ID: 1131433258

View in Genome Browser
Species Human (GRCh38)
Location 15:92403221-92403243
Sequence CAGCTAGTAAACATGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 179}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131433258 Original CRISPR CAGCTAGTAAACATGGAGCT GGG Intronic
901840910 1:11953431-11953453 CAGCTAGTAAATGGTGAGCTGGG - Intronic
902817310 1:18923661-18923683 GAGCTAGCAAGCAGGGAGCTGGG + Intronic
904433736 1:30480670-30480692 CACCTACTAAACAGGGACCTGGG + Intergenic
905855292 1:41307413-41307435 CAGTTAGAAAAAATTGAGCTGGG - Intergenic
905954805 1:41983567-41983589 CAGCTAATAAAGGTGCAGCTGGG + Intronic
906877204 1:49552216-49552238 CAGCTAGGAGACAGGTAGCTTGG - Intronic
907108299 1:51903901-51903923 CAGTTAGTAAACACACAGCTGGG - Intergenic
907199058 1:52710441-52710463 TGGCTAGTAAATGTGGAGCTGGG + Intergenic
907811160 1:57871450-57871472 CAGCTAGTAAGCTTAGAGCTGGG + Intronic
909504202 1:76369539-76369561 CAGCTAGTAATGATGGAGCTAGG + Intronic
910474519 1:87592368-87592390 CAGGTAGTAAAGATGGAACCAGG - Intergenic
910637554 1:89425765-89425787 CAAATAGTAAACATGTAGGTAGG + Intergenic
911697222 1:100904148-100904170 GAACTAGTAAATTTGGAGCTGGG + Intronic
911748763 1:101471417-101471439 CAGCTGGTAAATATGGGGTTTGG - Intergenic
915009930 1:152676123-152676145 CTGCAGGGAAACATGGAGCTGGG - Exonic
915373966 1:155375837-155375859 CAGCTACTAAACGTAGATCTAGG + Intronic
916540351 1:165747753-165747775 AAGCTAGTAAATGTTGAGCTGGG - Intronic
917973348 1:180222663-180222685 CAGCTATTTAAAATGGAGCCAGG + Intergenic
1064614699 10:17140918-17140940 CAGGTAGTTAACATGGAATTAGG - Intergenic
1064943804 10:20765635-20765657 CAGTTAGTAAACATTGAGATTGG - Intergenic
1069822529 10:71236486-71236508 CAGCTCGTAAATATGAAGCCGGG + Intronic
1069825652 10:71253625-71253647 CAGCCAGGAACCAGGGAGCTTGG - Intronic
1069852456 10:71418811-71418833 CAGCTAGTAAACAGTGAACCAGG - Intronic
1074546688 10:114406677-114406699 CAGCAAGGAAGAATGGAGCTGGG + Intergenic
1074974957 10:118572632-118572654 CTGCCAGTATCCATGGAGCTGGG + Intergenic
1079250231 11:18781608-18781630 GAGCTAATAAAGTTGGAGCTGGG - Intronic
1080284635 11:30595365-30595387 CAGCTGGAAAAATTGGAGCTGGG + Intergenic
1080615464 11:33941453-33941475 CAGCCAGTAAACATAGAGCCTGG + Intergenic
1080711946 11:34757231-34757253 GAGCTAGTGAACATTTAGCTGGG + Intergenic
1081234986 11:40636382-40636404 GAGCAAGTAAAAGTGGAGCTGGG + Intronic
1081526800 11:43933238-43933260 CAGCTAGTAAGCATAGAGACTGG - Intronic
1084401093 11:68943384-68943406 ATGTTAGTAAACATGGGGCTGGG + Intergenic
1084772878 11:71355698-71355720 CAGCTAGGAAGCATCCAGCTAGG + Intergenic
1089175920 11:116548876-116548898 CAGCTAACAAGCATGGAGCCTGG + Intergenic
1092944555 12:13440619-13440641 CAGCAAGGAAACAGGGACCTTGG + Intergenic
1092993830 12:13929066-13929088 CAGTTAGTAAGTATAGAGCTAGG + Intronic
