronic
1168240295 19:55085822-55085844 GTGACTGAGGAGAAGCGGGAGGG - Exonic
1168268775 19:55238433-55238455 GTTAGTGTGTGGGAGCTGGATGG - Intronic
1168279051 19:55294248-55294270 GTGAGTGAGGGGCGGATAGAGGG + Intronic
925200030 2:1959671-1959693 GTGTGTGAGGGGCAGAGGGATGG - Intronic
925298990 2:2796480-2796502 GTGGCTGAGGGGAGCCTGGAAGG + Intergenic
925457293 2:4027030-4027052 CTGGCTGAGTGGAAGCTGGAGGG + Intergenic
925532352 2:4877834-4877856 GTGTGAGAGGAGAACCTGGAAGG + Intergenic
926352939 2:12013853-12013875 GTGTGGGAGAGCAAGCTGGAGGG + Intergenic
927040570 2:19226541-19226563 GTGCGGGATGGGGAGCTGGAAGG - Intergenic
927106773 2:19834417-19834439 GAAAGAAAGGGGAAGCTGGAAGG - Intergenic
927248878 2:20980718-20980740 GTGCCTGAAGGGCAGCTGGAAGG + Intergenic
927355430 2:22167584-22167606 GGAAGTGGGGTGAAGCTGGAAGG - Intergenic
927884849 2:26712100-26712122 GTGGGTGCAGAGAAGCTGGAGGG + Intronic
928219404 2:29391155-29391177 GTGGGTGACGGGGATCTGGAAGG + Intronic
928776107 2:34765582-34765604 GTGGGTGAGGGGAAAGAGGAGGG + Intergenic
928813107 2:35253648-35253670 TTGAGGGAAGGGGAGCTGGAAGG - Intergenic
929137354 2:38637599-38637621 GGGAGGGAGGGAAAGCAGGAAGG + Intergenic
929927784 2:46229928-46229950 GAGAGTGAGGGAGAGCTGGAGGG - Intergenic
930335921 2:50045525-50045547 GTCTGTGAGGGGAAGGAGGAAGG - Intronic
930523699 2:52498952-52498974 GGGAGGGAGGGGAGGATGGAGGG + Intergenic
930813140 2:55562829-55562851 GTCAGTGAGTGGAAGCTACAGGG - Intronic
930851512 2:55965940-55965962 GTGTGTGAAGGGAAGGAGGAAGG + Intergenic
931890044 2:66661731-66661753 GTCAGTGTGGGGAAGTGGGATGG + Intergenic
932084878 2:68749098-68749120 GTGAGGGAGAGGCAGATGGAAGG + Intronic
932148773 2:69348910-69348932 GAGAGTGAGAGGAAGCTTGGGGG - Intronic
933224456 2:79729453-79729475 GTCAGTGAGAGGAAGCAGCACGG - Intronic
933581073 2:84127778-84127800 GTGTGAGAGGTGAAGCTGGCTGG + Intergenic
933703515 2:85273149-85273171 GTGAGTGAGGAGGAGGTGGGAGG - Intronic
933716162 2:85362394-85362416 GGGAGTGAGGGGAGGGTGTATGG + Intronic
934103857 2:88678631-88678653 GGGAGTGAGGGGGAGATGGGAGG + Intergenic
934575366 2:95397241-95397263 ATGTGGGAGGGGCAGCTGGAGGG + Intergenic
935008989 2:99113367-99113389 GGGGGAGAGGGGAAGGTGGAGGG + Intronic
936600193 2:113888513-113888535 GAGAATGAGAGGAAGGTGGAAGG - Intergenic
936706228 2:115077750-115077772 GTGAGTCAGGGAAATCTTGATGG - Intronic
937089607 2:119197061-119197083 GGGGGTGAGGGGAGGATGGAGGG + Intergenic
937309488 2:120893327-120893349 GTGGGGGAGGGGAGGCTGGGGGG - Intronic
937349818 2:121153705-121153727 GTCAGTGAGGGGGTCCTGGAGGG + Intergenic
937515506 2:122650645-122650667 GAGAGTGAGGGCAAGGTGGGTGG + Intergenic
938803899 2:134788261-134788283 GTGAGTCTGGGGCACCTGGAGGG - Intergenic
939678677 2:145104123-145104145 CTGGGGGTGGGGAAGCTGGATGG - Intergenic
940442062 2:153727886-153727908 GTGGGTAAGGGGAAAGTGGAGGG - Intergenic
941218825 2:162748865-162748887 GGGAGGGAGGGGAAGGGGGAGGG - Intronic
941415669 2:165217989-165218011 GGGAGTGTGGGGAAAGTGGAGGG - Intergenic
941428631 2:165383901-165383923 GAGAGTGAGAGGAAGGAGGAAGG + Intronic
942191900 2:173478495-173478517 GTGGGTGATGGGAACCTGGATGG - Intergenic
943367254 2:186977863-186977885 GGTTGGGAGGGGAAGCTGGAGGG + Intergenic
945234879 2:207625039-207625061 GTGAGTGGGGGGCAGCTATAGGG - Intronic
945523988 2:210866008-210866030 GAGAGTGAGGAAAAGCAGGATGG + Intergenic
946062827 2:216959520-216959542 GTGAATGAGTGGAATCTGCAAGG + Intergenic
