ID: 1131406418

View in Genome Browser
Species Human (GRCh38)
Location 15:92168595-92168617
Sequence CTCACCTATGCTCAGCCGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 81}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131406418_1131406426 18 Left 1131406418 15:92168595-92168617 CCTAGCGGCTGAGCATAGGTGAG 0: 1
1: 0
2: 0
3: 6
4: 81
Right 1131406426 15:92168636-92168658 GACTGCTGTAGCATGGGCCAGGG 0: 1
1: 0
2: 0
3: 20
4: 310
1131406418_1131406427 28 Left 1131406418 15:92168595-92168617 CCTAGCGGCTGAGCATAGGTGAG 0: 1
1: 0
2: 0
3: 6
4: 81
Right 1131406427 15:92168646-92168668 GCATGGGCCAGGGCATACATAGG 0: 1
1: 0
2: 1
3: 12
4: 120
1131406418_1131406422 11 Left 1131406418 15:92168595-92168617 CCTAGCGGCTGAGCATAGGTGAG 0: 1
1: 0
2: 0
3: 6
4: 81
Right 1131406422 15:92168629-92168651 CACCTAAGACTGCTGTAGCATGG 0: 1
1: 0
2: 0
3: 9
4: 106
1131406418_1131406423 12 Left 1131406418 15:92168595-92168617 CCTAGCGGCTGAGCATAGGTGAG 0: 1
1: 0
2: 0
3: 6
4: 81
Right 1131406423 15:92168630-92168652 ACCTAAGACTGCTGTAGCATGGG 0: 1
1: 0
2: 0
3: 6
4: 78
1131406418_1131406425 17 Left 1131406418 15:92168595-92168617 CCTAGCGGCTGAGCATAGGTGAG 0: 1
1: 0
2: 0
3: 6
4: 81
Right 1131406425 15:92168635-92168657 AGACTGCTGTAGCATGGGCCAGG 0: 1
1: 0
2: 0
3: 10
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131406418 Original CRISPR CTCACCTATGCTCAGCCGCT AGG (reversed) Intronic
900368961 1:2323059-2323081 GGCACCTGTGCGCAGCCGCTCGG - Intronic
900429964 1:2596777-2596799 CCCACCTATCCTCAGCCTCAGGG + Intronic
900716561 1:4148789-4148811 CTCAGCTATGATCTGCCGGTAGG + Intergenic
900718036 1:4157632-4157654 CTCACCTGTCCCCAGCCACTGGG - Intergenic
903708216 1:25302542-25302564 CTCACCTAGGATTAGCCTCTGGG - Intronic
904488767 1:30845141-30845163 CTCATTCCTGCTCAGCCGCTGGG - Intergenic
910615230 1:89190199-89190221 CTGCCCTCTGCACAGCCGCTGGG + Exonic
915307617 1:154989690-154989712 CTCACCTCTGCACAGCTGCATGG - Exonic
916217040 1:162405253-162405275 CCCACCTATGCCCAGACTCTGGG - Intronic
917986492 1:180325884-180325906 CTCTCCTGTGCTGAGCCACTTGG + Intronic
1063381251 10:5587657-5587679 CTCACCTAGCCTGAGCCCCTGGG + Intergenic
1064694005 10:17947876-17947898 CTCAACTATGCTCTACCTCTAGG - Intergenic
1070572313 10:77649756-77649778 CTAACCTCAGCTCAGTCGCTGGG - Intergenic
1072157354 10:92736107-92736129 CTCACCTTTACTCACCCTCTGGG + Intergenic
1072733725 10:97865537-97865559 CCCACCCCTGCTCAGCAGCTGGG + Exonic
1075203246 10:120423846-120423868 GTCACCCTTGGTCAGCCGCTTGG + Intergenic
1077258188 11:1598840-1598862 CCCACCTCTGCTCAGCTTCTGGG + Intergenic
1082862058 11:57866447-57866469 TTCACCTATGTTCAGCCCCATGG - Intergenic
1083471542 11:62887575-62887597 CACACCTATGGTCAGCTACTGGG + Intronic
1084432256 11:69117618-69117640 ACCACCTATGTCCAGCCGCTCGG - Intergenic
1084749906 11:71197853-71197875 CTTACCCATGCTCAGCCCCACGG + Intronic
1084798672 11:71526708-71526730 CCCACCTCTGCTCAGCTTCTGGG - Intergenic
1084803769 11:71564970-71564992 CCCACCTCTGCTCAGCTTCTGGG - Intronic
1089745095 11:120611089-120611111 CTCACCTTCGTTCAGCCCCTGGG + Intronic
1094845728 12:34360611-34360633 CTCCCCACTGCTCAGGCGCTGGG - Intergenic
1098813462 12:75125877-75125899 CTCACCTAGGCTCATCCATTGGG + Intronic
1102923583 12:116810462-116810484 CTCACCTACCCTGAGCCACTGGG - Intronic
1104722142 12:131050505-131050527 CTGACCTCTGCTCAGCTTCTGGG + Intronic
1109219623 13:59628135-59628157 CTCAGCCATGATCAGCTGCTTGG + Intergenic
1113663116 13:112120436-112120458 CTCACCCCTGCTCAGACTCTTGG - Intergenic
1113893223 13:113747587-113747609 CTCATCCATGCCCAGCCGCCAGG - Intergenic
1119557787 14:75566904-75566926 CTTCCCTCTGCTCAGCCCCTTGG - Intergenic
1121323172 14:93004716-93004738 CTCTCCTTTGCTCAGCCACATGG - Intronic
1125356250 15:38819893-38819915 CTCTCCTGTGCTCATACGCTGGG - Intergenic