1095520505 12:43058882-43058904 TAGCTAGTAAACATCGAGACAGG + Intergenic
1095631915 12:44386760-44386782 CAGCTAGTAATTTTGGAGCCAGG + Intronic
1098213098 12:68186802-68186824 CAATTAGTGAAGATGGAGCTAGG - Intergenic
1100735659 12:97526993-97527015 GAGCTAGTAAGCAAGGAGCTAGG + Intergenic
1101813465 12:108128022-108128044 CAGCTGGTAATTATGGAGTTAGG + Intergenic
1105395095 13:20024277-20024299 CATCAAGTAAACATGGAGTTAGG - Intronic
1107103240 13:36616907-36616929 CAGCTGGTAAACACTGAGCATGG + Intergenic
1107361596 13:39624159-39624181 TAGCTAGTAAACTTGAAGATGGG + Intergenic
1111975266 13:94960457-94960479 CAGCTAGTAATAATGGACCCAGG - Intergenic
1112045576 13:95593627-95593649 CAGCTAGTAATGAAGGAGCCAGG - Intronic
1113669681 13:112167170-112167192 CAGATGATAAAAATGGAGCTAGG - Intergenic
1114884143 14:26826667-26826689 CAGTTAGTAAATGTGGAGCCAGG + Intergenic
1115179091 14:30601257-30601279 CAGTGGGGAAACATGGAGCTGGG + Intronic
1118820658 14:69343507-69343529 CAGCTAGTGTCCAGGGAGCTGGG - Intronic
1119206023 14:72794097-72794119 CAGCAAGTAAGCAAGGAGCTGGG - Intronic
1119548392 14:75490321-75490343 CAGCCAGGAAATATGGAGCCAGG + Intergenic
1119708920 14:76807116-76807138 AAGCTAGTAGATGTGGAGCTAGG - Intronic
1126848063 15:52779923-52779945 CAGACAGTAAATGTGGAGCTGGG + Intronic
1128213764 15:65920206-65920228 CAGCTACTAACCATGGTCCTAGG - Intronic
1128428826 15:67571763-67571785 CAGCTAGTCAATAGAGAGCTGGG + Intronic
1128566274 15:68702202-68702224 CAGCTAGGAAAGGAGGAGCTGGG - Intronic
1130006875 15:80107992-80108014 CAGCTAGTAAGTGAGGAGCTGGG - Intronic
1131433258 15:92403221-92403243 CAGCTAGTAAACATGGAGCTGGG + Intronic
1133856747 16:9556738-9556760 ATGATAGTAATCATGGAGCTGGG - Intergenic
1134598772 16:15516776-15516798 CAGCTAGTAAATGGGGAGTTAGG + Intronic
1135718004 16:24789730-24789752 CAGCTAGCAACCATGGTGCCTGG + Exonic
1137666102 16:50250006-50250028 CAGCTACCAAACATTGAGCTGGG - Intronic
1137841912 16:51648822-51648844 CAGCAAGTAAAGGAGGAGCTTGG - Intergenic
1139643943 16:68313773-68313795 CAGCAAGTAAAAGTGCAGCTGGG + Intronic
1141730585 16:85820401-85820423 CAGCCAATAAAGCTGGAGCTGGG + Intergenic
1142938028 17:3353939-3353961 CATCTGATAACCATGGAGCTGGG - Intergenic
1144926740 17:18817644-18817666 CAGCAAGTAAATATGAAGCCAGG - Intergenic
1145826897 17:27883775-27883797 CAGCTAATAAAGCTGGAGCTTGG + Intronic
1146085147 17:29821410-29821432 CTCTTAGTAAATATGGAGCTGGG - Intronic
1146775649 17:35612691-35612713 CAGCTAGTAGTAATGTAGCTAGG + Intronic
1147338282 17:39739672-39739694 CAGGAAGTAAACAAGGAGGTTGG + Intronic
1147357676 17:39910513-39910535 CAGCTAGTAAGTGTAGAGCTGGG + Intronic
1148233109 17:45949526-45949548 CAGCTAGTAAGCAGAGAGCAAGG - Intronic
1150097517 17:62390400-62390422 CAGGAAGTAGACATGGAGGTGGG + Intronic
1150957718 17:69879297-69879319 CAGCCAGCAAAGATGGAGTTTGG + Intergenic
1151891126 17:76950920-76950942 CAGCTTGTAAGCAGGGAGGTGGG + Intergenic