946405245 2:219488901-219488923 GTGAGGATGGGGCAGCTGGAGGG + Intronic
946625150 2:221603710-221603732 GTGAGTGGTGGGAAAATGGAAGG + Intergenic
947499153 2:230659651-230659673 TTGAGTCTGGGGAAGCTGCAGGG - Intergenic
947880620 2:233507676-233507698 GTGACTGAGGGGGAGATGTAAGG + Intronic
947951410 2:234150734-234150756 GGGAGAGAGGGCATGCTGGAGGG + Intergenic
948330116 2:237157896-237157918 GTGAGTGAGGGGCTGGTGAATGG - Intergenic
948654339 2:239467129-239467151 GGGCGTGGGGGGAAGCTGGATGG + Intergenic
1169014468 20:2280352-2280374 GTGGGGGAAGTGAAGCTGGAAGG - Intergenic
1169026985 20:2379938-2379960 GTGAGGAAGGGGAAGTGGGAGGG - Intergenic
1170315025 20:15032134-15032156 GGGAGTGAGGAGAGGCCGGAGGG + Intronic
1170613400 20:17931538-17931560 GAGAGTGAGTAGAAGCTGCAAGG - Intergenic
1170881043 20:20296515-20296537 TTGAGTGAGGGGAGGAAGGAAGG - Intronic
1171113966 20:22508588-22508610 GTGAGTGAATGGAAGCATGAAGG - Intergenic
1171885989 20:30652804-30652826 GTGAGTCAGGGAACCCTGGAGGG - Intergenic
1171886183 20:30653934-30653956 GTGAGTCAGGGAACCCTGGAGGG - Intergenic
1172134800 20:32679731-32679753 CTGAGGGAGAGGAAACTGGAGGG + Intergenic
1172192294 20:33069283-33069305 GAGGGTCAGAGGAAGCTGGAGGG - Intronic
1172589187 20:36105623-36105645 GGGAGTGATGGGAAGAAGGAGGG + Intronic
1172628160 20:36360612-36360634 GTGGGTGATGAGTAGCTGGAAGG + Intronic
1172837467 20:37882267-37882289 GTGAGTGAGGGGAAGACGAGGGG + Intergenic
1172838474 20:37887901-37887923 GAGCGTGAGGGGGAGCTGGTGGG + Intergenic
1173059515 20:39648114-39648136 GAGACTGATGGGAAGCTGGAAGG + Intergenic
1173256218 20:41395820-41395842 GGGAGGGAGGGAGAGCTGGAGGG - Intergenic
1173334399 20:42101119-42101141 GCTGGGGAGGGGAAGCTGGAAGG + Intronic
1173571394 20:44078976-44078998 AGGAGTAAGAGGAAGCTGGAAGG - Intergenic
1173642621 20:44614653-44614675 GTGAGCGTGAGGAAGCTGGCTGG + Exonic
1174200290 20:48802342-48802364 GTGAGTGAGGGGAGAATGGGTGG - Intronic
1174407141 20:50309940-50309962 GTGAGTGAGGGGCAGAGGGGTGG + Intergenic
1174476842 20:50801820-50801842 GGGACTGAGGGGAAGGAGGATGG + Intronic
1175592755 20:60206602-60206624 GTGATTAGGGGGAAGCTGGCTGG + Intergenic
1175817214 20:61889480-61889502 ATGAGTGAGTGGATGATGGATGG + Intronic
1175817877 20:61893073-61893095 GTGAGTAGAGGGATGCTGGATGG + Intronic
1175905764 20:62378605-62378627 GTGACTGAGGCCAAGCGGGACGG - Intergenic
1176112133 20:63415557-63415579 GGGAGGGAGGGGAGGCTGGGTGG + Intronic
1176145169 20:63562250-63562272 GGGCCAGAGGGGAAGCTGGAGGG + Intronic
1176850403 21:13908403-13908425 GTGAGTCAGGGCACCCTGGAGGG - Intergenic
1177743301 21:25179715-25179737 GTGAGGGAGGAAAACCTGGAGGG - Intergenic
1178036630 21:28591032-28591054 CTGATTGCAGGGAAGCTGGATGG + Intergenic
1178697554 21:34807614-34807636 ATGACTGAGGTGAATCTGGAGGG - Intronic
1179396481 21:41044944-41044966 GAGAGGGAGGAGCAGCTGGAAGG + Intergenic
1180026233 21:45163787-45163809 GTGACTGAAGGGAAACTCGAGGG + Intronic
1180745767 22:18087964-18087986 GGGAGGAAGGGGAAGCTGCAGGG - Exonic
1181036131 22:20170507-20170529 GTGAGTGAGTGCAAGAGGGAAGG + Intergenic
1181537274 22:23552968-23552990 GAGATTGATGGGAAGGTGGATGG - Intergenic
1181588276 22:23866493-23866515 GTGAGTGAAGGGAAGCCACATGG - Intronic
1182579905 22:31300788-31300810 GTGAGTGAGGATAGGCTAGAAGG + Intergenic
1182659516 22:31915398-31915420 GTGGGGAAGGGGATGCTGGAGGG + Intergenic
1182673236 22:32015704-32015726 GGAAGTGAGGGGAAACTGGAGGG - Intergenic
