ID: 1131431926

View in Genome Browser
Species Human (GRCh38)
Location 15:92394571-92394593
Sequence GCCCCCTGCCCACTTTGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 281}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131431926_1131431938 15 Left 1131431926 15:92394571-92394593 CCTTGGCAAAGTGGGCAGGGGGC 0: 1
1: 0
2: 1
3: 25
4: 281
Right 1131431938 15:92394609-92394631 AGCTGGGGGAGGGGTTCCTGGGG 0: 1
1: 0
2: 4
3: 60
4: 584
1131431926_1131431930 -1 Left 1131431926 15:92394571-92394593 CCTTGGCAAAGTGGGCAGGGGGC 0: 1
1: 0
2: 1
3: 25
4: 281
Right 1131431930 15:92394593-92394615 CGCGCAGGGATCTCTGAGCTGGG 0: 1
1: 0
2: 2
3: 6
4: 84
1131431926_1131431940 24 Left 1131431926 15:92394571-92394593 CCTTGGCAAAGTGGGCAGGGGGC 0: 1
1: 0
2: 1
3: 25
4: 281
Right 1131431940 15:92394618-92394640 AGGGGTTCCTGGGGCCGGAGCGG 0: 1
1: 0
2: 2
3: 42
4: 394
1131431926_1131431933 4 Left 1131431926 15:92394571-92394593 CCTTGGCAAAGTGGGCAGGGGGC 0: 1
1: 0
2: 1
3: 25
4: 281
Right 1131431933 15:92394598-92394620 AGGGATCTCTGAGCTGGGGGAGG 0: 1
1: 0
2: 1
3: 50
4: 434
1131431926_1131431931 0 Left 1131431926 15:92394571-92394593 CCTTGGCAAAGTGGGCAGGGGGC 0: 1
1: 0
2: 1
3: 25
4: 281
Right 1131431931 15:92394594-92394616 GCGCAGGGATCTCTGAGCTGGGG 0: 1
1: 0
2: 2
3: 21
4: 187
1131431926_1131431936 13 Left 1131431926 15:92394571-92394593 CCTTGGCAAAGTGGGCAGGGGGC 0: 1
1: 0
2: 1
3: 25
4: 281
Right 1131431936 15:92394607-92394629 TGAGCTGGGGGAGGGGTTCCTGG 0: 1
1: 1
2: 7
3: 53
4: 611
1131431926_1131431932 1 Left 1131431926 15:92394571-92394593 CCTTGGCAAAGTGGGCAGGGGGC 0: 1
1: 0
2: 1
3: 25
4: 281
Right 1131431932 15:92394595-92394617 CGCAGGGATCTCTGAGCTGGGGG 0: 1
1: 0
2: 0
3: 18
4: 240
1131431926_1131431937 14 Left 1131431926 15:92394571-92394593 CCTTGGCAAAGTGGGCAGGGGGC 0: 1
1: 0
2: 1
3: 25
4: 281
Right 1131431937 15:92394608-92394630 GAGCTGGGGGAGGGGTTCCTGGG 0: 1
1: 0
2: 5
3: 71
4: 593
1131431926_1131431941 27 Left 1131431926 15:92394571-92394593 CCTTGGCAAAGTGGGCAGGGGGC 0: 1
1: 0
2: 1
3: 25
4: 281
Right 1131431941 15:92394621-92394643 GGTTCCTGGGGCCGGAGCGGAGG 0: 1
1: 0
2: 1
3: 25
4: 373
1131431926_1131431934 5 Left 1131431926 15:92394571-92394593 CCTTGGCAAAGTGGGCAGGGGGC 0: 1
1: 0
2: 1
3: 25
4: 281
Right 1131431934 15:92394599-92394621 GGGATCTCTGAGCTGGGGGAGGG 0: 1
1: 0
2: 3
3: 47
4: 444
1131431926_1131431929 -2 Left 1131431926 15:92394571-92394593 CCTTGGCAAAGTGGGCAGGGGGC 0: 1
1: 0
2: 1
3: 25
4: 281
Right 1131431929 15:92394592-92394614 GCGCGCAGGGATCTCTGAGCTGG 0: 1
1: 0
2: 0
3: 5
4: 76
1131431926_1131431935 6 Left 1131431926 15:92394571-92394593 CCTTGGCAAAGTGGGCAGGGGGC 0: 1
1: 0
2: 1
3: 25
4: 281
Right 1131431935 15:92394600-92394622 GGATCTCTGAGCTGGGGGAGGGG 0: 1
1: 1
2: 4
3: 48
4: 468
1131431926_1131431942 28 Left 1131431926 15:92394571-92394593 CCTTGGCAAAGTGGGCAGGGGGC 0: 1
1: 0
2: 1
3: 25
4: 281
Right 1131431942 15:92394622-92394644 GTTCCTGGGGCCGGAGCGGAGGG 0: 1
1: 0
2: 0
3: 18
4: 194
1131431926_1131431939 19 Left 1131431926 15:92394571-92394593 CCTTGGCAAAGTGGGCAGGGGGC 0: 1
1: 0
2: 1
3: 25
4: 281
