ID: 1131438070

View in Genome Browser
Species Human (GRCh38)
Location 15:92438771-92438793
Sequence AGGTACATTCTGGACATTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 141}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131438070_1131438079 7 Left 1131438070 15:92438771-92438793 CCTCCAATGTCCAGAATGTACCT 0: 1
1: 0
2: 1
3: 7
4: 141
Right 1131438079 15:92438801-92438823 ATTAAATCAATGGAGGAGAGGGG 0: 1
1: 0
2: 4
3: 28
4: 377
1131438070_1131438078 6 Left 1131438070 15:92438771-92438793 CCTCCAATGTCCAGAATGTACCT 0: 1
1: 0
2: 1
3: 7
4: 141
Right 1131438078 15:92438800-92438822 AATTAAATCAATGGAGGAGAGGG 0: 1
1: 0
2: 7
3: 55
4: 477
1131438070_1131438077 5 Left 1131438070 15:92438771-92438793 CCTCCAATGTCCAGAATGTACCT 0: 1
1: 0
2: 1
3: 7
4: 141
Right 1131438077 15:92438799-92438821 CAATTAAATCAATGGAGGAGAGG 0: 1
1: 0
2: 5
3: 23
4: 254
1131438070_1131438084 26 Left 1131438070 15:92438771-92438793 CCTCCAATGTCCAGAATGTACCT 0: 1
1: 0
2: 1
3: 7
4: 141
Right 1131438084 15:92438820-92438842 GGGGAAGAGAGGCGTGGCAGGGG 0: 1
1: 0
2: 6
3: 62
4: 697
1131438070_1131438080 15 Left 1131438070 15:92438771-92438793 CCTCCAATGTCCAGAATGTACCT 0: 1
1: 0
2: 1
3: 7
4: 141
Right 1131438080 15:92438809-92438831 AATGGAGGAGAGGGGAAGAGAGG 0: 1
1: 1
2: 30
3: 526
4: 3177
1131438070_1131438082 24 Left 1131438070 15:92438771-92438793 CCTCCAATGTCCAGAATGTACCT 0: 1
1: 0
2: 1
3: 7
4: 141
Right 1131438082 15:92438818-92438840 GAGGGGAAGAGAGGCGTGGCAGG 0: 1
1: 0
2: 2
3: 80
4: 736
1131438070_1131438074 -3 Left 1131438070 15:92438771-92438793 CCTCCAATGTCCAGAATGTACCT 0: 1
1: 0
2: 1
3: 7
4: 141
Right 1131438074 15:92438791-92438813 CCTCAAACCAATTAAATCAATGG 0: 1
1: 0
2: 4
3: 15
4: 189
1131438070_1131438075 0 Left 1131438070 15:92438771-92438793 CCTCCAATGTCCAGAATGTACCT 0: 1
1: 0
2: 1
3: 7
4: 141
Right 1131438075 15:92438794-92438816 CAAACCAATTAAATCAATGGAGG 0: 1
1: 0
2: 1
3: 18
4: 184
1131438070_1131438083 25 Left 1131438070 15:92438771-92438793 CCTCCAATGTCCAGAATGTACCT 0: 1
1: 0
2: 1
3: 7
4: 141
Right 1131438083 15:92438819-92438841 AGGGGAAGAGAGGCGTGGCAGGG 0: 1
1: 0
2: 3
3: 69
4: 805
1131438070_1131438081 20 Left 1131438070 15:92438771-92438793 CCTCCAATGTCCAGAATGTACCT 0: 1
1: 0
2: 1
3: 7
4: 141
Right 1131438081 15:92438814-92438836 AGGAGAGGGGAAGAGAGGCGTGG 0: 1
1: 7
2: 261
3: 2094
4: 6475

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131438070 Original CRISPR AGGTACATTCTGGACATTGG AGG (reversed) Intronic
901441744 1:9282310-9282332 AGGAACTTTCAGGAAATTGGTGG - Intergenic
904801303 1:33094648-33094670 ATGCACGTTCTGGACCTTGGTGG + Exonic