1182886391 22:33777630-33777652 GGGAGGGAGGGGAAGGGGGAGGG + Intronic
1183094981 22:35546598-35546620 GTGAGTGAGTGGATGAAGGAAGG + Intronic
1183451502 22:37898462-37898484 GAGAGTGTGGGGCAGCTGGATGG + Intergenic
1184341666 22:43889611-43889633 GTGACTCAGGGACAGCTGGAGGG - Intronic
1184418707 22:44366916-44366938 GGGAGGTAGGGGAAGCGGGAAGG - Intergenic
1184430150 22:44437799-44437821 ATGAGTCAGGAGAATCTGGAAGG + Intergenic
1184744621 22:46449125-46449147 GTGAGTGGATGGAAGCTGGGTGG - Intronic
1184777084 22:46628635-46628657 GTGTCTGAGGGGCAGGTGGAGGG + Intronic
949353736 3:3155022-3155044 GTGAGTGAGAAAAGGCTGGAAGG - Intronic
950903851 3:16520080-16520102 GAGCGTGAAGGGAAGCAGGAGGG + Intergenic
950922222 3:16705959-16705981 GTGAGTGAGGGGAGGCTGAAGGG - Intergenic
950958640 3:17081248-17081270 GTGAGGGAGGAGAAGGAGGAGGG - Intronic
951655750 3:25006158-25006180 GGGAGAGAGAGTAAGCTGGAGGG - Intergenic
952192967 3:31043197-31043219 GTCAGGGAGGGGAGGGTGGAGGG - Intergenic
952331999 3:32372130-32372152 GTGTGAGAGGGAGAGCTGGACGG - Intergenic
952991277 3:38833046-38833068 GAGAGAGAAGGGAAGATGGAAGG - Intergenic
953033109 3:39190778-39190800 GTGGGTCAGGGGCAGCAGGAGGG - Intronic
953273931 3:41476081-41476103 GGGAGGGAGGGCAAGCAGGAAGG + Intronic
953317442 3:41942034-41942056 GTGGTTGAGGTGAAGGTGGAGGG - Intronic
953355724 3:42254844-42254866 GTTAGCGAGGGGAAGAGGGATGG + Intergenic
955242057 3:57186949-57186971 GAGTGTGAGGGGAAGCAAGACGG + Intergenic
955303356 3:57805884-57805906 GTGAGTCAGGGGAAGTAGGGAGG - Intronic
955422990 3:58758679-58758701 GTGGGTGAGGGGAAGGGGGAGGG - Intronic
956219487 3:66886776-66886798 AAGAGTGAGAGGATGCTGGATGG - Intergenic
957564280 3:81865073-81865095 GTGAGGAAGGGGAAGGGGGAGGG - Intergenic
960170375 3:114454104-114454126 GGGAGAGAGGGGAAGAGGGATGG + Intronic
961204524 3:125070734-125070756 GTGAGTGAGAGGTAGGTGAATGG + Intergenic
961259982 3:125594739-125594761 GAGAGCGAAGGAAAGCTGGAGGG - Exonic
961315612 3:126033379-126033401 GAGGGAGTGGGGAAGCTGGAGGG + Intronic
961425939 3:126847846-126847868 GTAAGAGAGGGGAAGGAGGACGG - Intronic
961849703 3:129803337-129803359 GAGAGTGAGGGGAGGGTAGAAGG + Intronic
961860758 3:129915537-129915559 GTCGGTGAGGGGAAGCAGCAGGG - Intergenic
961968318 3:130929835-130929857 GTTAGTGAAGGGGAGCTGGTGGG - Intronic
962340052 3:134575154-134575176 GGGAGGGAGGGGAAGGGGGACGG - Intergenic
962490750 3:135891790-135891812 GTGCATGAGGGGAAGATGGGTGG - Intergenic
962525900 3:136237245-136237267 GAGAGAGAGGGAAAGATGGAAGG - Intergenic
962922582 3:139964451-139964473 GAGAGTCAGAGGAAGCTGCAGGG + Intronic
962978846 3:140469806-140469828 GTGAGGCAGGGGAAGAGGGAGGG + Intronic
964214321 3:154262743-154262765 GAGTGTGAGGGGAAGCAGGGCGG + Intergenic
964612877 3:158632439-158632461 TTGAGTGAGGGGCAGGGGGAGGG + Intergenic
965288886 3:166850145-166850167 GAGAGTGAGGAAAAGCTGGGTGG - Intergenic
967271361 3:187736209-187736231 GTGAGTGAGTGGGGACTGGAGGG + Intronic
967315466 3:188148607-188148629 ATGAGGAAGGGGAAGCTGCAGGG + Intergenic
967859102 3:194138177-194138199 GTAAGCGAGGGGCCGCTGGAAGG - Exonic
968035614 3:195544940-195544962 CTCAGCGAGGGGAAGCAGGATGG + Intergenic
968263096 3:197340548-197340570 GAGAGTTAGGGGCAGCTTGAGGG + Intergenic
968339315 3:197941473-197941495 GGGAGGGAGGGGAAGGGGGAGGG - Intronic
968534062 4:1112922-1112944 GGGAGTGAGGGGCTGCGGGAGGG - Intronic
968619442 4:1597243-1597265 GGGAGTGAGGGGACCCTCGAGGG - Intergenic
968640740 4:1713209-1713231 GTGACGGCGGGGAAGCGGGACGG - Intergenic