Right 1131431939 15:92394613-92394635 GGGGGAGGGGTTCCTGGGGCCGG 0: 1
1: 0
2: 20
3: 110
4: 1024

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131431926 Original CRISPR GCCCCCTGCCCACTTTGCCA AGG (reversed) Intronic
900414351 1:2528226-2528248 GCCCGCTGGCCACCGTGCCAAGG - Intergenic
900416543 1:2537753-2537775 GGCCCCTGCCCACCTTTCCTCGG - Intergenic
900522931 1:3114926-3114948 CCTCCCTGCACACTTGGCCAAGG + Intronic
900974959 1:6011234-6011256 GCCTCCTGCACACTTGGCCCTGG - Intronic
902407362 1:16191969-16191991 GCTCCCTGCCCACCTGCCCAGGG - Intergenic
905028223 1:34865592-34865614 GCCCTCTGCCCACTGGGCCCAGG - Exonic
905314925 1:37076315-37076337 TCCTCCTGCCCTCTTTGTCAGGG + Intergenic
905516780 1:38567724-38567746 GTCACCTGCCCCCTTTGCCGAGG + Intergenic
906724013 1:48030510-48030532 GCCCCCTGCCCACCTCTGCACGG + Intergenic
910350871 1:86296378-86296400 GGACCCTGCCCCCTTGGCCAAGG + Intergenic
911177621 1:94833043-94833065 GCCCCCTGCACGCTTGGCCCAGG + Intronic
912552481 1:110493189-110493211 ACCCCCTGCCCAGTTGGCCCTGG + Intergenic
912554499 1:110506466-110506488 GCCCCCTGCCCCCTCTCCAAAGG + Intergenic
913552450 1:119928938-119928960 GCCTCCTGGCCACTCTGCCTTGG - Intronic
913984511 1:143552791-143552813 CACCCCTGGCCACTTTACCAAGG + Intergenic
914902988 1:151721730-151721752 GCGCCCTCCCCACTTTATCAGGG - Intronic
915631244 1:157155299-157155321 GGCCCCTGCCCACTTCCCCCAGG + Intergenic
918401256 1:184164749-184164771 GCCTAATGCCCACTTTCCCATGG - Intergenic
918843903 1:189583689-189583711 TCCCCCTGCTCACTTTGCTCTGG + Intergenic
919221978 1:194641211-194641233 GTCCTCTGCCCACTTTGTAAAGG + Intergenic
919431109 1:197492846-197492868 GCCCTCTGCCCACTTTTTGATGG - Intergenic
920264582 1:204712273-204712295 GCCCCCGCCCCTCTCTGCCAGGG + Intergenic
920533772 1:206723891-206723913 GCCCCCTGCCAACTGTGGCAGGG - Intronic
922196333 1:223363587-223363609 GGCCCCCGCCCCCTTTCCCACGG + Exonic
922819190 1:228472141-228472163 GCCCCCACCCCACTTCACCAGGG + Intergenic
923392213 1:233523710-233523732 GCCCTCTTCCCACCTTGCAAAGG + Intergenic
924141789 1:241031796-241031818 GCCCTCTGCCCACTTTTTAATGG + Intronic
924388900 1:243529123-243529145 GTCCCTTGCCCACTTTGTAATGG + Intronic
1068545020 10:58335264-58335286 GCCCCCTGCCCACGCTGACTCGG + Intronic
1070289193 10:75103811-75103833 CTCCCCTCCCCACTTTCCCAGGG + Intronic
1071523978 10:86347537-86347559 GCCCCCTGGCCACTTGCCCCTGG - Intronic
1073110596 10:101061231-101061253 GCCCCCGGCCCAAAGTGCCACGG + Intergenic
1073451640 10:103613165-103613187 GCGCCCAGCCCTCTTTGCCCAGG + Exonic
1074190023 10:111127608-111127630 GCCCCCTGCAGACATGGCCAGGG + Intergenic
1075095744 10:119469439-119469461 TGCCACTGCCCACCTTGCCAGGG - Intergenic
1075105515 10:119537695-119537717 GCCGCCTGCCCACAGTGCCACGG + Intronic
1075966244 10:126614212-126614234 TCCCCCTGCCCACTTTCCCAAGG + Intronic
1075995117 10:126870873-126870895 CTCCCCTGCCCCCTTTACCAAGG - Intergenic
1076365501 10:129919027-129919049 GTCCCCTTCCCACTGTGCCCAGG - Intronic
1076686484 10:132200547-132200569 GCCCGCTGCACACCCTGCCAAGG + Intronic
1077184137 11:1228886-1228908 GGCCTCTGCCCACTATGCCTGGG - Intronic