904994736 1:34622457-34622479 AAGAGCATTCTGGAAATTGGAGG + Intergenic
905820184 1:40983294-40983316 AAGTACATTCTGGTTACTGGTGG + Exonic
911903286 1:103531715-103531737 TTGTAGATTCTGGACATTAGTGG + Intronic
912140768 1:106723260-106723282 AGGTACATTTTACACTTTGGAGG + Intergenic
912175299 1:107148370-107148392 AGGTATATTGAGGACTTTGGTGG - Exonic
916298063 1:163242269-163242291 AGGTACATTCTTTGCACTGGTGG + Intronic
920449810 1:206051440-206051462 AGGCACTTTCTAGACACTGGGGG + Intronic
920850817 1:209626894-209626916 AGGTCCGGTCTGGACACTGGCGG + Exonic
921197922 1:212778299-212778321 AGTTACATTATGAACTTTGGGGG - Intronic
1064721457 10:18233920-18233942 AGGAACATACTGGAGATTTGAGG - Intronic
1071684956 10:87744963-87744985 AGGGACATGCTGGTCATTGTGGG - Intronic
1077790259 11:5431475-5431497 ATGTACATTGTGGCCATTGTGGG - Intronic
1078738484 11:14043919-14043941 AGGTATATTCTTGACCCTGGAGG + Intronic
1083673505 11:64313154-64313176 AGGCGGATTCTGGACCTTGGAGG + Intronic
1085190158 11:74613488-74613510 GTGTACATTTTGGAAATTGGTGG + Intronic
1085764728 11:79272882-79272904 AGGTACATCCTAGGCATTGGAGG - Intronic
1086921976 11:92597623-92597645 AGGTACATTCTGAAAAATGTAGG + Intronic
1089001493 11:115055647-115055669 AGGAAAGTTCTGGTCATTGGTGG + Intergenic
1090084245 11:123637212-123637234 AGGTACAGGCTGGACTTTAGAGG + Intronic
1090465441 11:126929282-126929304 AGCTACATTTTGGACCTGGGAGG - Intronic
1090581847 11:128169073-128169095 AGGTAAATTCTGGATATGTGGGG + Intergenic
1092760976 12:11810982-11811004 AAGAACTTTCTGGACATTGGAGG - Intronic
1093411835 12:18877216-18877238 AGGTAAAGTCTGCACCTTGGAGG - Intergenic
1097690748 12:62732370-62732392 ATGCACAGTCTGGACATTCGGGG - Intronic
1101666426 12:106819954-106819976 AGGTACATTCCTGAAATTGGTGG + Intronic
1102147362 12:110664653-110664675 AGGTACTTTCTGGACTGTGAAGG + Intronic
1104526076 12:129523959-129523981 AGATATTTTCTGGACATTGTGGG - Intronic
1105776646 13:23668192-23668214 AATGACATTCTGGATATTGGTGG + Intronic
1108445627 13:50506501-50506523 ATGTACATTCTGGTGATTTGGGG + Intronic
1111708266 13:91778652-91778674 AGGTAGATGCTAGACCTTGGAGG - Intronic
1115308978 14:31960521-31960543 AGGTAGATTCTGGAAATTACAGG + Intergenic
1115509190 14:34123362-34123384 TGGTACATTCTGGACCTTGGAGG + Intronic
1118459638 14:65976464-65976486 AGGCACATTCTGGCCCTTAGTGG - Intronic
1125892862 15:43279096-43279118 AGGTAGTGTCTGGACATGGGTGG - Exonic
1127387098 15:58475426-58475448 AGGTATATTCAGGACACTGCAGG - Intronic
1130356413 15:83134888-83134910 AGGTGCTTTCTGGACATTCTAGG - Exonic
1131438070 15:92438771-92438793 AGGTACATTCTGGACATTGGAGG - Intronic