1156753930 18:40496837-40496859 CAGTTACTAAACATTGATCTAGG + Intergenic
1157189170 18:45566279-45566301 CAGCTAGAAATCATGGGGCCAGG + Intronic
1157651952 18:49342145-49342167 CAGCAAGAAAACAGGGACCTGGG - Intronic
1159414880 18:68132749-68132771 CAGATAGAAACTATGGAGCTAGG + Intergenic
1164641833 19:29831957-29831979 CAGCTGGGAAACACGAAGCTTGG - Intergenic
1165570874 19:36773580-36773602 CAGGTAGTAACCTTGGAGCCAGG + Intronic
1168300606 19:55402724-55402746 CAGCAAGTAGGCCTGGAGCTCGG + Intronic
1168470095 19:56632845-56632867 CTGATAATAGACATGGAGCTTGG - Intergenic
929160846 2:38830699-38830721 GAGTTAGTAAGCATGGAGCTTGG + Intronic
931206174 2:60148016-60148038 TAGCTAGTGAACGAGGAGCTGGG - Intergenic
932479759 2:72032162-72032184 CAGCTGGGAAACAGGGAGCCAGG - Intergenic
934537883 2:95151385-95151407 CAGCAAGAAAACAAGGACCTCGG + Intronic
935897939 2:107757685-107757707 AAGGTAGTAAACATGGTGCTAGG - Intergenic
938015818 2:127866382-127866404 CAGCTAGTACATGTTGAGCTGGG + Intronic
939115341 2:138054166-138054188 AAGCTAGTACACATGTAACTTGG + Intergenic
944689675 2:202148291-202148313 CAGCTAGCAAACATGAGCCTCGG - Intronic
945036147 2:205705736-205705758 CAGATAGTAATCGTGGGGCTGGG + Intronic
946488078 2:220120113-220120135 GAGCTGGTGAACATGGAGGTAGG + Intergenic
946520243 2:220456693-220456715 CACCTAGGAAACTTGGACCTAGG - Intergenic
948288659 2:236807898-236807920 GAGCAATTAAACATGGACCTTGG + Intergenic
948441922 2:237997604-237997626 TAGCCAGTAATCCTGGAGCTAGG + Intronic
948913326 2:241017398-241017420 CAGCCAAGAAACATGGAGCCTGG + Intronic
1171092196 20:22295916-22295938 CAGCTAGCAGAGGTGGAGCTGGG + Intergenic
1172195882 20:33091121-33091143 CAGCTAATAAATGTGGACCTGGG + Intronic
1172900521 20:38331262-38331284 CAGTTAGTAAGTATGGAGCAGGG - Intronic
1173544308 20:43881746-43881768 GTGCCAGTAAACATGGTGCTGGG + Intergenic
1173898541 20:46569450-46569472 CAGCTAGAAAAGATTAAGCTGGG - Intronic
1174136441 20:48383228-48383250 CTGCTGTTAACCATGGAGCTGGG + Intergenic
1174160124 20:48544574-48544596 CAGCTAGTAAACAGTGGACTGGG - Intergenic
1174322049 20:49749697-49749719 CAGCCAGTAAATACTGAGCTGGG - Intergenic
1179122274 21:38559117-38559139 CAGCTAGGATTCATGGAGCAAGG - Intronic
1179718833 21:43304061-43304083 CAGGTAGAAACCATGGAGGTAGG - Intergenic
1181163424 22:20970965-20970987 CAGCCAGAAGTCATGGAGCTGGG + Intronic
1181750950 22:24988955-24988977 CAACTAGTGATTATGGAGCTGGG + Intronic
1182869905 22:33636825-33636847 CAGTTAGTTGACATGGGGCTGGG - Intronic
949862396 3:8518103-8518125 CAGGTAGTAAAAATGTAGCCAGG + Intronic
952869732 3:37887481-37887503 CAGCTAGAAACCGTGGAACTGGG - Intronic
953915810 3:46920591-46920613 CAGTTGGTAAAACTGGAGCTGGG - Intergenic
954578934 3:51692594-51692616 CTGCTCGTACAGATGGAGCTGGG - Intronic
954797396 3:53168539-53168561 CAGCCAGTAAATATTGAGCAAGG - Intronic
955683401 3:61526071-61526093 CAGCTAGTAAAGATGGAAGCTGG + Intergenic
