ID: 1131424440

View in Genome Browser
Species Human (GRCh38)
Location 15:92334153-92334175
Sequence GGCAGAGCTGCATTCGTAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131424440_1131424446 10 Left 1131424440 15:92334153-92334175 CCAGTTACGAATGCAGCTCTGCC No data
Right 1131424446 15:92334186-92334208 TGTCCTTTCCTAGAAGACATGGG No data
1131424440_1131424449 21 Left 1131424440 15:92334153-92334175 CCAGTTACGAATGCAGCTCTGCC No data
Right 1131424449 15:92334197-92334219 AGAAGACATGGGAACATCTCTGG No data
1131424440_1131424445 9 Left 1131424440 15:92334153-92334175 CCAGTTACGAATGCAGCTCTGCC No data
Right 1131424445 15:92334185-92334207 GTGTCCTTTCCTAGAAGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131424440 Original CRISPR GGCAGAGCTGCATTCGTAAC TGG (reversed) Intergenic
No off target data available for this crispr