1140889330 16:79271808-79271830 AGGTACAATATGGAGCTTGGTGG + Intergenic
1142319482 16:89371809-89371831 AGGAACATGATGGACATTGCTGG - Intronic
1149246629 17:54715722-54715744 TGGTACATCCTTAACATTGGAGG - Intergenic
1156154970 18:34290888-34290910 AGGAAGAATCTGGACATTAGAGG + Intergenic
1156364636 18:36414603-36414625 AGTTATATGCTGGACCTTGGGGG + Intronic
1157870473 18:51225824-51225846 AGGCACATGTAGGACATTGGGGG + Intergenic
1158609932 18:58930239-58930261 AGGTACATTCTGGCCAGTTAAGG - Intronic
1165981620 19:39729032-39729054 AGGTGAATTCTGCACAGTGGAGG - Intergenic
1167529690 19:50007548-50007570 AGGTACACTCTGTCCATGGGCGG - Exonic
925380725 2:3423856-3423878 GGGTACATTCAGGAAAATGGTGG - Intronic
925435363 2:3832788-3832810 AGGTATACACTAGACATTGGGGG - Intronic
931966961 2:67545322-67545344 AAGTACATTTTGGGCTTTGGGGG - Intergenic
932434369 2:71694609-71694631 AGGGACATTCTCGACCTAGGAGG - Intergenic
935601150 2:104922678-104922700 ACATACATTGTGGACATTGTGGG + Intergenic
938586385 2:132694858-132694880 AGGTCCATGCTGGAGACTGGAGG - Intronic
938926689 2:136049562-136049584 AGGTACATTGTGGTCTTTTGTGG - Intergenic
939929143 2:148210304-148210326 TGGTACATCCTTAACATTGGAGG - Intronic
944432387 2:199647137-199647159 AGGTACCACCTGGACATTGAAGG + Intergenic
945195035 2:207229622-207229644 AGCAAAATTCTAGACATTGGTGG + Intergenic
945968622 2:216214845-216214867 AGGTTCATTCTGTTCTTTGGTGG + Intergenic
946658872 2:221978267-221978289 AGGTACAATCTGGTAGTTGGTGG - Intergenic
1170601095 20:17842281-17842303 AGGTTTCTTCAGGACATTGGAGG - Intergenic
1171521895 20:25782589-25782611 AGGTTCATTCTTGACACTGCAGG + Intronic
1171554930 20:26073294-26073316 AGGTTCATTCTTGACACTGCAGG - Intergenic
1174983891 20:55427987-55428009 AGGTACTTTCTAGACATCGGAGG + Intergenic
1175956152 20:62610419-62610441 AGGCACATTCAGCACAATGGAGG - Intergenic
1176641946 21:9313400-9313422 AGGTACATTCTGTTGATTTGGGG - Intergenic
1181939687 22:26465517-26465539 AGGGATAATCTGGACATTCGGGG + Exonic
1184622614 22:45693668-45693690 AGTCACATTCTGGGTATTGGGGG - Intronic
949663304 3:6307080-6307102 TGGTACATCCTGTGCATTGGCGG - Intergenic
952903828 3:38126807-38126829 AGGGACATGCTCGACTTTGGGGG + Intronic
953232910 3:41080276-41080298 AGCTGCATTCTGGACATCAGGGG + Intergenic
954586495 3:51741272-51741294 TGGGTCATTCTGGAGATTGGAGG - Intergenic
956058838 3:65329377-65329399 AGCTACATGCGGGTCATTGGTGG + Intergenic
957871263 3:86093081-86093103 AGGTGCTTTTTGGACACTGGGGG + Intergenic
965879097 3:173366713-173366735 AACTACATTCTGAACATTAGTGG + Intergenic
1202744947 3_GL000221v1_random:91618-91640 AGGTACATTCTGTTGATTTGGGG + Intergenic
