ID: 1131406417

View in Genome Browser
Species Human (GRCh38)
Location 15:92168594-92168616
Sequence TCACCTATGCTCAGCCGCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 45}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131406417_1131406427 29 Left 1131406417 15:92168594-92168616 CCCTAGCGGCTGAGCATAGGTGA 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1131406427 15:92168646-92168668 GCATGGGCCAGGGCATACATAGG 0: 1
1: 0
2: 1
3: 12
4: 120
1131406417_1131406426 19 Left 1131406417 15:92168594-92168616 CCCTAGCGGCTGAGCATAGGTGA 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1131406426 15:92168636-92168658 GACTGCTGTAGCATGGGCCAGGG 0: 1
1: 0
2: 0
3: 20
4: 310
1131406417_1131406422 12 Left 1131406417 15:92168594-92168616 CCCTAGCGGCTGAGCATAGGTGA 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1131406422 15:92168629-92168651 CACCTAAGACTGCTGTAGCATGG 0: 1
1: 0
2: 0
3: 9
4: 106
1131406417_1131406423 13 Left 1131406417 15:92168594-92168616 CCCTAGCGGCTGAGCATAGGTGA 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1131406423 15:92168630-92168652 ACCTAAGACTGCTGTAGCATGGG 0: 1
1: 0
2: 0
3: 6
4: 78
1131406417_1131406425 18 Left 1131406417 15:92168594-92168616 CCCTAGCGGCTGAGCATAGGTGA 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1131406425 15:92168635-92168657 AGACTGCTGTAGCATGGGCCAGG 0: 1
1: 0
2: 0
3: 10
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131406417 Original CRISPR TCACCTATGCTCAGCCGCTA GGG (reversed) Intronic
900640064 1:3684340-3684362 TCACTTATGCTCAGCCCGAAAGG + Intronic
900716562 1:4148790-4148812 TCAGCTATGATCTGCCGGTAGGG + Intergenic
1067851990 10:49760243-49760265 TCCCCAATGCTCAGCCCCTGAGG + Intronic
1073621241 10:105050975-105050997 ACACCTATGCCCAGACTCTATGG + Intronic
1077204150 11:1333697-1333719 TCACCTTTGCTGAGCAGCCAAGG - Intergenic
1077720119 11:4619806-4619828 TCAGCTAAGCACAGCCACTAGGG - Intergenic
1078115107 11:8440277-8440299 CCACCTATGCTCTGCCTGTATGG + Intronic
1084432254 11:69117617-69117639 CCACCTATGTCCAGCCGCTCGGG - Intergenic
1084451858 11:69243740-69243762 ACAGCTCTGCTCAGCCTCTAGGG + Intergenic
1103924833 12:124417772-124417794 GCCACTGTGCTCAGCCGCTACGG - Intronic
1113724853 13:112590866-112590888 TCACCTAAGATCAGCCCTTATGG + Intergenic
1113893222 13:113747586-113747608 TCATCCATGCCCAGCCGCCAGGG - Intergenic
1118907602 14:70033883-70033905 TGAGCTATGCTCAGCCTCTGTGG + Intergenic
1119693652 14:76695809-76695831 TCACCTCTGCTCAGCCACACAGG + Intergenic
1123948918 15:25252124-25252146 TCACGCATGCTCATCCTCTATGG - Intergenic
1129840283 15:78739486-78739508 AGACCAATGCTCAGCCGCTTTGG + Intergenic
1130926965 15:88392730-88392752 GCACCTCTGCTCAGCCACTGGGG + Intergenic
1130981347 15:88813818-88813840 GCACCTCTTCTCAGCCACTAGGG + Intronic
1131406417 15:92168594-92168616 TCACCTATGCTCAGCCGCTAGGG - Intronic
1135143249 16:19939643-19939665 GCTCCTCTGCTCAGCTGCTATGG - Intergenic
1136425494 16:30167423-30167445 TCCCCCATGCTCTGCCCCTATGG + Intergenic
1140394902 16:74618066-74618088 GTACCTATGTTCAGCCTCTAAGG + Intergenic
1146665799 17:34702424-34702446 TCACCTCTGCTAAGCCTCTTTGG + Intergenic
1151554035 17:74837627-74837649 GCACCCACGCTCAGCCCCTAAGG - Exonic
928176122 2:29035456-29035478 TTACCTAGGCTCAGCTGCAATGG + Exonic
929128107 2:38539152-38539174 TCACGCAAGCTCAGCCTCTAGGG - Intergenic
934865258 2:97803795-97803817 TGTCCTATGCTCAGCTGCTAAGG - Intronic
935814509 2:106834774-106834796 TCACCCATCCTCAGGGGCTATGG - Intronic
944908166 2:204283412-204283434 TCACCTTTCCTCAGCCTCAAAGG - Intergenic
946291233 2:218747063-218747085 TCACGTATGCAGAGCCGCTTTGG + Exonic
949067490 2:242002075-242002097 TCACCAATGCTCAGCCTCTGCGG + Intergenic
1175543624 20:59763772-59763794 CCACCTCTGCTCAGCCTCTCTGG - Intronic
1180905094 22:19404774-19404796 TCACCTCTGCTGAGACCCTAAGG - Intronic
1183705474 22:39472788-39472810 ACACCTGGGCTCAGCCTCTAGGG + Intronic
960555827 3:119029408-119029430 CCACCAATGCTCAGCTTCTATGG + Intronic
962846056 3:139274885-139274907 TCATCTTTGCTCATCAGCTAAGG - Intronic
970117059 4:12709006-12709028 TCACCTGTGATCAGCTGCAAAGG - Intergenic
1009885382 6:69618251-69618273 TCAGCTAAGTGCAGCCGCTATGG - Intergenic
1012989541 6:105911233-105911255 TCACCTCTGCTCAGGAGCTCAGG - Intergenic
1016919978 6:149283151-149283173 TCCCCTCTGCTCTCCCGCTAGGG + Intronic
1018953724 6:168394474-168394496 TCAGCTAAGCCCAGCCGCAATGG - Intergenic
1020123285 7:5517792-5517814 TCTCCTCTGCTCAGCCACTCTGG + Intergenic
1034569923 7:151947253-151947275 TCACTTTTGCTCACCTGCTATGG + Intergenic
1037498885 8:19466824-19466846 TCACCTATGTTCAGTGGCTCTGG + Intronic
1049424078 8:142530340-142530362 TGCCCTATGCACAGCTGCTAAGG - Intronic
1188304444 X:28545478-28545500 TTCCCTGTGCTCAGCCCCTAAGG + Intergenic
1189117975 X:38363027-38363049 TCCCCTATTCTCAGCCTCTGCGG - Intronic
1197866910 X:131028751-131028773 TCACCTATGCCCAGAGTCTATGG - Intergenic