968894257 4:3389604-3389626 GTGGGTGAGGGGATTCTGGCAGG - Intronic
968940087 4:3633281-3633303 GGGAGGGAGGGGAAGGGGGAGGG - Intergenic
969015752 4:4103124-4103146 GTGCATGAGGGGATGCAGGATGG + Intergenic
969576462 4:8038888-8038910 GTGAGTGACTGGGAGCTGAAAGG - Intronic
969861339 4:10038016-10038038 GTGAGTGAGGTGAGTCTGGCAGG + Intronic
970762503 4:19507875-19507897 CTGAGTGAGGGAAAGCTGCCTGG - Intergenic
971109288 4:23565111-23565133 GGGAGTGAGGGGGAGGTGAAGGG - Intergenic
971479176 4:27099081-27099103 GGGAGTGAGAGAAGGCTGGAGGG + Intergenic
971502058 4:27328359-27328381 GGGATGGATGGGAAGCTGGAAGG + Intergenic
972628011 4:40819705-40819727 GCCAGTGAGGGGGAGCTTGAAGG - Intronic
973210971 4:47615176-47615198 GTGAGTGATGGGAGACTAGAAGG + Intronic
974126353 4:57701159-57701181 ATGAGGGAGGGGAATATGGAGGG - Intergenic
974501817 4:62714470-62714492 GCCAGTGAGAGGAACCTGGAAGG - Intergenic
975198359 4:71553573-71553595 GTGGGGGTGGGGCAGCTGGAAGG - Intronic
975446503 4:74471666-74471688 GTGAGAGAGGGAAAGCTGGAAGG + Intergenic
976224008 4:82780989-82781011 GTGAGTGTGAGGAGGCTGGTGGG - Intronic
976440353 4:85066317-85066339 GAGAGAGAGGGGAAGAAGGAAGG - Intergenic
976497753 4:85750026-85750048 GTACGTGAGGGGCAGGTGGATGG - Intronic
976679989 4:87745799-87745821 GTGTGGGAGGGGAAGCTGAGGGG - Intergenic
977065157 4:92304867-92304889 GTGAGGGAAGGGTAGCGGGAAGG - Intronic
977585481 4:98771281-98771303 GTGAGTGAGGATACTCTGGAAGG + Intergenic
977684632 4:99834536-99834558 ATGAGTGAAACGAAGCTGGATGG - Intronic
978403046 4:108350573-108350595 GGGCCTCAGGGGAAGCTGGATGG + Intergenic
978622566 4:110648305-110648327 GTAACAGAGGGGAACCTGGAGGG - Intergenic
979981335 4:127258913-127258935 GTGAGTAAGGGGATAATGGAAGG - Intergenic
980167143 4:129242587-129242609 GTGTTTGTGGGGGAGCTGGAAGG + Intergenic
981289413 4:143056774-143056796 GGGGGTGAGGGGATGCTGGGGGG + Intergenic
981531725 4:145760831-145760853 TTGGGTGAGGGGATGCTGGGAGG + Exonic
982025660 4:151251814-151251836 GTGACTGCGGGGCAGCTGAAAGG - Intronic
982181307 4:152751011-152751033 GTGAGTGGGGGGAGGGAGGAGGG + Intronic
983919765 4:173333684-173333706 GGGGGAGAGGGGAAGCCGGAGGG + Intronic
984091116 4:175376480-175376502 GTCACTGAAGGGAAGCTGCAGGG + Intergenic
984478234 4:180264903-180264925 GGGAGTGAGGGGAAGGGGCATGG - Intergenic
984501675 4:180565961-180565983 GTGAGTGTGGGTGAGCAGGAGGG + Intergenic
984964483 4:185128416-185128438 GGGAGTGCGGGGAGGCGGGAAGG - Intergenic
985334845 4:188881169-188881191 GAGAGTGTGGGGAAGCATGAAGG - Intergenic
985786248 5:1896777-1896799 GTGAGCGAGGAGTGGCTGGAGGG + Intergenic
987156224 5:15092081-15092103 GTGAGAAAGGGTAAGCTGCATGG + Intergenic
987288678 5:16487350-16487372 GAGTGTGAGAGAAAGCTGGAAGG - Intronic
989350981 5:40486426-40486448 GTGAATGAGAAGATGCTGGAGGG - Intergenic
989474343 5:41857185-41857207 GTGTGGGAGGGGAAGCAGGGAGG - Intronic
989578442 5:43010303-43010325 GTGAGGGTGGGGATGTTGGAGGG - Intergenic
990042432 5:51390122-51390144 CTGAGGGCGGGGAAGCTGGGAGG + Intronic
990410475 5:55535719-55535741 GTGAGGGAGGTGACGGTGGATGG - Intergenic
991375274 5:65958656-65958678 GTGAGGGAGGGGGAGGGGGAGGG + Intronic
991379200 5:66001955-66001977 GGGAGTGAGGGGAAAGTGGAGGG - Intronic
991900513 5:71455629-71455651 GTGAGCGCGGGGATGCTGGGAGG + Exonic
991927375 5:71718959-71718981 GTGAGGGACGGGAAGCGGGAGGG - Intergenic
993034916 5:82746187-82746209 GTAAGAGAGGGGAAGGTGGTTGG + Intergenic
