ID: 1131406422

View in Genome Browser
Species Human (GRCh38)
Location 15:92168629-92168651
Sequence CACCTAAGACTGCTGTAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 106}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131406417_1131406422 12 Left 1131406417 15:92168594-92168616 CCCTAGCGGCTGAGCATAGGTGA 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1131406422 15:92168629-92168651 CACCTAAGACTGCTGTAGCATGG 0: 1
1: 0
2: 0
3: 9
4: 106
1131406418_1131406422 11 Left 1131406418 15:92168595-92168617 CCTAGCGGCTGAGCATAGGTGAG 0: 1
1: 0
2: 0
3: 6
4: 81
Right 1131406422 15:92168629-92168651 CACCTAAGACTGCTGTAGCATGG 0: 1
1: 0
2: 0
3: 9
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131406422 Original CRISPR CACCTAAGACTGCTGTAGCA TGG Intronic
901941821 1:12668061-12668083 CACCTATGACTGATGGAGGAGGG + Intergenic
902255521 1:15186571-15186593 CACTTAAGACATCTGTAGAATGG + Intronic
903014399 1:20352601-20352623 CACCTCAGCATGCTGTAGCAGGG + Intronic
906382010 1:45338877-45338899 CACCTCAGCCTCCTGTAGCTGGG + Intronic
906988565 1:50713044-50713066 CACCTCAGCCTCCTGTAGCTGGG - Intronic
907540109 1:55208000-55208022 TTCCAAAGACTGCTGTATCATGG + Intronic
908693733 1:66812707-66812729 CACTTAAGGCTGCAGAAGCAGGG + Intergenic
912495545 1:110089139-110089161 CACCTAAGACTGTTGAGGGAGGG + Intergenic
916526782 1:165617846-165617868 CACATAAGAATGCAGCAGCAAGG + Intergenic
917084088 1:171288299-171288321 TACTTAAGACTGGTCTAGCAGGG - Intergenic
917273942 1:173310296-173310318 CTCCAAACACTGCTTTAGCAGGG + Intergenic
918050878 1:180971588-180971610 CACCTACAACTGTTGTGGCATGG + Intergenic
918190571 1:182170178-182170200 CACCTCAGCCTCCTGTAGCTGGG - Intergenic
922533836 1:226365072-226365094 AACCGAAGATTGCTGTGGCACGG - Exonic
924724522 1:246656814-246656836 CACCTTAGCCTCCTGTAGCTGGG - Intronic
1069738635 10:70673578-70673600 CCCCTAAGACTGCTGCAAGAGGG - Intronic
1069927526 10:71861207-71861229 CACCTAAGCCTCCTGTAGCTGGG - Intergenic
1071962571 10:90821500-90821522 CACCTTAGCCTGCAGTGGCAAGG - Intronic
1072138294 10:92567855-92567877 CACCTCAGCCTCCTGTAGCTAGG - Intronic
1073112908 10:101073449-101073471 CACCTCAGATCACTGTAGCAAGG + Intergenic
1073242402 10:102067010-102067032 CACCCCAGGCTGCTGTAGGAAGG - Exonic
1079615630 11:22489162-22489184 CATCTAAGACTTCTCTAGAATGG - Intergenic
1080580026 11:33634616-33634638 CACCTAAGACTTCTGTTACACGG + Intronic
1085995545 11:81908394-81908416 CAACTAAGGGTGCTGTACCAAGG - Intergenic
1086213716 11:84351774-84351796 AACCTAAATCTGCTGAAGCAAGG - Intronic
1089871183 11:121673749-121673771 GACCTAAGTCTTCTGTACCATGG - Intergenic
1091200807 11:133779174-133779196 AACATAACACTCCTGTAGCAGGG + Intergenic
1091454514 12:596806-596828 CACCTCAGCCTCCTGTAGCTGGG - Intronic
1101430497 12:104622955-104622977 CACTTTAGACTGCTTCAGCAGGG - Intronic
1107512939 13:41103228-41103250 CACCTCAGCCTCCTGTAGCTGGG - Intergenic
1108761384 13:53570036-53570058 AACCTAAGATTGCTGTACCAGGG - Intergenic
