ID: 1131433630

View in Genome Browser
Species Human (GRCh38)
Location 15:92405962-92405984
Sequence GACTTCTGGAAGCTGCGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 151}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131433630_1131433637 5 Left 1131433630 15:92405962-92405984 CCCAGACGCAGCTTCCAGAAGTC 0: 1
1: 0
2: 0
3: 8
4: 151
Right 1131433637 15:92405990-92406012 CTTTATCACCTGCCTACGGGTGG 0: 1
1: 0
2: 0
3: 1
4: 45
1131433630_1131433635 1 Left 1131433630 15:92405962-92405984 CCCAGACGCAGCTTCCAGAAGTC 0: 1
1: 0
2: 0
3: 8
4: 151
Right 1131433635 15:92405986-92406008 CTTTCTTTATCACCTGCCTACGG 0: 1
1: 0
2: 2
3: 25
4: 242
1131433630_1131433640 23 Left 1131433630 15:92405962-92405984 CCCAGACGCAGCTTCCAGAAGTC 0: 1
1: 0
2: 0
3: 8
4: 151
Right 1131433640 15:92406008-92406030 GGTGGCCTCTAAACTGTTTCTGG 0: 1
1: 0
2: 1
3: 4
4: 103
1131433630_1131433642 30 Left 1131433630 15:92405962-92405984 CCCAGACGCAGCTTCCAGAAGTC 0: 1
1: 0
2: 0
3: 8
4: 151
Right 1131433642 15:92406015-92406037 TCTAAACTGTTTCTGGCTCAAGG 0: 1
1: 0
2: 0
3: 29
4: 281
1131433630_1131433636 2 Left 1131433630 15:92405962-92405984 CCCAGACGCAGCTTCCAGAAGTC 0: 1
1: 0
2: 0
3: 8
4: 151
Right 1131433636 15:92405987-92406009 TTTCTTTATCACCTGCCTACGGG 0: 1
1: 0
2: 0
3: 14
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131433630 Original CRISPR GACTTCTGGAAGCTGCGTCT GGG (reversed) Intronic
900699975 1:4040724-4040746 TTCCTCTGGAAGCTTCGTCTCGG - Intergenic
901327958 1:8380311-8380333 GACTTTTGGGAGTTGTGTCTGGG - Intronic
901891793 1:12272913-12272935 CATTTCTGGAAGCTGCAGCTAGG - Intronic
903384553 1:22917916-22917938 CCATTCTGGCAGCTGCGTCTTGG - Intergenic
913281123 1:117185965-117185987 GACCTCTGGAGGCTGTGTCATGG + Intronic
915219432 1:154362503-154362525 GACCTCTGGAGGCTGTGTCATGG + Intergenic
915980211 1:160415718-160415740 GACTTCCTGAAGGTGCCTCTTGG + Exonic
917516416 1:175712172-175712194 GAATTCTGGTAGCTGCTTCATGG - Intronic
924232375 1:241972906-241972928 GACTGTTGGAAGCTGGGGCTGGG + Intergenic
1064825553 10:19395251-19395273 GACCTCTGGAGGCTGTGTCATGG - Intronic
1071306306 10:84302246-84302268 TACTTCTGAAATCAGCGTCTGGG + Intergenic
1071698420 10:87903210-87903232 TTCCTCTGGAAGCTTCGTCTTGG + Intronic
1075551940 10:123399510-123399532 GACTTCTGACAGCTGATTCTTGG + Intergenic
1076669244 10:132110620-132110642 GAGTTCTGGAAAAAGCGTCTTGG + Intronic
1078410236 11:11108695-11108717 GATCTCTGGAAGATGCCTCTGGG + Intergenic
1078451411 11:11443590-11443612 GACATCTGGAGCCTGCGGCTGGG + Intronic