993906706 5:93631717-93631739 AGCAGTGAGGGGAAGCTGGGAGG - Intronic
994792358 5:104245528-104245550 GTGAGTGGGGGGAAGTGGGAGGG + Intergenic
995122373 5:108549829-108549851 GGGAGTGAGTGGAAGGTGGTGGG + Intergenic
995294419 5:110502672-110502694 GTGAGTGAGGGGAAAGTGGAAGG - Intronic
996262758 5:121493757-121493779 GTGAGTGAGACGAAACTGGAAGG - Intergenic
997424052 5:133791036-133791058 GTGAGTGAGGGGACTGTGGTAGG - Intergenic
997428196 5:133818748-133818770 GTGAGGCAGGGGAAGGTGTAGGG - Intergenic
997803190 5:136887813-136887835 GTGATGGAGGGGAAGATAGAGGG - Intergenic
998025481 5:138811942-138811964 GAGAGGGAGGGGAAGGGGGAGGG + Intronic
998188325 5:140000365-140000387 CTGCGGCAGGGGAAGCTGGAAGG - Intronic
999323202 5:150627173-150627195 GGGACTGAGGGGAAGCAGGCAGG + Intronic
1000042362 5:157494238-157494260 GTGAGTGGGTGGTAGATGGATGG + Intronic
1000388193 5:160695436-160695458 ATGAGTGAGAGGTGGCTGGATGG + Intronic
1001110690 5:168893712-168893734 GTGAGTGAGGGGGAGGTGGCAGG + Intronic
1001143932 5:169167795-169167817 GTCAGTGAGGGGTTGCTGGGTGG - Intronic
1001245616 5:170104227-170104249 GGAAGTGGGAGGAAGCTGGATGG + Intergenic
1001266216 5:170276390-170276412 GTCTGGGAGGGGAAGATGGAAGG - Intronic
1001946919 5:175786871-175786893 GTGAATGAGGGGAAAGTGGTTGG - Intergenic
1002426910 5:179181974-179181996 GTGTGCGGTGGGAAGCTGGAGGG - Intronic
1002467084 5:179412986-179413008 GTCGGTGGGGGGAGGCTGGAAGG - Intergenic
1002538010 5:179888828-179888850 GTGAGTGCTGGGAAGAGGGAAGG + Intronic
1002783878 6:386761-386783 GGGAGTCAGGGGTTGCTGGAGGG - Intergenic
1003112587 6:3261974-3261996 GGGAGTTTAGGGAAGCTGGAGGG - Intronic
1003299058 6:4860323-4860345 GGGAGTGAGGGGAATATGGATGG - Intronic
1004030026 6:11859411-11859433 GTGAGAGAGGGGAGAGTGGAGGG + Intergenic
1004169244 6:13283278-13283300 GTGAGTGAGGGGCAGGGGCAGGG - Intronic
1004263472 6:14129071-14129093 CTGAGGGAGGGGTTGCTGGATGG + Intronic
1004353702 6:14913046-14913068 GTTAGTGGGCGGAAGCGGGAGGG - Intergenic
1005217169 6:23543983-23544005 ATGAGTGAGGGGGATGTGGAAGG + Intergenic
1005452444 6:25986788-25986810 GTAATTGAGGGGTGGCTGGAAGG - Exonic
1006003880 6:30987571-30987593 GTGAGTGAGGCGAAGCCTGGTGG + Exonic
1006224066 6:32521660-32521682 TTGTGGGAGGGGAAGCAGGAGGG - Intronic
1006510801 6:34520083-34520105 GTGAGTGATGGGAGGGAGGATGG + Intronic
1006732481 6:36246671-36246693 GTGAGTGACTCGAAGCTGGGTGG - Intronic
1006739199 6:36295216-36295238 GTGAGGGATGGGACACTGGATGG + Intronic
1006856952 6:37140619-37140641 GTAGGTGAAGGGAATCTGGAAGG - Intergenic
1006984186 6:38166643-38166665 GGGAGTGCGGGGGAGGTGGAGGG - Intergenic
1007115017 6:39337262-39337284 GGAAGGGAGGGGAGGCTGGAGGG - Intronic
1007371084 6:41427542-41427564 CTGGGAGAGGGGAAGCTGGGGGG + Intergenic
1007373887 6:41443495-41443517 GGGGGGGAGGGGAAGCGGGAGGG + Intergenic
1007741274 6:44011036-44011058 GTGCGTGCGTGGAAGCTGGGAGG - Intergenic
1008181067 6:48329930-48329952 GTGAGTGAGAGGCAGAAGGATGG + Intergenic
1008804915 6:55415357-55415379 GTGAGTGAGTGGTAGCTTCATGG - Intergenic
1010889822 6:81292845-81292867 ATGAGTGAGAGGAACTTGGAGGG + Intergenic
1011449573 6:87478476-87478498 GTGAGTGAAGGGAAGCAGGGAGG + Intronic
1012438883 6:99243622-99243644 GTGAGTTATGGAAAGCTGCAGGG - Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013412874 6:109897426-109897448 CTGAGTGAGGCTAAGCTGGAGGG - Intergenic
1013616595 6:111849388-111849410 GGGGGTGACGGGGAGCTGGAGGG - Intronic