1130047811 15:80459868-80459890 GTCACCTAGGCTTAGCTGCTGGG + Intronic
1130926964 15:88392729-88392751 AGCACCTCTGCTCAGCCACTGGG + Intergenic
1131406418 15:92168595-92168617 CTCACCTATGCTCAGCCGCTAGG - Intronic
1138026018 16:53523108-53523130 CTCACCTATGGTCACCTGCTTGG + Intergenic
1138178700 16:54928765-54928787 CTCACCTCTCCTCCGCCGCGCGG + Intergenic
1138233288 16:55356716-55356738 CTCAGCTATTCTCAGTAGCTGGG - Intergenic
1139281402 16:65773940-65773962 TTCACTTCTGCTCAGCTGCTTGG - Intergenic
1144234501 17:13244773-13244795 CTCCTCTTTACTCAGCCGCTGGG - Intergenic
1146117348 17:30153028-30153050 CTCACCTCTCCTCAGTAGCTGGG + Intronic
1146674811 17:34765962-34765984 CTCTCCTATGCTCATCCTCTTGG - Intergenic
1147607303 17:41781433-41781455 CTCTCCTTTGCTCAGCCTCCTGG - Intronic
1147924732 17:43939236-43939258 CTCACCTCTGCTCTCCCTCTGGG - Intergenic
1148138641 17:45312180-45312202 CTCACCTAAGCAAAGCTGCTTGG + Intronic
1149450592 17:56747141-56747163 ATCACCAATGCTCAGCAACTGGG + Intergenic
1152698635 17:81808277-81808299 CTCACCTATTCTTAGCCCCTGGG - Intronic
1152926976 17:83091858-83091880 CTCACCTGTTCTGAGCCTCTAGG - Intronic
1153758482 18:8307126-8307148 CTCCCCCATGCTCTGCTGCTTGG - Intronic
1157038432 18:44006810-44006832 CTCTCTTATGCTCAGTCTCTAGG - Intergenic
1163026839 19:14517772-14517794 CTCACCTGGGCTCGGCCGCCGGG - Intronic
1163289556 19:16370471-16370493 CACACCTATACTCAGATGCTGGG + Intronic
1163568119 19:18063871-18063893 CTCACCGATGCTGAAGCGCTGGG + Exonic
927781047 2:25939658-25939680 CTCACCCAGGCTCTGCCTCTGGG - Intronic
929528383 2:42727477-42727499 CTCACCTACTCACAGCCACTTGG - Intronic
934716494 2:96547566-96547588 CTCACCTGTGCTCCGCCTCCAGG + Intronic
942005003 2:171688978-171689000 CTGCCTTATGCTCAGCTGCTAGG + Intronic
943367595 2:186980869-186980891 TTCACCTATTCTCACCCACTTGG + Intergenic
946784227 2:223225618-223225640 CTCACCAATAGTCAGCTGCTTGG + Intergenic
948384165 2:237571359-237571381 CTCACCTATGCTCACCTGGAAGG + Intergenic
1175143764 20:56880667-56880689 CTCACCTTTGTTCAGGTGCTGGG - Intergenic
1178460651 21:32799204-32799226 CTCACCCATGCTCATCCCATGGG - Intronic
1180043916 21:45294101-45294123 CTCCCCTATGTGCAGCCGCTGGG - Intergenic
1185057420 22:48588186-48588208 CGCACCTGTGCTCAGCCCCAGGG - Intronic
955779626 3:62470621-62470643 CTCACCTGTTCTCAGCCACTTGG + Intronic
965106424 3:164361112-164361134 CTCACCTCTGCTGTGCCGCTTGG - Intergenic
978611368 4:110544837-110544859 CTCACATTTGCTCAGCTCCTTGG + Intronic
985661518 5:1159411-1159433 CTCCCCTGTCCTCAGCCACTCGG - Intergenic
988846762 5:35135440-35135462 CTCACCTTTGCTGAGCTGTTGGG + Intronic
999232542 5:150070136-150070158 CTCACCTGGGCTCAGGGGCTGGG - Intronic
1014397570 6:120945046-120945068 CCCACCTCTGCTCAGCTTCTGGG + Intergenic
1016919977 6:149283150-149283172 CTCCCCTCTGCTCTCCCGCTAGG + Intronic
1019696131 7:2447063-2447085 CTCTCCTCTGCTCTGCAGCTGGG - Intergenic
1026589308 7:71681563-71681585 CTGCCCTAGGCTCAGCCTCTGGG - Intronic
1032694468 7:134322355-134322377 CTCACCTAGGGTCATCCTCTGGG + Intergenic
1037041243 8:14237587-14237609 CTCACCTATGGTCAGCTGTCCGG + Exonic
1037273830 8:17156836-17156858 CTCACCTATGCACAGCTGGATGG - Exonic
1050174101 9:2852272-2852294 TTCACCTTTGCTCAGCAACTGGG + Intergenic
1052316457 9:27120700-27120722 CTCACCTATGGTAACCTGCTAGG - Intronic
1054989250 9:71303032-71303054 CTCACCAATGCTCAGAGACTAGG + Intronic
1056370310 9:85947503-85947525 CTCACCCATGCTCCACCTCTTGG - Intronic
1060827128 9:126693795-126693817 CTCACCCTGGCCCAGCCGCTGGG - Exonic
1186849869 X:13569759-13569781 CTCCTCTCTCCTCAGCCGCTCGG - Exonic
1187531384 X:20100001-20100023 CTCAACTCTGCTCAGCCCCCAGG - Intronic
1192341699 X:70268530-70268552 CTCCCCTAAGCTCACCCCCTGGG + Intronic
1197362271 X:125519575-125519597 CTTCCCTATGCTCAGCACCTTGG + Intergenic