1077192790 11:1262422-1262444 GCCCCCTGCCCCCTGTCCCCTGG - Intergenic
1079245028 11:18745547-18745569 GCCTCCCACACACTTTGCCAAGG + Intronic
1079385575 11:19976452-19976474 GCCCCCTGCCAGCCTCGCCAGGG - Intronic
1079812868 11:25017094-25017116 GCCACTTGCCCACTTTTCAATGG + Intronic
1081189152 11:40081653-40081675 ACCCCCACCCCACTGTGCCATGG + Intergenic
1081802497 11:45869657-45869679 GCCCTCAGCCCACTTGGCCAGGG - Exonic
1083598368 11:63931106-63931128 CACCCCTGCCCGCTTGGCCAGGG - Intergenic
1083764600 11:64835899-64835921 CCCCTCTGCCCACCTTACCATGG + Intronic
1084898403 11:72292515-72292537 GACCTCTGCCCACATGGCCATGG - Exonic
1085322297 11:75582695-75582717 GCCCCCTTCTCTCGTTGCCACGG - Intergenic
1085344879 11:75762193-75762215 GCCCCCTGCACACTGTGGAAAGG - Intronic
1088997291 11:115012260-115012282 GGCCCCTGGTCACTTTACCAGGG + Intergenic
1089284371 11:117396171-117396193 GCCCCCAGCTCACTGTTCCAAGG - Exonic
1089596957 11:119586437-119586459 GCCTCCTCCCCACATGGCCAGGG - Intergenic
1090497845 11:127232045-127232067 GCACCCTGCACACTTGGACAAGG + Intergenic
1091122490 11:133067667-133067689 TCCACCTGGCCACTTTGCCCAGG - Intronic
1092232374 12:6783283-6783305 GCCCCCAGCCCCCTTTGCAGAGG + Intergenic
1095590567 12:43898639-43898661 GTCCCCTGCACAGTTTTCCATGG + Intronic
1097623727 12:61973819-61973841 GCTCCCTGCTCACTTCCCCAAGG - Intronic
1100270056 12:93016125-93016147 GTCACCTGCCCTCTTTGCCCAGG + Intergenic
1100384319 12:94091621-94091643 GCCCTCTCCCCATTTTCCCAAGG + Intergenic
1101037402 12:100718549-100718571 GTCCCCTGCTCATTTTACCAAGG + Intronic
1102147188 12:110662923-110662945 GTCCACTGCCCAGTTTTCCATGG - Intronic
1102598509 12:114011814-114011836 GCTCCCTGCCCTCTTCCCCATGG + Intergenic
1102636189 12:114326455-114326477 GCCCCCTACCCACTTAGACTTGG + Intergenic
1102655471 12:114479356-114479378 GGTCCCTGCCCTCTTAGCCAGGG - Intergenic
1104972584 12:132538613-132538635 GCACCCTCCCCACAGTGCCAAGG - Intronic
1105278212 13:18948432-18948454 CACCCCTGCCCACTTCCCCATGG + Intergenic
1105306473 13:19172561-19172583 GTCCCCTGCACACACTGCCAAGG + Intergenic
1108171967 13:47751079-47751101 GTCCCCTGCTCACTCTGCCATGG + Intergenic
1109794684 13:67295357-67295379 GCACCCTACCCTCTTTGCTAGGG - Intergenic
1110523229 13:76505433-76505455 CCTCCCTCACCACTTTGCCAAGG + Intergenic
1111855212 13:93628403-93628425 TCTCCCTGCCCACTTTACCAAGG - Intronic
1112159069 13:96849513-96849535 GCCCCCTGCCCACTATGCAGAGG - Intergenic
1113324151 13:109266426-109266448 CCCCCCTTCCCACTTTTCTAGGG + Intergenic
1113633198 13:111901812-111901834 GCCCCCTGCCCCCTTCCACAGGG - Intergenic
1113954390 13:114089401-114089423 GCCTCCTGCCCTCCATGCCAGGG - Intronic
1118729375 14:68655735-68655757 CCTCCCTGCCCTCTTGGCCATGG - Intronic
1119741349 14:77015559-77015581 GCCCCCTGCCCCCACAGCCAAGG - Intergenic
1121641079 14:95485342-95485364 GCCCCCTCCCCACATTCCAATGG + Intergenic
1126724793 15:51621976-51621998 TCCCCCTGCCCGCTGTGCTAGGG - Intronic
1126851222 15:52798387-52798409 GCCTCCTGCCCATCTGGCCAAGG + Intergenic
1128078611 15:64843110-64843132 GCCCACCTCCCACTTTTCCAGGG + Intronic
1129181167 15:73876573-73876595 GCCATCTGCCTACTTTGCCGTGG - Intronic