1013748047 6:113368733-113368755 GTGAGATAGGAAAAGCTGGAAGG - Intergenic
1013931896 6:115544917-115544939 GAGAGCGAGGGAAAGCAGGATGG + Intergenic
1014290378 6:119551329-119551351 GTGAGCAAGGGGAGGATGGAAGG - Intergenic
1015319245 6:131853668-131853690 GTGTGTGAGGGTAAGGTGGGAGG + Intronic
1016174464 6:141062215-141062237 GGGGGTGGGGGGAAGATGGAGGG + Intergenic
1016363727 6:143293921-143293943 GAGAGTGAGGTGGAGGTGGAGGG - Intronic
1016428890 6:143962720-143962742 GTGAATGAGCTGAAACTGGAAGG - Intronic
1016948793 6:149560544-149560566 GTGAGTGAGGGGGAAAGGGAAGG + Intergenic
1017036283 6:150270069-150270091 GAGGGGGAGGGGAAGCTGGATGG + Intergenic
1017524609 6:155231624-155231646 GTGCTTGGGGGGAAGCTGGCAGG - Intronic
1017643378 6:156515871-156515893 GTGAGTGAGGCAAAGGTGGGTGG - Intergenic
1017991530 6:159493285-159493307 GTGAGTGAGGAGACGCTGCTGGG - Intergenic
1018036588 6:159887455-159887477 ATGATTGAGGGGAGGCTGGGGGG + Intergenic
1018383884 6:163285318-163285340 ATGTGTCAGGGGAAGCGGGAGGG - Intronic
1018948432 6:168363325-168363347 GAGAGAGAGAGGAAGATGGAGGG + Intergenic
1019103740 6:169651641-169651663 GGAGGTGAGGGGAAGCTGGTGGG - Intronic
1019293353 7:261107-261129 GTGAGTGAGGGGCACCGTGAAGG + Intergenic
1019523392 7:1470362-1470384 GTGAATGAGGGCTTGCTGGACGG + Exonic
1019666395 7:2254130-2254152 GTGCGTGACGGGAGGCTGGGAGG + Exonic
1019875656 7:3808311-3808333 TTGAGTGAGGAGCAGATGGAGGG + Intronic
1020431277 7:8118803-8118825 GAGACTGAGGGCAAGCTGCAGGG - Intronic
1020868141 7:13591481-13591503 GAGAGTGAGGAAAAGCAGGATGG - Intergenic
1021422122 7:20457522-20457544 CTGAATGAGGGGAATCTGTATGG - Intergenic
1022109130 7:27217285-27217307 GTGTGTGTGGGGAAGGTGGTGGG + Intergenic
1022976276 7:35559225-35559247 GTGAGTGAGGGAAAAATGAAGGG + Intergenic
1023120371 7:36902952-36902974 TGGAGTGAGGAGGAGCTGGAAGG - Intronic
1023705199 7:42933451-42933473 GGGGGAGAGGGGAAGCGGGAGGG - Intronic
1024688767 7:51777103-51777125 GAGAGTGGGGTGAAGCTGGGAGG + Intergenic
1024776992 7:52799367-52799389 GTGAGAGAGGGAAAGAGGGAAGG - Intergenic
1024977326 7:55125945-55125967 GAGTGTGAGGGGAAGTGGGATGG - Intronic
1025764948 7:64435333-64435355 AGGAGTGAGGGGAAGCAGGTAGG - Intergenic
1026065033 7:67063691-67063713 GAGAATGACGGGAACCTGGAAGG - Intronic
1026171759 7:67960103-67960125 GTGAGTCAGGGGAATATGCAGGG + Intergenic
1026774680 7:73223957-73223979 GTGAGTGTGGGGACGGAGGAGGG + Intergenic
1027015539 7:74777348-74777370 GTGAGTGTGGGGATGGAGGAGGG + Intronic
1027072493 7:75168609-75168631 GTGAGTGTGGGGACGGAGGAGGG - Intergenic
1027988658 7:85329858-85329880 GTGGGTGGGGGGAGGGTGGAGGG - Intergenic
1028180469 7:87715824-87715846 ATTACTGAAGGGAAGCTGGAGGG + Intronic
1028503883 7:91550187-91550209 GTGAGAGAGAGGAAGCAGCAGGG - Intergenic
1028581982 7:92418106-92418128 GAGAGGGAGGGGAGGCTGGGTGG - Intergenic
1029020215 7:97357234-97357256 AGGAGTGGGGGGAAGGTGGAAGG + Intergenic
1030796648 7:113796861-113796883 GTGATTCAGGGTAAGCTGGTGGG - Intergenic
1031258938 7:119491789-119491811 ATTACTGAGGGGAAGCTGGAGGG + Intergenic
1031370745 7:120962549-120962571 GTGAGTTAGGGCAAGGTGTATGG + Intronic
1031567587 7:123319972-123319994 GGGAATGAAGGGGAGCTGGATGG + Intergenic
1032442937 7:131956039-131956061 GTGAATGTGGGGAGGCAGGAAGG - Intergenic
1032546623 7:132749162-132749184 GTGAGTGAGGGCAAGAATGATGG - Intergenic
1033868329 7:145718938-145718960 GAGAGTGAGGAGAAGCAGGGTGG - Intergenic
1034065874 7:148136070-148136092 GAGAGGGAGGGGGAGGTGGAAGG + Intronic