1082613773 11:55334638-55334660 TTCCTCTGGAAGCTTCGTCTTGG + Intergenic
1084545891 11:69814954-69814976 GTGTCCTGGAAGCTGTGTCTGGG - Intronic
1084577786 11:70001117-70001139 CACTTCTGGAGGCTGCTCCTGGG + Intergenic
1086884163 11:92184035-92184057 GACTTCTGAAAGCTCCGGGTAGG + Intergenic
1090014290 11:123072075-123072097 GACTTCTGGATGCTGAGCCTGGG + Exonic
1090836967 11:130461059-130461081 GGCTGCTCGAAGCTGCCTCTGGG + Intronic
1091367847 11:135037253-135037275 GACTCATGGAAGCTGCTTCTTGG + Intergenic
1096577224 12:52560367-52560389 GAATTCTGGCAGCAGCCTCTTGG + Intergenic
1098205123 12:68100970-68100992 GTCTGCTGGAAGCAGTGTCTTGG - Intergenic
1098864517 12:75746774-75746796 GACTTCCTGAGGCTGTGTCTCGG - Intergenic
1101031212 12:100662073-100662095 GACTTCTGGAGGCTGTGTGGCGG + Intergenic
1104399211 12:128461818-128461840 GAGTTCTGGAAGGTGGGGCTTGG - Intronic
1104537923 12:129635784-129635806 GACCTCCTGAGGCTGCGTCTTGG - Intronic
1108920223 13:55664145-55664167 GGCTTCTGGAATTTGCCTCTAGG - Intergenic
1111135491 13:84037100-84037122 GACTTCCTGAGGCTGCGTCTTGG - Intergenic
1112413152 13:99180810-99180832 GACTTCCTGAGGCTGCGTCATGG - Intergenic
1113857531 13:113456198-113456220 GAGTTCTGGAAGCAGAGCCTGGG + Intronic
1114038580 14:18654515-18654537 GACTTCTCCAAGCTCTGTCTGGG - Intergenic
1114120040 14:19660532-19660554 GACTTCTCCAAGCTCTGTCTGGG + Intergenic
1117459774 14:55933913-55933935 GCCTTTTGTAAGCTGCGTATGGG + Intergenic
1120205784 14:81585998-81586020 GACTTCCTGAAGCTGTGTCACGG + Intergenic
1122693120 14:103540787-103540809 GACTCCTGGGAGCTGCGTACAGG + Intergenic
1122863070 14:104591271-104591293 GGCTTCTGGAACCTGAGGCTTGG - Intronic
1123859347 15:24447803-24447825 GACTTCAGGAAACTGTGTCCTGG + Intergenic
1124624582 15:31300592-31300614 GACCCCTGGAGGCTGTGTCTGGG + Intergenic
1124998351 15:34745955-34745977 GACTCCTGGAAGCTGTGACCTGG - Intergenic
1126134519 15:45377927-45377949 GATTTCTGGAAAATGCGTGTGGG - Intronic
1126156095 15:45566856-45566878 GACTTCCAGCAGCTGCGTCTAGG - Intergenic
1130751375 15:86716617-86716639 GACATCTGAAAGCTGAGTATTGG - Intronic
1131340232 15:91592103-91592125 AACTTCAAGAAGCTACGTCTTGG + Intergenic
1131433630 15:92405962-92405984 GACTTCTGGAAGCTGCGTCTGGG - Intronic
1132311608 15:100861798-100861820 GAGTTTTGGAAGCCGCGGCTGGG - Intergenic
1132527874 16:426341-426363 GAGTTCTGGAAGCGGCGCTTCGG - Exonic
1134003343 16:10799875-10799897 GACTTCTGGAAAGTCAGTCTCGG - Intronic
1135135574 16:19884027-19884049 GACCTCTGGAAGAGGCGGCTAGG - Intronic
1137734098 16:50711492-50711514 GACCTTGGGAAGCTGAGTCTGGG - Exonic