1108893511 13:55293998-55294020 TACCTGAGACTTCTGTAGCCTGG - Intergenic
1109575006 13:64243870-64243892 CACCTTAGAGGGCTGTTGCAGGG - Intergenic
1126658209 15:51004092-51004114 CACTTATGACTCTTGTAGCAAGG - Exonic
1130342729 15:83012865-83012887 CCACTAAAACTGCTGTAGCCCGG - Intergenic
1131406422 15:92168629-92168651 CACCTAAGACTGCTGTAGCATGG + Intronic
1146841377 17:36157734-36157756 CACTTAACTCTGCTGTTGCAGGG + Intergenic
1151403494 17:73871667-73871689 CACCTGAGCCTGCAGCAGCAAGG + Intergenic
1151761786 17:76108260-76108282 CACCTCAGCCTCCTGTAGCTGGG + Intronic
1154222122 18:12465288-12465310 CACCTCAGACTCCAGTAGCCAGG + Intronic
1156205701 18:34883423-34883445 CACCTCAGCCTCCTGTAGCTGGG + Intronic
1156294683 18:35778745-35778767 CAGCTGAGACTGCTGAAGAAGGG - Intergenic
1158231527 18:55261124-55261146 CAGCTAAGACTGTCTTAGCAAGG - Intronic
1160481006 18:79239464-79239486 CAGCCAAGTCTGCTGTGGCAGGG + Intronic
1165149966 19:33754358-33754380 CAGCCTAGAGTGCTGTAGCAAGG - Intronic
925918596 2:8624373-8624395 CACCAAGGGCTGCTCTAGCAGGG + Intergenic
928245634 2:29624576-29624598 CACCGAGGCCTGCTGGAGCAGGG + Intronic
929115246 2:38438476-38438498 CACCTATAACTGTTGGAGCAGGG - Intergenic
930158950 2:48133241-48133263 CTCCTAAGAGTGCAGTGGCATGG - Intergenic
932427952 2:71654975-71654997 CACCTTAGCCTCCTGTAGCTGGG - Intronic
932603518 2:73146917-73146939 AACCTAAGACTCTTGCAGCAAGG + Intronic
932629539 2:73327441-73327463 CACCTCAGCCTCCTGTAGCTGGG + Intergenic
938635754 2:133224472-133224494 CACATATGACTGTTGTAGTAGGG - Intronic
942779235 2:179621654-179621676 CACCTAGACCTGCTGTAACAGGG - Intronic
948601228 2:239108461-239108483 CTCCTCAGCCTGCTGCAGCAGGG - Intronic
1168874916 20:1164765-1164787 TACCCAAGACTGCTGAAGAAAGG - Intronic
1168908028 20:1422473-1422495 CACCTTAGAGAGCTGTTGCAAGG - Intergenic
1173470080 20:43316674-43316696 CACCTAAAACTCCTGTTGCTGGG - Intergenic
1176349617 21:5782119-5782141 CAACTAGGATTGGTGTAGCAAGG - Intergenic
1176356431 21:5902703-5902725 CAACTAGGATTGGTGTAGCAAGG - Intergenic
1176408814 21:6436743-6436765 AGCCTGAGACTGCTGCAGCAGGG + Intergenic
1176543938 21:8180189-8180211 CAACTAGGATTGGTGTAGCAAGG - Intergenic
1176562889 21:8363234-8363256 CAACTAGGATTGGTGTAGCAAGG - Intergenic
1177583527 21:23059129-23059151 TTCCTAAGACTGCTATAACAAGG - Intergenic
1178041341 21:28643562-28643584 CACCTAAGCCTCCAGTAGCTGGG - Intergenic
1179684307 21:43045065-43045087 AGCCTGAGACTGCTGCAGCAGGG + Intergenic
1180979464 22:19871889-19871911 CACCTGGGACTGCTCTAGCAGGG - Intergenic
1181097773 22:20517658-20517680 CTCTCAGGACTGCTGTAGCAGGG + Intronic
1184326746 22:43793632-43793654 CAACTAACACTACTGTAGCCTGG + Intronic
1203248807 22_KI270733v1_random:96411-96433 CAACTAGGATTGGTGTAGCAAGG - Intergenic
951036109 3:17933982-17934004 ATCTTAAGAGTGCTGTAGCACGG - Intronic
951567951 3:24030775-24030797 CACCTAAGACTCCTGCACCCAGG - Intergenic
952241943 3:31540062-31540084 CACCTATGTTTGCTGTAGAAGGG + Intronic
952937768 3:38413543-38413565 CACCTCAGACAGCTGAAACAAGG - Exonic