1034277638 7:149830622-149830644 GTGACTGAGGGGACTGTGGAGGG - Intergenic
1034277682 7:149830782-149830804 GTGACTGAGGGGACTGTGGAGGG - Intergenic
1034376398 7:150648764-150648786 CTGAATGAGGGGAAGTTGAAGGG - Intergenic
1035336759 7:158134289-158134311 GTGTGTGAGAGGGAGCGGGAGGG - Intronic
1035971921 8:4258429-4258451 GGGAGGGAGGGGAGGATGGAAGG + Intronic
1035971931 8:4258457-4258479 GAGAGGGAGGGGAGGATGGAAGG + Intronic
1036053744 8:5227998-5228020 GTGAATGGGGGGGACCTGGATGG - Intergenic
1036081120 8:5557085-5557107 GTGGGTGGGGGGAAGGGGGAGGG - Intergenic
1036097651 8:5741488-5741510 GAGAGGGAGGGGAAGTTGGGTGG + Intergenic
1036599954 8:10251670-10251692 GTGGGTGTGGGGAAGATGGTTGG - Intronic
1036653775 8:10662583-10662605 CCGAGTCAGGGGAAGCGGGAGGG - Intronic
1037323957 8:17670165-17670187 GTGAATGAGGAGACGCTGCATGG + Intronic
1037505933 8:19529297-19529319 GTGAGTGAGCAGTAGTTGGAAGG + Intronic
1037949078 8:23007143-23007165 CTGAGTGAGGGGGAGCTGGGGGG + Exonic
1038311715 8:26450059-26450081 CTGAGAGAGGGGCAGCTGTAGGG + Intronic
1039468569 8:37800015-37800037 GTGGGTGTGGGGGTGCTGGAGGG - Intronic
1039846559 8:41329819-41329841 GAGTGGGAAGGGAAGCTGGAGGG - Intergenic
1039939802 8:42080372-42080394 GGGAGGGAGGGGAAGAAGGAAGG - Intergenic
1040576263 8:48654109-48654131 CAGAGTGAGGGGCAGCAGGATGG + Intergenic
1040807051 8:51406578-51406600 GTGAGGGACTGGAAGCAGGAAGG - Intronic
1041293068 8:56325781-56325803 GTGAGTGAGGGCAGGAAGGAGGG - Intergenic
1041729311 8:61048818-61048840 GTGAGGGAGGGGAAGAGGGAAGG - Intergenic
1042871712 8:73405656-73405678 TTGGGGAAGGGGAAGCTGGAAGG - Intergenic
1043516170 8:80996792-80996814 TTGAGTGAGGGGAAGGTGGAGGG + Intronic
1043686177 8:83089276-83089298 TTGAGTGAGGGAAAGATGTAGGG - Intergenic
1043842830 8:85128754-85128776 GTGACTGACTGGATGCTGGATGG - Intronic
1046587198 8:116162130-116162152 GCAAGTGAGGGGAGACTGGATGG - Intergenic
1046738153 8:117799676-117799698 GTGGGGGAGGGGAAGCAAGAAGG - Exonic
1046994083 8:120496254-120496276 GTGAGTGATGGGAAGGAAGAGGG + Intronic
1047369981 8:124248063-124248085 GAGAGGGAGGGGAAGCGGGGGGG + Intergenic
1047375873 8:124295565-124295587 GTGAGTTCGCAGAAGCTGGAGGG - Intergenic
1048372083 8:133787537-133787559 ATGAGTGAAGGGAAGATGAATGG + Intergenic
1049361145 8:142213062-142213084 GTGAGGGAGGGGAGACAGGAAGG - Intronic
1051272092 9:15365532-15365554 GTGTCTGAGGTGAAGCTGGCTGG - Intergenic
1051718076 9:20006331-20006353 GTGGGTGAGGGGAGGGGGGATGG + Intergenic
1051833610 9:21309723-21309745 GTGAGTGAGGTGGTGCTGGGGGG - Intergenic
1051833660 9:21310236-21310258 GAGAATGATGTGAAGCTGGAAGG - Intergenic
1051940710 9:22502295-22502317 GTTAGTGAGCAGAAGCTGGAGGG - Intergenic
1052876916 9:33574412-33574434 GTGAGTCAGGGCACCCTGGAGGG + Intergenic
1052984961 9:34480159-34480181 GTGAGGGAGGGGCTCCTGGAAGG - Intronic
1053415534 9:37944840-37944862 GAGAGTCAGGAGAAGCTGCAGGG - Intronic
1053434258 9:38065153-38065175 ATGAGTGAGGGGCAGAAGGAAGG + Intronic
1053455055 9:38227241-38227263 GTGAGGGTGAGGAAGCTGGAGGG + Intergenic
1053499091 9:38569974-38569996 GTGAGTCAGGGCACCCTGGAGGG - Intronic
1053718629 9:40922433-40922455 GTGAGTTGGGGGAAGCAGGGAGG + Intergenic
1054450663 9:65401992-65402014 GGGAGGGAGGGGAAGGGGGAGGG + Intergenic
1054739595 9:68791361-68791383 GGGAGTGAGGGGATGATGGATGG + Intronic
1055002506 9:71468303-71468325 CTGGGAGAGGGGAAGCAGGATGG - Intergenic
1055535989 9:77245021-77245043 ATGAGTGAGGGGAGAGTGGAGGG + Intronic