969338757 4:6527649-6527671 AGGTGCATTCTGGAAATGGCCGG - Intronic
973914018 4:55614938-55614960 AGGTACCTGCTGGAAATTTGAGG - Intronic
976239154 4:82935213-82935235 AGGTACAGTCTGGAAATTAAAGG - Intronic
977400585 4:96526201-96526223 AGTCACATTCTTGACATTGGTGG + Intergenic
979462451 4:120999493-120999515 ATGTACATTCTGTTGATTGGGGG + Intergenic
987182765 5:15385033-15385055 AGGGAGTTTCTGGACATGGGTGG - Intergenic
989574554 5:42978320-42978342 AGTTACTTTATGGAAATTGGAGG + Intergenic
991100590 5:62788186-62788208 AGGTACCAGCTGGAGATTGGAGG + Intergenic
991290031 5:65024708-65024730 AGTTACATTTTGGACATGGTAGG - Intergenic
992080029 5:73227807-73227829 AAATACATTCTGGACTTTGTAGG - Intergenic
993701144 5:91120680-91120702 AGGGAGAGTCTGGACATTCGGGG + Intronic
994211472 5:97091267-97091289 GGGTACAGTCTGGACATTTAGGG + Intronic
996183881 5:120452741-120452763 AGATATATTTTGGAGATTGGAGG + Intergenic
998296360 5:140972979-140973001 AGGTAGATTCTGTGCATTTGTGG + Intronic
1002198108 5:177512095-177512117 GAGTCCATGCTGGACATTGGAGG - Exonic
1002757330 6:174150-174172 TTGTACATTCTGGATATTAGTGG - Intergenic
1003504254 6:6726696-6726718 AATTGCATTATGGACATTGGAGG - Intergenic
1003787231 6:9500171-9500193 CGGGACATTTTGGACATTTGTGG - Intergenic
1004072018 6:12308073-12308095 AGGTACTTTCTTCACAATGGTGG + Intergenic
1006968384 6:38013747-38013769 AGGTGTAACCTGGACATTGGAGG - Intronic
1008259530 6:49347755-49347777 AGGTACCTTTTGGACCTTGCTGG - Intergenic
1009525892 6:64745951-64745973 AGGTACACTCTAGCCTTTGGAGG - Intronic
1009756410 6:67946152-67946174 AGATACTTTCAGGACATTGCTGG - Intergenic
1014885121 6:126771021-126771043 AGCAACATGCTGGACATTGAGGG - Intergenic
1026411570 7:70128270-70128292 AGGTATAGTCTGGGCATTTGAGG + Intronic
1028259168 7:88639938-88639960 AGACACATTCTTGACATTGAAGG - Intergenic
1028363008 7:89991956-89991978 TGGTAAATTGTGGACATTGAGGG + Intergenic
1028909450 7:96191752-96191774 AGGTACAGACTTTACATTGGTGG + Intronic
1029015862 7:97314949-97314971 ATAAAAATTCTGGACATTGGAGG + Intergenic
1030528772 7:110686287-110686309 AGGTACATTCAGGAAACAGGGGG - Intronic
1032117781 7:129131437-129131459 ATTTACATTCTGGACATTATTGG + Intergenic
1033277787 7:139985765-139985787 AGTTCCGTGCTGGACATTGGGGG - Intronic
1033684348 7:143624729-143624751 TGCTGCATTCTGGACAATGGGGG + Intronic
1033687524 7:143703948-143703970 TGCTGCATTCTGGACAATGGGGG + Intronic
1033700263 7:143832894-143832916 TGCTGCATTCTGGACAATGGGGG - Intergenic
1036491313 8:9228665-9228687 TGGTGCATTCTGAACAATGGAGG + Intergenic
1038737072 8:30179936-30179958 AGGTTTTTTCTGGACCTTGGTGG - Intronic