1129560816 15:76565347-76565369 GCCCTTTGCCCACTTTGTAATGG - Intronic
1130086037 15:80779216-80779238 GCCCCCGCCCCACTTGGGCAAGG + Intergenic
1130121099 15:81048332-81048354 ACCCCCTGGCCACTCAGCCAGGG + Intronic
1131244972 15:90783317-90783339 ACCCCCTTTCCACTTTTCCATGG + Intronic
1131266832 15:90920491-90920513 GCCAAGTGCCCAGTTTGCCAGGG - Exonic
1131431926 15:92394571-92394593 GCCCCCTGCCCACTTTGCCAAGG - Intronic
1132621061 16:868536-868558 GTCCCCTGCCCAGTTCACCATGG + Intronic
1132659390 16:1054733-1054755 TCCGCCTGCCCACCTGGCCACGG + Intergenic
1132871103 16:2116112-2116134 GCCCCCTGCCCACCAGGTCATGG - Exonic
1134248546 16:12558079-12558101 GCCCCGTCCCCACTTTGCATGGG - Intronic
1134521431 16:14920782-14920804 GCCCCCTGCCCACCAGGTCATGG + Intronic
1134709102 16:16319433-16319455 GCCCCCTGCCCACCAGGTCATGG + Intergenic
1134716311 16:16359462-16359484 GCCCCCTGCCCACCAGGTCATGG + Intergenic
1134950503 16:18349212-18349234 GCCCCCTGCCCACCAGGTCATGG - Intergenic
1134958439 16:18392697-18392719 GCCCCCTGCCCACCAGGTCATGG - Intergenic
1136541288 16:30928725-30928747 GCCCCAGCCCCACTTGGCCACGG + Intronic
1136574111 16:31113146-31113168 ACACCCTACCCACCTTGCCAGGG + Intergenic
1137702386 16:50506463-50506485 ACCCCCAGGCCACTTTGCCCTGG - Intergenic
1139160556 16:64502520-64502542 GCCCTTTGCCCACTTTGTAATGG + Intergenic
1139488108 16:67270806-67270828 TCCCCCTGCCCACTCTTCCAGGG - Exonic
1140074678 16:71686591-71686613 GCCCCCTCCCCACCATGCCCTGG + Intronic
1140218805 16:73028725-73028747 GCCCACTGCCCCCTTTCCCAGGG - Intronic
1142115714 16:88355077-88355099 GCCCCCTGCCCACCCTCCCCAGG - Intergenic
1142967909 17:3592442-3592464 CCCACCTGCCCTCCTTGCCAAGG + Intronic
1143609867 17:8012088-8012110 GCCCCTTCCCCACATTGCCCTGG + Intronic
1145254561 17:21315566-21315588 GCACCCTGCACACTTTGCCTGGG + Intergenic
1145322035 17:21772398-21772420 GCACCCTGCACACTTTGCCTGGG - Intergenic
1145861060 17:28210754-28210776 TCCCCCTGCCCACTTTTCTCTGG + Intergenic
1146465133 17:33080191-33080213 CCTCCCTGCCCACTCTGCCTTGG - Intronic
1147317822 17:39629238-39629260 CCTCCCTGCCCACTTAGCCCTGG + Intronic
1148583045 17:48756803-48756825 GACCCTTGCCTTCTTTGCCACGG - Intergenic
1148601997 17:48901300-48901322 GCCCTCTGCCCAAGCTGCCAGGG + Intergenic
1148766752 17:50043994-50044016 GCCAGCTGCCCACTCAGCCAGGG - Intergenic
1149576861 17:57719995-57720017 GCACTCTGCCCAGTTTGCCCAGG + Intergenic
1150017748 17:61575475-61575497 GCCCTCTGACCACTTTGCCTTGG + Intergenic
1150652927 17:67021653-67021675 GCTTCCTGCCCACCTTGCCCTGG + Intronic
1151182307 17:72338192-72338214 GCCCACTGCCCACTTTTGCATGG + Intergenic
1151979964 17:77502897-77502919 GCCCCCTGCCCCCTACGCCATGG + Intergenic
1153255464 18:3165987-3166009 ACCCACTGCCCACTGTGCCCAGG + Intronic
1153977656 18:10283561-10283583 GCCCACTGCCCACCCTGGCATGG - Intergenic
1154334737 18:13456366-13456388 GCTCCCTGTGCACCTTGCCAGGG + Intronic
1155758463 18:29532782-29532804 GCCCACTGCCCACTTTTTAATGG - Intergenic
1157231537 18:45920980-45921002 GCCCCCAGCCCACTTAGGCCAGG + Intronic
1157535655 18:48455634-48455656 TTCCCCTTCCCACTCTGCCAAGG + Intergenic