1056135396 9:83625057-83625079 CTGAGTGAGGGGAAGCATGATGG + Intronic
1056687507 9:88778523-88778545 TTCATTGCGGGGAAGCTGGATGG + Intergenic
1056795349 9:89655226-89655248 TTGAGTAGGAGGAAGCTGGAAGG - Intergenic
1057162141 9:92896316-92896338 GTGAGTCAGGGCACCCTGGAGGG - Intergenic
1057414989 9:94853488-94853510 GTGAGTGAGGTGAGACTGAATGG - Intronic
1057545773 9:96019853-96019875 GTGAGAGAGAGGAAGGGGGACGG + Intergenic
1058093555 9:100833033-100833055 GTGGGTGGGGGGAAGGAGGAGGG + Intergenic
1058315883 9:103565138-103565160 GTGAGGGAGGAGAAGATGGTAGG + Intergenic
1058336629 9:103837553-103837575 CAGACTGATGGGAAGCTGGAGGG - Intergenic
1058346530 9:103970190-103970212 GTGAGAGAGGGGAAGGTGGGGGG - Intergenic
1058687398 9:107490270-107490292 GAGAGGGAGGGGGAGATGGAGGG - Intronic
1058943504 9:109835357-109835379 GGGATAGAGGGGAAGGTGGAGGG + Intronic
1058944329 9:109841964-109841986 GGGATGGAGGGGAAGTTGGAGGG + Intronic
1059145730 9:111897314-111897336 GTGAGTGAGGGACCGCAGGAGGG + Intronic
1060301131 9:122375212-122375234 GCGGGAGGGGGGAAGCTGGATGG + Intronic
1060756189 9:126215638-126215660 GTGAGTGAGGGGAAGGCCGGTGG - Intergenic
1060801122 9:126546390-126546412 GAGAGTGAAGGGAAGATTGAGGG + Intergenic
1061095685 9:128455853-128455875 TTGAGTGAGGGGAATCCGGGAGG + Intronic
1061244708 9:129395496-129395518 GTGAATGAATGGAAGATGGATGG + Intergenic
1061593629 9:131614553-131614575 GTGAGTGAGAGGCAGATGAATGG + Intronic
1061739340 9:132688949-132688971 ATCAGTGACGGGAAGATGGAAGG + Exonic
1062477494 9:136736048-136736070 GGGAGGGAGGGGCAGCAGGAGGG - Intergenic
1062512787 9:136916699-136916721 GTGGCTGAGGAGCAGCTGGAAGG - Intronic
1062708729 9:137960190-137960212 CTGAGTGAGGGGGAGGGGGAGGG + Intronic
1185547133 X:954553-954575 GTGAGTGAAGGAAGGATGGACGG - Intergenic
1186112089 X:6269200-6269222 GTGTGTGAGGGGAAGGTGAGCGG - Intergenic
1187128873 X:16481677-16481699 GAGAGGGAGGGGAAGTGGGAAGG - Intergenic
1187685861 X:21815020-21815042 GAGAGTGAGATGAAGGTGGAGGG - Intergenic
1188915539 X:35905161-35905183 GAGAGTGAGCAGAAGCAGGATGG - Intergenic
1189448278 X:41101974-41101996 GGGACTGAGGGGAGGTTGGAGGG + Intronic
1190534624 X:51413563-51413585 GAGAGGGAGGGAAAGATGGAGGG - Intergenic
1191044427 X:56120650-56120672 GTGAGTGAGTGGCAGCAGGAAGG - Intergenic
1191111601 X:56807351-56807373 GAGAGTCAGGGGTAGCTTGATGG + Intergenic
1191750377 X:64535881-64535903 CTGGGGGAGAGGAAGCTGGAAGG + Intergenic
1191757325 X:64607457-64607479 GAGAGTGAGGCGAAGCAGGGTGG - Intergenic
1192165164 X:68823496-68823518 TTGGCTGAGGGGCAGCTGGAGGG + Intergenic
1193579539 X:83247183-83247205 GTGAGTGGGGGGAGGGGGGAGGG + Intergenic
1194048443 X:89037198-89037220 GGGAGAGAGGGGAAGCAGGTAGG + Intergenic
1194580437 X:95665318-95665340 GAGAGTGAGGAGAAGCTGGGTGG + Intergenic
1195477513 X:105303636-105303658 TTGTGTGTGGGCAAGCTGGAAGG - Intronic
1196108194 X:111918334-111918356 GTGAGGGAGGAGAAGTTGGCAGG + Intronic
1196544003 X:116941421-116941443 GTGAGTGGGGGGAGGGAGGAGGG - Intergenic
1196963442 X:121029016-121029038 ATGAGTGAGGGGGTGCTGCAGGG - Intergenic
1198477513 X:137009674-137009696 GGGAGTGATGGGAAGTTGAAGGG + Intergenic
1199435099 X:147804248-147804270 GTGAGTGAGGGGTGGGTGGAAGG + Intergenic
1200137738 X:153883175-153883197 GTGAGGCAGGGGCAGCTGGGGGG + Intronic
1200230198 X:154440136-154440158 ATGAGTGAGGGGAAGCTGGGTGG + Exonic
1201328985 Y:12798069-12798091 GAGAGGGAGGGGAAGGGGGAGGG - Intronic