ID: 1131410135

View in Genome Browser
Species Human (GRCh38)
Location 15:92200697-92200719
Sequence CACTCTACTTCCCTTTAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131410135_1131410140 20 Left 1131410135 15:92200697-92200719 CCAATTTAAAGGGAAGTAGAGTG No data
Right 1131410140 15:92200740-92200762 AGCCTGGCTCATGGTGGAGAAGG No data
1131410135_1131410141 21 Left 1131410135 15:92200697-92200719 CCAATTTAAAGGGAAGTAGAGTG No data
Right 1131410141 15:92200741-92200763 GCCTGGCTCATGGTGGAGAAGGG No data
1131410135_1131410139 14 Left 1131410135 15:92200697-92200719 CCAATTTAAAGGGAAGTAGAGTG No data
Right 1131410139 15:92200734-92200756 GTCTGCAGCCTGGCTCATGGTGG No data
1131410135_1131410138 11 Left 1131410135 15:92200697-92200719 CCAATTTAAAGGGAAGTAGAGTG No data
Right 1131410138 15:92200731-92200753 AAAGTCTGCAGCCTGGCTCATGG No data
1131410135_1131410137 4 Left 1131410135 15:92200697-92200719 CCAATTTAAAGGGAAGTAGAGTG No data
Right 1131410137 15:92200724-92200746 AACTTGGAAAGTCTGCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131410135 Original CRISPR CACTCTACTTCCCTTTAAAT TGG (reversed) Intergenic
No off target data available for this crispr