1158588763 18:58762588-58762610 GCCACCTGGTCCCTTTGCCACGG - Intergenic
1160008590 18:75087498-75087520 GCCCACGGCCCACATGGCCACGG + Intergenic
1160551028 18:79693951-79693973 CCTCCATGCCCACTGTGCCATGG - Intronic
1160975567 19:1790645-1790667 CCCCCCTTCCCACTGTGCCTTGG + Intronic
1162030181 19:7913993-7914015 GCCCCTTGGCCCCTTTGTCAGGG + Exonic
1162078529 19:8205199-8205221 GTCCCCTGCCCAGCTTCCCAGGG - Intronic
1162500562 19:11051033-11051055 GCCCCCTGAGCCCTCTGCCATGG - Intronic
1162930382 19:13954449-13954471 CCCACCTGCCCCCTTTGCCTGGG - Intronic
1163292062 19:16385370-16385392 CCCCCCTGCCCACTCTGGCATGG + Intronic
1163848436 19:19650361-19650383 GCCCCCTCCCAACTCTGACAGGG + Intronic
1163950219 19:20577038-20577060 TCCCCGTGCCAATTTTGCCAAGG + Intronic
1164083086 19:21877546-21877568 GCCCCCTGTGCACAGTGCCAAGG - Intergenic
1164191066 19:22917659-22917681 GCCCCCTGTGCACAGTGCCAAGG - Intergenic
1164640808 19:29824180-29824202 GCCCCCTGCCCAGCTGGCTATGG - Exonic
1165220294 19:34310804-34310826 GCACCCAGCTCACTGTGCCAGGG + Intronic
1165766478 19:38354634-38354656 GCCCCCTGCCCACATTTCCCTGG - Intronic
1166396659 19:42446177-42446199 ACCCACTGCTCACTTTCCCACGG - Intergenic
1166691734 19:44825720-44825742 GCCCCCTTCCCACTGGCCCAGGG - Intergenic
1166915175 19:46190641-46190663 CCTCCCAGCCCTCTTTGCCAAGG + Intergenic
1167119532 19:47508235-47508257 GCCCCCGGCTCCCTGTGCCAGGG - Intronic
924978087 2:196130-196152 GCCCACTGTCCACTGCGCCACGG - Intergenic
925868259 2:8247547-8247569 GCCCCCAGCCCACCCTGCCCTGG + Intergenic
926502186 2:13669873-13669895 ATCCCTTGCCCACTTTGCAATGG + Intergenic
927286414 2:21361689-21361711 GGCCTTTTCCCACTTTGCCATGG + Intergenic
927490760 2:23519412-23519434 TCCCCCTGGCCAGTGTGCCAAGG + Intronic
929009716 2:37429019-37429041 GAACCCTGCCCTCTTTGTCAGGG + Intergenic
929806714 2:45152876-45152898 GCCCCCTCCCCACAATGCCAGGG - Intergenic
931111802 2:59118861-59118883 GTCCCCTGACCAATTTTCCAGGG - Intergenic
934074447 2:88416016-88416038 GCCCCCTGCCCTCTTTATCAGGG + Intergenic
934753489 2:96809532-96809554 GCCCCCTGCCCACCCTGCGGGGG + Exonic
934892972 2:98087020-98087042 GCGCCCCGCCCTCTTGGCCACGG + Intergenic
935431933 2:102985492-102985514 GACCACTGCCCACTGTGCAATGG - Intergenic
935835101 2:107042318-107042340 GTCCCTTGCCCACTTTTTCATGG - Intergenic
938367223 2:130744530-130744552 GGCCCCTGCCACCTATGCCAAGG - Intergenic
938694881 2:133826187-133826209 GGGCCCTGCACACTATGCCAGGG - Intergenic
938865127 2:135410783-135410805 GCCCTTTGCCCACTTTTCAATGG - Intronic
939205146 2:139092563-139092585 GACCTCTGCCCACTTTTCAATGG - Intergenic
942116641 2:172735531-172735553 GCCCTCTCCCCACTCTGCCTTGG + Intronic
943872393 2:193017018-193017040 GCCCCCTTCCCACTTTTTAATGG - Intergenic
944090556 2:195905111-195905133 GCCCTCTGCAGACTTTTCCATGG - Intronic
946422459 2:219572315-219572337 GCCCCGTGCCCCTTCTGCCAGGG - Exonic
1169870141 20:10240829-10240851 GCCCCCTGCCTGCTCTTCCAGGG - Intronic
1170208259 20:13822736-13822758 GCTTCCTGTCCACTTTGCCTTGG - Intergenic
1171456083 20:25273162-25273184 CCTCCCTGCCCCCTTGGCCAGGG - Intronic
1171458779 20:25286841-25286863 GTCCCCTGCCCACTGTGACCTGG + Intronic