1138947570 16:61870698-61870720 GACCTCTGGAGGCTGTGTCATGG - Intronic
1140043965 16:71427407-71427429 GGCTCTTGGAAGCTGGGTCTGGG - Intergenic
1140942986 16:79739624-79739646 TATTTCTGGAAGCTGTGTGTAGG + Intergenic
1141469340 16:84228179-84228201 CAGTTCTGGAAGCTCCATCTGGG + Intronic
1142855534 17:2727408-2727430 GCCTCCTGGAAGCTCCATCTCGG + Intergenic
1143029580 17:3960329-3960351 GACTCCTGCCAGCGGCGTCTTGG - Intronic
1143519573 17:7437726-7437748 GGTTTCTGGAAGCTGCCCCTGGG - Intergenic
1145800065 17:27677020-27677042 GACTTCTGGGGCCTGGGTCTGGG + Intergenic
1145945741 17:28773079-28773101 GACTTGTGGAAGTTTCTTCTTGG - Intronic
1146845468 17:36179226-36179248 GACTTCTGGAGCCTGGGTGTGGG + Intronic
1146873683 17:36391069-36391091 GACTTCTGGAGCCTGGGTGTGGG + Intronic
1146881042 17:36442157-36442179 GACTTCTGGAGCCTGGGTGTGGG + Intergenic
1147065705 17:37921804-37921826 GACTTCTGGAGCCTGGGTGTGGG - Intergenic
1150999890 17:70362855-70362877 GAATGCAGGAAGCTGTGTCTGGG - Intergenic
1151613279 17:75190997-75191019 AAATTCTGGGAGCTGGGTCTAGG + Intergenic
1152036369 17:77875555-77875577 GAATTCTTGAATCTGCCTCTGGG + Intergenic
1155365670 18:25047127-25047149 CACATCTGGAACCTGCCTCTGGG - Intergenic
1155538368 18:26841108-26841130 GACCTCTGGAAGCTGAATGTGGG - Intergenic
1155816732 18:30320825-30320847 GACTTCAGGAAGCTTCATCATGG + Intergenic
1157912447 18:51629923-51629945 GACTTCCTGAAGCTGTGTCATGG + Intergenic
1157959831 18:52140946-52140968 GGCTTGTGGTAGCTGCCTCTGGG + Intergenic
1161011270 19:1960356-1960378 GTCTTCAGGATGCTGCCTCTCGG + Intronic
1161939476 19:7393982-7394004 GACTTCAGAAAGGTGGGTCTGGG - Intronic
1163393065 19:17042236-17042258 GGGTTCTGGAGGCTGCGACTTGG + Intergenic
1163569503 19:18072323-18072345 GCCTTCTGGAAGCTCCAGCTGGG + Exonic
1163770057 19:19185793-19185815 GGATTCTGGAAGATGCCTCTGGG - Intronic
1166072721 19:40396288-40396310 GACTTTTGGCAGCTGCACCTCGG + Exonic
1167531603 19:50021154-50021176 TAATTCTGGAACCTGCGTCCTGG - Intronic
1168350642 19:55674057-55674079 GACTTCTGGTAGAGGCGGCTGGG + Exonic
1168613292 19:57818115-57818137 GACTTCCTGAAGCTGTGTCACGG - Intronic
927096658 2:19752392-19752414 GACTTCTGGAGCCTGGGTATGGG - Intergenic
929425922 2:41844723-41844745 GACTTCTGGAGGCTTCTTCCTGG - Intergenic
929843967 2:45502080-45502102 TTCCTCTGGAAGCTTCGTCTTGG - Intronic
931234381 2:60400985-60401007 TTCTTCTGGAAGCTTCCTCTGGG - Intergenic
935265458 2:101389833-101389855 GACTTCCTGAGGCTGCGTCATGG - Intergenic
938542357 2:132294857-132294879 GATTGCTGGAAACTGAGTCTAGG - Intergenic