960049920 3:113229327-113229349 CACCAATGACTGCTTTAACAAGG - Intronic
962181052 3:133206874-133206896 CACTTAAGTCTGCTGAAGCTGGG + Intronic
967269645 3:187722451-187722473 CCCCAAAGCCTGCTGAAGCATGG - Exonic
968428105 4:536221-536243 CGCCTATCACTGCTGAAGCAAGG - Intronic
970129304 4:12849340-12849362 CCACTAAAACTGCTTTAGCAAGG + Intergenic
972963905 4:44486490-44486512 CACCTACAACTGCTGAAGGAGGG - Intergenic
973117911 4:46484320-46484342 CTCCCAAGAATTCTGTAGCAGGG - Intergenic
979327350 4:119395297-119395319 CACCTTAGACTGCAGTTCCAGGG + Intergenic
979512276 4:121567856-121567878 CACTTAAGTCTGCTGAAGCTGGG - Intergenic
982823562 4:159974679-159974701 CACCCACGAATGCTATAGCAGGG - Intergenic
983245233 4:165279985-165280007 CACCTTAGACTGCAGTTCCAGGG + Intronic
983265375 4:165502291-165502313 CACCTCAGCCTCCTGTAGCTAGG + Intergenic
983460043 4:168016096-168016118 GCCCTAAGAATGCTGGAGCAAGG - Intergenic
984528800 4:180890134-180890156 CATCTCAGGCTGCTGTAACAAGG + Intergenic
986980608 5:13444090-13444112 CTGCAAAGCCTGCTGTAGCAGGG - Intergenic
992798414 5:80273844-80273866 CACCTCAGTCTCCTGTAGCTGGG + Intergenic
992810972 5:80388191-80388213 CACCTCAGCCTCCTGTAGCTAGG - Intergenic
998444236 5:142186332-142186354 CACCGAAGAGTGCTATAGAATGG + Intergenic
1001819938 5:174702567-174702589 CACCTCAGCCTCCTGTAGCTGGG + Intergenic
1004420516 6:15465335-15465357 CACCTCAGCCTCCTGTAGCTGGG - Intronic
1006564503 6:34943249-34943271 AACCTAAAACTGCTGTAGGCCGG - Intronic
1007975364 6:46095641-46095663 CATCTGAGACTGCTGCAGCCTGG + Intergenic
1013677998 6:112488571-112488593 CACCTAATACTACTGTACCAAGG + Intergenic
1014282737 6:119459756-119459778 CACCTTCGTCTACTGTAGCAAGG + Intergenic
1017750520 6:157486959-157486981 CACCTACCAATGCTGTAGCTGGG - Intronic
1026150011 7:67779971-67779993 CACCTCAGCCTCCTGTAGCTGGG - Intergenic
1033985551 7:147221487-147221509 CACCTGAGACAGCAGAAGCATGG - Intronic
1039922778 8:41904990-41905012 CTCCTAATACTGCTGTAGAAAGG - Intergenic
1042251906 8:66764582-66764604 CACCTCAGCCTCCTGTAGCTGGG + Intronic
1048759759 8:137781123-137781145 CACCTGTGACAGCTGTAGTATGG + Intergenic
1056833087 9:89932215-89932237 CAACAAAGACTTCTGCAGCATGG - Intergenic
1057616625 9:96596743-96596765 CACCTCAGCCTCCTGTAGCTGGG - Intronic
1059927341 9:119223427-119223449 CACATAAGACTTCTGGAGAAAGG - Intronic
1203465207 Un_GL000220v1:79659-79681 CAACTAGGATTGGTGTAGCAAGG - Intergenic
1185503190 X:614347-614369 CACCTGGGACCCCTGTAGCAAGG + Intergenic
1193473768 X:81939262-81939284 CACCTTAGGCTGCTGTAACAAGG - Intergenic
1195023802 X:100855529-100855551 CAGCTATGACAGCTGTAACAAGG - Intronic
1196650398 X:118162984-118163006 CACCTAAGCCTGATCTACCAAGG + Intergenic
1196942521 X:120791381-120791403 CCACTAAGAATGCTGCAGCAGGG - Intergenic
1199277542 X:145964097-145964119 CACTTTAGTCTGCAGTAGCAAGG - Intergenic
1199491864 X:148408815-148408837 CACCTAAGACTCCTTTAGGAAGG - Intergenic
1200782779 Y:7231908-7231930 CACCCAAGTCTGCTGTTGAATGG - Intergenic