1040534374 8:48295314-48295336 AAGTACATTCTGCTCATTAGGGG + Intergenic
1041606139 8:59784515-59784537 AGGGACAGTGTGGACTTTGGAGG - Intergenic
1043150248 8:76706017-76706039 AGTTACATTTAGGACATTTGAGG - Exonic
1044707598 8:95024117-95024139 AGTTCCATGCTGGACCTTGGAGG + Intronic
1046454620 8:114441346-114441368 AGGTTCATTTTGGACCTTGGGGG - Intergenic
1047277669 8:123417788-123417810 AGGTACCTCCTGGACATCGATGG - Intronic
1047594925 8:126368561-126368583 AGGTATGTTCTGCACAGTGGAGG - Intergenic
1048221658 8:132547664-132547686 AGGGTCATTTTGGAGATTGGAGG + Intergenic
1048723936 8:137360313-137360335 AGCTATTTTCTGGACATTGTGGG + Intergenic
1051732244 9:20156727-20156749 AGATAAACTCTAGACATTGGTGG - Intergenic
1052049304 9:23826533-23826555 AGGTACACTCTTAACACTGGCGG + Intergenic
1052909417 9:33867035-33867057 AGGAATATTTAGGACATTGGAGG - Intronic
1053623044 9:39840453-39840475 AGGGGCATAATGGACATTGGAGG - Intergenic
1053881827 9:42602775-42602797 AGGGGCATAATGGACATTGGAGG + Intergenic
1053890846 9:42691516-42691538 AGGGGCATAATGGACATTGGAGG - Intergenic
1054220851 9:62410238-62410260 AGGGGCATAATGGACATTGGAGG + Intergenic
1054229863 9:62498934-62498956 AGGGGCATAATGGACATTGGAGG - Intergenic
1054879741 9:70132500-70132522 AGATACATTCTGCAAATCGGGGG + Intronic
1055158039 9:73088722-73088744 AAGTAAATTCTGCACATTGGTGG - Intergenic
1058123291 9:101162914-101162936 AAGTTCATTCTTGAGATTGGAGG - Intronic
1060043024 9:120317918-120317940 AGGAATAATCTGAACATTGGGGG - Intergenic
1060281743 9:122219777-122219799 AGGTACTTTTTGCACCTTGGAGG - Intronic
1061344329 9:130010098-130010120 AGGTACATTTTGAACATATGGGG - Intronic
1061666856 9:132165041-132165063 AGGTCCAGACTGGACATTTGGGG + Intronic
1203688433 Un_GL000214v1:18656-18678 AGGTACATTCTGTTGATTTGGGG - Intergenic
1203647842 Un_KI270751v1:85397-85419 AGGTACATTCTGTTGATTTGGGG + Intergenic
1187356691 X:18580436-18580458 AGATACATACTGGAGATTGTTGG - Intronic
1188350482 X:29124521-29124543 ATGTAGATTCTGGAGGTTGGAGG - Intronic
1188798885 X:34502028-34502050 AATTAAATTCTGGGCATTGGAGG - Intergenic
1188974719 X:36659462-36659484 AGGTAAAATCTGGGCCTTGGTGG - Intergenic
1190827777 X:54033222-54033244 AATTATATTCTGGACATTTGGGG - Intronic
1192802954 X:74484796-74484818 AGGTCCATTCTGTCCCTTGGTGG + Intronic
1194972145 X:100355737-100355759 AGGTCCCTTCTGGATATAGGAGG + Intronic
1197145612 X:123169017-123169039 AAGAAAATTCTGGACATGGGAGG + Intergenic
1197975186 X:132159613-132159635 ATGTACATTCTGTAGATTTGGGG + Intergenic
1198148626 X:133885363-133885385 ATCTACATTCTGGACACTTGAGG - Intronic
1201051819 Y:9943662-9943684 ATGTACATTCTGTTCATTTGGGG - Intergenic