ID: 1131422945

View in Genome Browser
Species Human (GRCh38)
Location 15:92322383-92322405
Sequence CAGGCTCATCTGAATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131422945_1131422950 9 Left 1131422945 15:92322383-92322405 CCTTCCTCATTCAGATGAGCCTG No data
Right 1131422950 15:92322415-92322437 ATCCAGTCACTGGCAGGAAGTGG No data
1131422945_1131422949 3 Left 1131422945 15:92322383-92322405 CCTTCCTCATTCAGATGAGCCTG No data
Right 1131422949 15:92322409-92322431 ATAACAATCCAGTCACTGGCAGG No data
1131422945_1131422948 -1 Left 1131422945 15:92322383-92322405 CCTTCCTCATTCAGATGAGCCTG No data
Right 1131422948 15:92322405-92322427 GTTAATAACAATCCAGTCACTGG No data
1131422945_1131422952 17 Left 1131422945 15:92322383-92322405 CCTTCCTCATTCAGATGAGCCTG No data
Right 1131422952 15:92322423-92322445 ACTGGCAGGAAGTGGAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131422945 Original CRISPR CAGGCTCATCTGAATGAGGA AGG (reversed) Intergenic
No off target data available for this crispr