ID: 1131427363

View in Genome Browser
Species Human (GRCh38)
Location 15:92356535-92356557
Sequence GGAGCTTTCTCTAAACAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131427355_1131427363 13 Left 1131427355 15:92356499-92356521 CCAGAGCTGCCCGTGGGACTCAG No data
Right 1131427363 15:92356535-92356557 GGAGCTTTCTCTAAACAAGAGGG No data
1131427357_1131427363 4 Left 1131427357 15:92356508-92356530 CCCGTGGGACTCAGGCCACAGCA No data
Right 1131427363 15:92356535-92356557 GGAGCTTTCTCTAAACAAGAGGG No data
1131427353_1131427363 17 Left 1131427353 15:92356495-92356517 CCGCCCAGAGCTGCCCGTGGGAC No data
Right 1131427363 15:92356535-92356557 GGAGCTTTCTCTAAACAAGAGGG No data
1131427358_1131427363 3 Left 1131427358 15:92356509-92356531 CCGTGGGACTCAGGCCACAGCAG No data
Right 1131427363 15:92356535-92356557 GGAGCTTTCTCTAAACAAGAGGG No data
1131427350_1131427363 26 Left 1131427350 15:92356486-92356508 CCATCTGCTCCGCCCAGAGCTGC No data
Right 1131427363 15:92356535-92356557 GGAGCTTTCTCTAAACAAGAGGG No data
1131427354_1131427363 14 Left 1131427354 15:92356498-92356520 CCCAGAGCTGCCCGTGGGACTCA No data
Right 1131427363 15:92356535-92356557 GGAGCTTTCTCTAAACAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131427363 Original CRISPR GGAGCTTTCTCTAAACAAGA GGG Intergenic