1172758131 20:37301851-37301873 GCCCCTTGCCCACTTTCACCTGG - Intronic
1172814878 20:37678474-37678496 CCCTCCTGCCCACATCGCCAAGG + Intergenic
1172929916 20:38579253-38579275 GCCCACTGCCCCCTTTGTGAAGG + Intergenic
1173647500 20:44642591-44642613 GCCCCCTCTCCACTTTGCCCTGG - Intronic
1175900514 20:62358202-62358224 GCCCCATCCCCACCTTGGCATGG + Intronic
1176177299 20:63734839-63734861 GCAGCCTGCCCACTTCTCCAGGG - Intronic
1176297689 21:5082950-5082972 ACCCCCTCCACACCTTGCCATGG - Intergenic
1176990610 21:15491675-15491697 GCCCCATGCCAATTCTGCCATGG + Intergenic
1178093684 21:29191054-29191076 GCACCCTGCCCCCTTCGCCTTGG + Intergenic
1178247455 21:30967723-30967745 TCCCCCTGCCCACTTCGAGATGG - Intergenic
1179044883 21:37835063-37835085 GCCCACTCCCCACTTTTCCTTGG - Intronic
1179488427 21:41725768-41725790 GCCCACTGCCCACTCTGCAGGGG + Intergenic
1179505684 21:41838696-41838718 GCCCCCTGGCCAGTTTCCCCAGG - Intronic
1179524222 21:41965359-41965381 GCCCCCTGCCCACTATCCAGTGG - Intergenic
1179859340 21:44178999-44179021 ACCCCCTCCACACCTTGCCATGG + Intergenic
1180604414 22:17046238-17046260 GACCTCTGCCCTCTGTGCCAAGG + Intergenic
1181028860 22:20140553-20140575 GCCCCCTGCCCACCCTGGCCTGG + Intronic
1181032604 22:20155538-20155560 GCTTCCTGCCCATGTTGCCAGGG + Intergenic
1183093654 22:35540195-35540217 GCCGCCTGCCCACTCGGCCGGGG - Intergenic
1183428600 22:37752484-37752506 GCTCCCTGCCCACACTGCCTGGG + Intronic
1183563995 22:38599737-38599759 GCACCCTGCCCACAGTGACAAGG + Intronic
1183828578 22:40406320-40406342 GGCCCCTGACAACTGTGCCAAGG + Intronic
1184244443 22:43228811-43228833 GCCCCGTGCCCATCTGGCCAAGG + Intronic
1184389049 22:44192573-44192595 GCTCCCTGCCCACTGGGGCATGG + Intronic
1184688051 22:46105216-46105238 GCCCCCTCCCCGCCTGGCCAGGG - Intronic
1184727446 22:46355199-46355221 GCCTCTTGCCCACTCTGACATGG + Intronic
1185205534 22:49535843-49535865 GCCCCCTGCCCACCTTTCTGGGG - Intronic
1185250513 22:49799339-49799361 GCCCCCTGCTCACCTTGGCCTGG - Intronic
949534095 3:4982420-4982442 AGCCTCTGCCCATTTTGCCACGG + Intronic
950065264 3:10107187-10107209 ACCCTCCGCCCACCTTGCCATGG - Intronic
950441252 3:13012000-13012022 GCCTCATGCCCACTTTGCAGAGG - Intronic
952554964 3:34521239-34521261 GCCCCCTGTCCACTATGCTGAGG - Intergenic
952942139 3:38453641-38453663 GGCTCCTGACCACTTTGCCCGGG - Intergenic
953702875 3:45210321-45210343 GCCTCCTCCCCACCTTGCCTTGG - Intergenic
954144421 3:48627336-48627358 GCCCCCTCCCCACTCAGCCCTGG - Intronic
954224755 3:49174411-49174433 GCCCCCTTCCCACATTCCCCAGG - Intronic
956607740 3:71089900-71089922 TGCCCATTCCCACTTTGCCATGG - Intronic
956675525 3:71728719-71728741 GCACCCTGCCCAAGTTGCCTTGG - Intronic
956780196 3:72597513-72597535 CCCCCCCGACCACTTTGTCACGG - Intergenic
961458469 3:127035899-127035921 GCCCCGTGGGCACTGTGCCAGGG + Exonic
961563783 3:127749003-127749025 GCCCTCTGCCCCCTTCCCCAGGG + Intronic
961930957 3:130532334-130532356 CCCCCCATCCCACTCTGCCAAGG + Intergenic
966799038 3:183745147-183745169 GGCCCCTGCCCACTATTCCTAGG + Intronic
967450503 3:189617698-189617720 GCCCTCTACTCACTATGCCAAGG - Intergenic
968885084 4:3324601-3324623 GGACCTTGCCCACTTTGTCAAGG - Intronic