958775986 3:98483382-98483404 CAGCTAGAAAACATGCAGCCTGG - Intergenic
959394829 3:105824154-105824176 CAGCTTATAAACCTGGAGTTTGG - Intronic
961511191 3:127404807-127404829 CAGCTAGTGAGTATGGAGCAGGG - Intergenic
961945265 3:130680282-130680304 CAGCTAGTAAACAGAAAGCTGGG - Intronic
962381626 3:134902980-134903002 CAGATAATGAACATGGAGTTAGG + Intronic
962392898 3:134988063-134988085 CAAATAGAAATCATGGAGCTTGG + Intronic
962601183 3:136991977-136991999 CACCTAGAAACCATGGAGCCAGG + Exonic
963386394 3:144599669-144599691 AAGCTAGTAATCTTGGAGATAGG + Intergenic
963397443 3:144751377-144751399 CAGCTTGTGAACTTGGAGGTGGG + Intergenic
963859768 3:150297110-150297132 CAGCTGGCAAATAAGGAGCTCGG - Intergenic
966501506 3:180646753-180646775 CTGCTAGTACACAGAGAGCTAGG - Intronic
967017434 3:185494964-185494986 GAGCTGGTAATGATGGAGCTGGG + Intronic
967354780 3:188556268-188556290 CAACTAGTAAATATGAAACTAGG - Intronic
970387433 4:15569933-15569955 CGGCTAGGAAACATGAGGCTGGG - Intronic
971233871 4:24823977-24823999 CAGCTGGTGAAAAGGGAGCTTGG - Intronic
975031516 4:69624548-69624570 CAACTAATAAACATGAAGATAGG - Intronic
975834390 4:78406761-78406783 CAGCTGGAAACAATGGAGCTGGG + Intronic
975911886 4:79276887-79276909 CAGTTAGTAAAAATGTAGATTGG + Intronic
976196872 4:82540957-82540979 CAGCTAGTAGAGACAGAGCTGGG - Intronic
976220116 4:82749978-82750000 CAGCTAATAAACGTAGAGCTGGG - Intronic
978132544 4:105216136-105216158 GAGCTAGTATACTTGGAGTTTGG + Intronic
980091708 4:128449837-128449859 CAGCTAGTAAATAGTGAGCCTGG + Intergenic
982127804 4:152199526-152199548 CTGCTAGTAAGGGTGGAGCTGGG - Intergenic
991556701 5:67902724-67902746 CAGCTATTACACATAGGGCTGGG - Intergenic
992138334 5:73770182-73770204 CAGATAGTAACCATAGAGTTAGG + Intronic
993081424 5:83305736-83305758 GAGTTAGTTACCATGGAGCTGGG - Intronic
993089149 5:83401997-83402019 CAGCTTGTAAACCTGGCTCTTGG + Intergenic
994163708 5:96585312-96585334 GAGGTAGTAAACTTGGAGGTGGG - Intronic
997447627 5:133952943-133952965 CAGCTAGTACAGATGGGTCTGGG + Intergenic
999273213 5:150310333-150310355 CAGCTAGGAAGGGTGGAGCTGGG - Intronic
1001044457 5:168361190-168361212 CAGCTAGGAAGGATGGAACTGGG + Intronic
1001621432 5:173088582-173088604 CAGCTGGAAAACATTGAGCAAGG + Intronic
1002203662 5:177547650-177547672 TAGCCAGAAAACAAGGAGCTGGG - Intronic
1004815154 6:19304533-19304555 CAGATAGATAGCATGGAGCTAGG - Intergenic
1006638212 6:35475056-35475078 GAGCTTGTAGACATGGTGCTGGG + Exonic
1006650179 6:35545000-35545022 CAGCTCTTAAACATGGTCCTGGG - Intergenic
1007812820 6:44498284-44498306 CAGCTAGGAAGTAGGGAGCTGGG + Intergenic
1009864783 6:69383786-69383808 CAGCTATAAGACATAGAGCTGGG + Intronic
1011712279 6:90066875-90066897 CAGCTAATAAGAATGGAGCCCGG - Intronic
1012118923 6:95339617-95339639 CTGCTAGTAAACAAGGATCAAGG - Intergenic
1015413917 6:132926989-132927011 CAGCTAAAATATATGGAGCTAGG - Intergenic
