ID: 1131417126

View in Genome Browser
Species Human (GRCh38)
Location 15:92270003-92270025
Sequence AAGAGCCTTTTGAAATCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131417126_1131417130 16 Left 1131417126 15:92270003-92270025 CCCTCAGATTTCAAAAGGCTCTT No data
Right 1131417130 15:92270042-92270064 ATCCAGTTGATGCTCAATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131417126 Original CRISPR AAGAGCCTTTTGAAATCTGA GGG (reversed) Intergenic
No off target data available for this crispr