968983914 4:3865247-3865269 GCCCCCTCCCCACGCTGGCACGG - Intergenic
969365771 4:6693588-6693610 ACCCCGTGCCCACTTACCCAGGG + Exonic
976174231 4:82335960-82335982 CACCCATGTCCACTTTGCCAAGG - Intergenic
977280607 4:95035102-95035124 GCCCTTTGCCCACTTTTCAATGG + Intronic
978848372 4:113302993-113303015 GCCCCCGGCCCCCGCTGCCATGG - Intronic
980858567 4:138470763-138470785 GGCCTCTGCCCACTTTGTAATGG + Intergenic
981088309 4:140706311-140706333 CTCCCCTGACCACTCTGCCATGG - Intronic
982130220 4:152222695-152222717 GCCCACAGCCCACTGTGCCAGGG + Intergenic
983551950 4:169026679-169026701 GCTCTCTCCCCACTTTGGCAAGG + Intergenic
984869481 4:184313742-184313764 GCCCCCTCCCCACTTTGGGGAGG - Intergenic
985129808 4:186727651-186727673 GCCCCCAGCCCCCTTTTGCAAGG - Intergenic
985587947 5:750668-750690 GCTCCGGGCCCACTTGGCCAAGG + Intronic
985602616 5:843135-843157 GCTCCGGGCCCACTTGGCCAAGG + Intronic
986253985 5:6086543-6086565 GCCTCCTGCCCCCTTTTCAAAGG + Intergenic
986256865 5:6108159-6108181 CCCACCTGCCCGCTTTGCCAAGG + Intergenic
990271498 5:54146448-54146470 GCGCCCTGCCCAATATCCCATGG + Intronic
990400740 5:55435065-55435087 GCCCCATGCCCACTTTTCAATGG - Intronic
992377199 5:76199630-76199652 TACCCATGCCCACTCTGCCATGG - Intronic
992845495 5:80743060-80743082 GCCCCTCGCCCACCTTTCCAAGG + Intronic
997455392 5:134013641-134013663 GCCCTCTGCCCACTTTTTAATGG - Intergenic
997657238 5:135564352-135564374 GCTCCCTCCCCACCTTGCCGAGG - Intergenic
998429501 5:142058734-142058756 GGGCCCTGCCCACTTTCCCTTGG - Intergenic
998545525 5:143024112-143024134 GCCCCCTGCCCTCCGAGCCAGGG - Intronic
998800036 5:145859842-145859864 GCCACCTGCTCTCTGTGCCACGG - Exonic
999206184 5:149849786-149849808 GCCCCCTGCACCCTCTGCAAGGG - Exonic
1001267599 5:170285932-170285954 GCTCCCTGCTCCCTGTGCCAAGG + Intronic
1001493033 5:172168974-172168996 TGCCCCTGCCCACTTCCCCAGGG + Intronic
1001780974 5:174368857-174368879 GCCCCCTGCTCTGTTGGCCAAGG + Intergenic
1003224048 6:4188964-4188986 GCCCCCTTCCCACTGCGCCCTGG - Intergenic
1005989386 6:30893555-30893577 GCCCCATACCCTCTTTGACATGG - Intronic
1006613190 6:35307756-35307778 TCCCACTTCCCAGTTTGCCAAGG + Intronic
1007321484 6:41031611-41031633 ACCCTGTGCCCACTTTGCCTAGG + Intronic
1007581056 6:42960497-42960519 GCCCTCTGCCCACTTAACCCGGG - Intergenic
1008381738 6:50845289-50845311 GCCCCCCTCCCGCTTTGCCTTGG + Exonic
1013650660 6:112191514-112191536 GCCCCCTTGTCACTTTCCCAGGG - Intronic
1014513078 6:122348854-122348876 TCCCACTTCCCACTTTGCCTAGG + Intergenic
1019034149 6:169040863-169040885 GCACCCTGCCCACCCTGCGATGG + Intergenic
1019183173 6:170205376-170205398 CCCCACTGCCCACCTTGCCTTGG + Intergenic
1019288999 7:240856-240878 GCCCCCTGCCAGCCCTGCCATGG - Intronic
1019384455 7:746683-746705 ACCCCCTGCCCACCCTGCCCAGG + Intronic
1021114429 7:16731775-16731797 GCCCCGTCCCCAGTTTGCAAGGG - Intergenic
1022163954 7:27740033-27740055 GCCCCCAGCCCACTCCGCCGCGG - Intronic
1023587019 7:41741582-41741604 GCCCACTGACCACATGGCCAGGG + Intergenic
1026159164 7:67853509-67853531 GCCACCTCCCCGCTTAGCCAGGG - Intergenic
1026831856 7:73615259-73615281 CCCCTCTGCCCAATTGGCCATGG + Intronic
