ID: 1131420109

View in Genome Browser
Species Human (GRCh38)
Location 15:92298265-92298287
Sequence CAGCAAATAGCAGTGGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131420109_1131420118 24 Left 1131420109 15:92298265-92298287 CCGTCCACCACTGCTATTTGCTG No data
Right 1131420118 15:92298312-92298334 CCATCCCTCCAGATCTGGCAGGG 0: 17
1: 43
2: 88
3: 172
4: 289
1131420109_1131420115 19 Left 1131420109 15:92298265-92298287 CCGTCCACCACTGCTATTTGCTG No data
Right 1131420115 15:92298307-92298329 GATTTCCATCCCTCCAGATCTGG No data
1131420109_1131420116 23 Left 1131420109 15:92298265-92298287 CCGTCCACCACTGCTATTTGCTG No data
Right 1131420116 15:92298311-92298333 TCCATCCCTCCAGATCTGGCAGG 0: 17
1: 36
2: 91
3: 149
4: 298

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131420109 Original CRISPR CAGCAAATAGCAGTGGTGGA CGG (reversed) Intergenic
No off target data available for this crispr