938907471 2:135852205-135852227 GACTTCTGGAAGGTGTTACTAGG - Intronic
939056542 2:137372203-137372225 GTCTTCTGGAAGCTGAGTTAGGG + Intronic
939637243 2:144597256-144597278 GACTTCTAGAAGTTGCGAGTTGG + Intergenic
940731930 2:157402949-157402971 TTCCTCTGGAAGCTTCGTCTCGG + Intergenic
940891560 2:159041142-159041164 TTCTTCTGGAAGCTTCATCTCGG + Intronic
942294548 2:174505116-174505138 GACTTCCTGAGGCTGCGTCATGG - Intergenic
943260445 2:185653484-185653506 GACTTCTTGAGGCTGTGTCAGGG - Intergenic
945347079 2:208731465-208731487 GACTTGTGGTGGCTGGGTCTGGG + Intronic
945501974 2:210587373-210587395 GACTTTGGGGAGCTGCTTCTTGG + Intronic
947271329 2:228338723-228338745 GATTTCTGGAAACTGCCTCTAGG - Intergenic
948019545 2:234719298-234719320 GACTGGAGGTAGCTGCGTCTAGG - Intergenic
948021923 2:234740626-234740648 GACCTCTGAAAGCTGTGTCATGG + Intergenic
948332141 2:237178094-237178116 TAGTTCTGGAAGCTGGGTCAAGG - Intergenic
948429879 2:237912469-237912491 GGCTTCTGGAAGCTGCAGGTAGG - Intergenic
1174202027 20:48813249-48813271 GACCTCGGGAAGCTGATTCTTGG - Intronic
1177894583 21:26844601-26844623 GGTTTCCGGAAGCGGCGTCTCGG + Exonic
1180151627 21:45951218-45951240 TACTTCTAGAAGCTGAGTCAGGG - Intergenic
1180462707 22:15581553-15581575 GACTTCTCCAAGCTCTGTCTGGG - Intergenic
1181511775 22:23392606-23392628 GGCTGCTGGAGGCTGCGGCTGGG - Intergenic
1182127592 22:27827350-27827372 GAAGTATGGAAGCTGAGTCTTGG + Intergenic
952964513 3:38612832-38612854 GACTTCTGGAAGGAACCTCTGGG + Intronic
954398469 3:50305927-50305949 GACTTCCTGAGGCTGTGTCTTGG + Intronic
954686168 3:52371439-52371461 GACGTCTGCAAGCTGGGTCAGGG + Intronic
955424582 3:58775060-58775082 GACTTCCTGAGGCTGCGTCATGG - Intronic
957027270 3:75195987-75196009 GACTTCCAGAAGCTGTGTCATGG + Intergenic
957443129 3:80278845-80278867 GACTTCAGGAAGCTGCCTTAGGG + Intergenic
957570054 3:81935476-81935498 GACTTTTGGAAGCTGAGGCGTGG - Intergenic
961626870 3:128270099-128270121 GACCTCTGGAAGATGGGTCAGGG + Intronic
961934007 3:130564067-130564089 GACTTCTGGAAGTTGCCTTTAGG - Intronic
962814706 3:138987737-138987759 GACTTCTAGAACCTGTCTCTGGG + Intergenic
963466367 3:145687121-145687143 GCTTTCTGGAAGCTTCTTCTGGG - Intergenic
964213189 3:154250554-154250576 GACTTCTGGAAACTGGCTGTAGG + Intronic
964263845 3:154872310-154872332 GACGTCAGGAAGCAGCGTCAGGG + Intergenic
964486536 3:157190969-157190991 GACCTCTGGAGGCTGTGTCAGGG + Intergenic
975446653 4:74473418-74473440 GACTGCAGGAAGCAGGGTCTGGG + Intergenic
975687604 4:76933090-76933112 TACTTCTGAAAGCTGTGACTTGG - Intergenic