1030674526 7:112370627-112370649 GCTCCCTGCCAAATTGGCCAAGG - Intergenic
1032836822 7:135682564-135682586 GCCCCCTGGGCATTTTGGCATGG + Intronic
1034152571 7:148928530-148928552 TCCCCCTGCCCAAATTCCCAAGG + Intergenic
1034256587 7:149728113-149728135 GCCCCCTGGCCTCTGGGCCATGG - Intronic
1034466110 7:151230160-151230182 TCCCCCTGCCCACCCTGCCCTGG + Intergenic
1035266195 7:157691486-157691508 CCCCTCTGCTCACTTTACCAGGG + Intronic
1036214249 8:6865987-6866009 GCCCCCTCCCCAGCTGGCCAGGG - Intergenic
1036773867 8:11596787-11596809 GCCCCCTGCCCTGGGTGCCATGG - Intergenic
1038100716 8:24371340-24371362 GCCACTTGCCAACTTTGCCTCGG + Intergenic
1038919941 8:32071614-32071636 TCCCACTGCCCACATTTCCACGG - Intronic
1039905279 8:41781805-41781827 GCCCCCAGCCCTCTTGGCCTTGG - Intronic
1040704144 8:50104858-50104880 GCCCTCTGTCCACTTTTCAATGG + Intronic
1040928845 8:52713992-52714014 GACCCCGGCCCACCGTGCCAGGG + Intronic
1041212721 8:55569185-55569207 GCCCCCTGTCCACATTGGGAAGG - Intergenic
1045330333 8:101150452-101150474 GCATGCTGCCCAGTTTGCCAAGG - Intergenic
1045653664 8:104365876-104365898 GCACCCTGACCACTGTGCCCAGG + Intronic
1046409433 8:113820062-113820084 GCCCTTTGCCCACTTTTCTATGG + Intergenic
1047012071 8:120683531-120683553 CCACCCTACCCACTTTCCCAGGG - Intronic
1047897882 8:129386582-129386604 GCCCACTGCACACTTTCCCCAGG - Intergenic
1049189707 8:141280225-141280247 GCCCCCTGCCCACCCTGTCCTGG + Intronic
1049529261 8:143146334-143146356 GCCCTCTCCCCACTTTGAAACGG + Intergenic
1050685926 9:8169248-8169270 GCTCCATGACCACTTTGCCAGGG - Intergenic
1052886459 9:33653316-33653338 GCCCTTTGCCCACTTTTTCATGG + Intergenic
1054711658 9:68516713-68516735 ACCCCAGGCCCACTTTGGCAAGG - Intronic
1056331024 9:85521459-85521481 GTCCCCTTCCTGCTTTGCCATGG + Intergenic
1056382049 9:86064558-86064580 GCCCTCTCCCCACATGGCCAGGG + Intronic
1056488777 9:87084938-87084960 GGCCCCTGTGCTCTTTGCCAGGG - Intergenic
1057301217 9:93884678-93884700 GCCCTCTGCCCATTTTGAAACGG - Intergenic
1059102296 9:111483193-111483215 GCCCCCTGCCCACTGAGCCTCGG - Intronic
1059282109 9:113143903-113143925 GGCCCCTGCCTACTTTGCAGAGG - Intergenic
1061147408 9:128808073-128808095 GCACTCTGCCCTCTTTGCCCAGG + Exonic
1061365741 9:130171958-130171980 GCCCCCTGCCCGCCCTGCGAGGG + Intergenic
1061625645 9:131839225-131839247 GTCCACAGCCCACTTTGCCAGGG + Intergenic
1062391153 9:136334393-136334415 GCCCCGGGGCGACTTTGCCAGGG + Intronic
1190405656 X:50084785-50084807 ACCATCTGCCCACTTTGACAAGG - Intronic
1191748555 X:64516236-64516258 GCCCCTCGCCCACTTTTCGATGG + Intergenic
1192901410 X:75501766-75501788 GCCCTTTGCCCACTTTTCAATGG + Intronic
1193423153 X:81308439-81308461 GCCCCCTGTCCACTTCACCATGG - Intergenic
1194320143 X:92436144-92436166 GCCCTTTGCCCACTTTTTCATGG - Intronic
1194403039 X:93461619-93461641 TCACCCTGCCCTCTTCGCCAGGG - Intergenic
1198047071 X:132913600-132913622 GCACCCTGCTCACTTGGCCCAGG - Intronic
1198580086 X:138053975-138053997 GCCCTTTGCCCACTTTGTTATGG - Intergenic
1199881028 X:151974447-151974469 GCCCCGCGCCCGCTTTGCCCCGG - Intronic
1200628262 Y:5549276-5549298 GCCCTTTGCCCACTTTTTCATGG - Intronic