1015829302 6:137350682-137350704 TAGCTAGTAAACAAGGAGCTGGG - Intergenic
1017670799 6:156767725-156767747 CGGCCTGTAAACATGGAGCTGGG + Intergenic
1019824397 7:3271806-3271828 CAGCTAGTAAAGGCGGAACTAGG + Intergenic
1022229808 7:28403658-28403680 CAGCATGTGAGCATGGAGCTGGG + Intronic
1022781643 7:33590869-33590891 AAACTAATAATCATGGAGCTGGG + Intronic
1022944536 7:35268961-35268983 CTGTTAGTGAACATGGGGCTTGG + Intergenic
1024987359 7:55206903-55206925 CAGGTAGTAAATATGAAACTAGG + Exonic
1026095222 7:67341503-67341525 CAGCTGGTAAATGGGGAGCTAGG - Intergenic
1029066416 7:97853727-97853749 CACCTAGTAAACACTGAGTTAGG - Intronic
1031161620 7:118175836-118175858 CAGCAAGAAAACAGGGACCTTGG - Intergenic
1032619782 7:133517421-133517443 GAGCTAATACACATGGAGCGGGG - Intronic
1034452870 7:151146900-151146922 CAGCTAGGACACACAGAGCTAGG - Intergenic
1038339176 8:26669858-26669880 CAGCTAGAATCCATGGAGCCTGG - Intergenic
1038949094 8:32394250-32394272 CAGCTACTCAGCATGGAGATGGG - Intronic
1039546604 8:38415176-38415198 CAGCAAGTCCACATGGGGCTGGG + Intronic
1040552527 8:48449584-48449606 TAAATAGTAAACAAGGAGCTAGG - Intergenic
1040563424 8:48545134-48545156 CACCTATAAAACAAGGAGCTTGG + Intergenic
1041098616 8:54373855-54373877 CATCTTGTAAACATGGAGCTGGG - Intergenic
1042655255 8:71088775-71088797 CAGCCAGGAAGAATGGAGCTGGG - Intergenic
1042754688 8:72197464-72197486 CAGCAAGGAAACAGGGACCTCGG - Intergenic
1042864940 8:73348930-73348952 CGGCTAGTAAGTTTGGAGCTGGG + Intergenic
1043357725 8:79432912-79432934 CAGCTAGTACACAGAGATCTAGG - Intergenic
1046608911 8:116402803-116402825 CAGCAAGAAAACAGGGATCTTGG - Intergenic
1047036892 8:120949797-120949819 CAGCTAATAAACGAGGTGCTTGG - Intergenic
1047833145 8:128658044-128658066 CAGTTAGTCAACATTGTGCTTGG + Intergenic
1049896558 9:115316-115338 CAGCTACCAAAGATGGGGCTTGG + Intergenic
1050135017 9:2453533-2453555 TAGCTATTACACATAGAGCTGGG - Intergenic
1050306316 9:4308899-4308921 CAGCTATTAAATGTGGAGCCAGG - Intronic
1056843485 9:90017862-90017884 CAGGTAGTAGCCATGGTGCTAGG + Intergenic
1057009794 9:91590973-91590995 CAGCTAATATATATGGAGATGGG + Intronic
1057736307 9:97664752-97664774 CAGCTAGTCCAGATGGAACTCGG + Intronic
1058691158 9:107521854-107521876 CAGCAAGGAAACAGGGAGCTAGG - Intergenic
1059050189 9:110916291-110916313 CAGCTAGGAATGACGGAGCTGGG + Intronic
1060837891 9:126770962-126770984 CAGCTAATAAATGTGGAGCTGGG - Intergenic
1189204372 X:39225251-39225273 ATGCTACTGAACATGGAGCTGGG + Intergenic
1195008348 X:100709558-100709580 CAGCTAGTAAATGTGGAAGTTGG - Intronic
1198581098 X:138065438-138065460 CAGCTAGTAAGAACAGAGCTGGG + Intergenic
1198931860 X:141870661-141870683 AAGCTACTAAACATGGATTTGGG - Intronic
1199118162 X:144017358-144017380 AAGATAGTAAAAATGGACCTGGG - Intergenic
1199676265 X:150191810-150191832 CAGCTAATAAAAACAGAGCTGGG + Intergenic