977354916 4:95933360-95933382 GACTTCCTGAGGCTGTGTCTTGG + Intergenic
979184747 4:117773585-117773607 GACTTGTAGAAGCAGTGTCTTGG - Intergenic
980270251 4:130574796-130574818 GACTTCCTGAGGCTGCGTCATGG - Intergenic
985158451 4:187018187-187018209 GACTGCAGGATGCTGCGACTAGG + Intergenic
986947710 5:13044955-13044977 GACTTCTTGAGGCTGGGTCATGG - Intergenic
988188607 5:27899914-27899936 GACTACTGGATGCTGGCTCTGGG + Intergenic
992164208 5:74032456-74032478 GCCTTCTGGCACCTGCTTCTGGG - Intergenic
992531154 5:77652959-77652981 GACTTGTGGGAGCTGCTTGTAGG - Intergenic
998106535 5:139472587-139472609 CACCTCCGGAAGCTGCCTCTGGG - Intergenic
999690096 5:154139148-154139170 GACTTCTGGAAGCTGCTGATGGG - Intronic
1000061409 5:157659649-157659671 GACTTCTTGAGGCTGTGTCACGG - Intronic
1001289625 5:170447562-170447584 GAATTCTGGATGCTGCCCCTGGG - Intronic
1010220555 6:73444901-73444923 GGTTTCTGGATGGTGCGTCTGGG + Intronic
1010719187 6:79263085-79263107 GACTGCTGTAGGCTGCTTCTGGG - Intergenic
1018723776 6:166594927-166594949 GAGATCTGGAAACTGGGTCTGGG + Intronic
1019075851 6:169387645-169387667 GACTCCAGGAAGATGTGTCTGGG - Intergenic
1020386551 7:7610822-7610844 GACTACTGGAATCTAAGTCTTGG - Intergenic
1021802130 7:24317444-24317466 GACTTCCTGAGGCTGCGTCACGG + Intergenic
1023964600 7:44956491-44956513 GTCTTCTGGAAGCTCTGTCCTGG - Intergenic
1024927451 7:54632415-54632437 GACTTCCTGAGGCTGCGTCATGG + Intergenic
1033465408 7:141584542-141584564 GACCTCTTGAAGCTGTGTCATGG + Intronic
1037541281 8:19873920-19873942 GACTTCCTGAGGCTGCGTCATGG + Intergenic
1042638533 8:70905979-70906001 TTCTTCTGGAAGCTTAGTCTTGG + Intergenic
1043070743 8:75632772-75632794 GACTTCTTGAGGCTGTGTCATGG + Intergenic
1048944190 8:139429113-139429135 GACACCTGGAAGCTGCGGTTTGG + Intergenic
1052434252 9:28406141-28406163 GATTTCTGGAATGTGCGGCTGGG + Intronic
1052894355 9:33733535-33733557 CCATTCTGGAAGCTGCGTCCTGG + Intergenic
1053350828 9:37412264-37412286 GACCCCTGGAAGCTGTGTCTTGG - Intergenic
1057856364 9:98604021-98604043 GACAGCTGGAAGCTGAGGCTTGG + Intronic
1058851331 9:109013913-109013935 GACTTCTGGAAGCTGTGCTGGGG + Intergenic
1061188733 9:129069928-129069950 GACTTCAGCAAGCTGAGGCTTGG - Exonic
1187616150 X:20995549-20995571 GACTTCCTGAAGCTGTGTCATGG + Intergenic
1195150726 X:102066985-102067007 GACTTCTTGAGGCTGTGTCATGG + Intergenic
1198853971 X:140996213-140996235 GACTTCCTGAGGCTGCGTCATGG + Intergenic
1198878042 X:141248893-141248915 GACTTCCTGAGGCTGCGTCATGG - Intergenic
1201549691 Y:15206941-15206963 GACTTCCTGAGGCTGTGTCTTGG + Intergenic