ID: 1131439282

View in Genome Browser
Species Human (GRCh38)
Location 15:92446859-92446881
Sequence TGGTTGAAACAGAGTGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 513
Summary {0: 1, 1: 4, 2: 12, 3: 85, 4: 411}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131439281_1131439282 -9 Left 1131439281 15:92446845-92446867 CCAAGAGACAAATGTGGTTGAAA 0: 1
1: 0
2: 2
3: 27
4: 284
Right 1131439282 15:92446859-92446881 TGGTTGAAACAGAGTGAGCAAGG 0: 1
1: 4
2: 12
3: 85
4: 411
1131439278_1131439282 23 Left 1131439278 15:92446813-92446835 CCTTGAGGTAGGAGGGTGTGTTC 0: 1
1: 0
2: 1
3: 22
4: 164
Right 1131439282 15:92446859-92446881 TGGTTGAAACAGAGTGAGCAAGG 0: 1
1: 4
2: 12
3: 85
4: 411

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131439282 Original CRISPR TGGTTGAAACAGAGTGAGCA AGG Intronic
900080475 1:853262-853284 TGATTGAAAGATAGTGAGCTAGG - Intergenic
901369471 1:8784111-8784133 TGGTGGGAGCAGAATGAGCAGGG - Intronic
902098994 1:13969558-13969580 TGGCTGAAGCAGAGTGACTAGGG - Intergenic
902124350 1:14196148-14196170 TGGTTGGAGGAGGGTGAGCAAGG + Intergenic
902126184 1:14213560-14213582 TGGTTGAAACAGAGCCAGTGAGG + Intergenic
902185856 1:14724846-14724868 TTGATGAACCAGAGTGAGGAAGG - Intronic
903024163 1:20415413-20415435 TGGCTGCAGCAGAGTGACCAAGG + Intergenic
903296045 1:22343675-22343697 TGGCTGCAGCAGAGTGGGCAAGG + Intergenic
903320561 1:22540663-22540685 TGGCTGGAGCAGAGTGGGCATGG + Intergenic
904343488 1:29853142-29853164 GGGTTGGCACAGAGTGAGCATGG + Intergenic
904499348 1:30905225-30905247 TGCTTGAAACAGGGTGAGGAAGG + Intronic
904876901 1:33662347-33662369 TGGCTGAAGCACAGGGAGCAAGG - Intronic
906883332 1:49617159-49617181 TAGCTGAAACAGAGTGAGTGAGG - Intronic
907184311 1:52598120-52598142 TGGCTGGAGCAGAGTGAGCAAGG - Intergenic
907477470 1:54715272-54715294 GGGCTGAAGCAGAGTGAGGAAGG - Intronic
907621061 1:55981144-55981166 TTGTTGCAACAGAGACAGCATGG + Intergenic
908294305 1:62698016-62698038 CTCTTGAAACAGAGGGAGCAGGG + Intergenic
908621854 1:65990942-65990964 TGGTTGAAACATAGTAGGAAGGG - Intronic
908647053 1:66289545-66289567 TGGCTGGAACAGAGTGAGCTAGG + Intronic
908701802 1:66910388-66910410 TGGCTGAAGCAGAGTAAACAAGG - Intronic
909034432 1:70581133-70581155 TGGTAGAAGCACAGTGGGCAGGG - Intergenic
909410942 1:75350602-75350624 AGGTTGAAACAGACTGGGCCTGG + Intronic
909679063 1:78270993-78271015 TGGTTGGAACAGAGCGAGCAAGG - Intergenic
910184205 1:84518657-84518679 TGATTGAAGCAGAGAGAGTAGGG - Intergenic
910288487 1:85578803-85578825 TGGTTGAACTAGAGAGAGAATGG - Intergenic
910670182 1:89764334-89764356 TGGAAGAAACAGAGTGAACAAGG - Intronic
911830848 1:102549998-102550020 TGGTTGAAGCAGAGGAAACATGG + Intergenic
912023749 1:105140101-105140123 TGGTTGAAGTAGAAAGAGCAAGG - Intergenic
912111956 1:106354251-106354273 TGGTTTGAGCAGAGTAAGCAAGG + Intergenic
913408802 1:118527347-118527369 TGTTTGGAGAAGAGTGAGCAAGG + Intergenic
914667763 1:149845598-149845620 TGGCTGAAGCACAGTGACCAAGG + Intronic
915098259 1:153479396-153479418 TGGTGGAAGCAAAGTGAGAATGG - Intergenic
915984164 1:160446937-160446959 TGGTTGAAACTGAATCAGCACGG + Intergenic
916292329 1:163180511-163180533 TGGTTAAAACACAGAGAGCTGGG + Intronic
917037424 1:170763905-170763927 TTATTCAAACAGAGTCAGCATGG - Intergenic
917761609 1:178165848-178165870 TGGTTAAAAGACAGTGAGCAGGG - Intronic
917994734 1:180424469-180424491 TGGTTGGAACAGAGTGAAAAAGG + Intronic
918598887 1:186328786-186328808 TTGTGGAAATAGATTGAGCAAGG - Intronic
919304029 1:195807078-195807100 TGGTTGAAATACAGTGAGCAGGG - Intergenic
919673860 1:200362165-200362187 TGGCTGAAACAGAGTGAGTGAGG - Intergenic
919715369 1:200770356-200770378 TGGTGTAAACAGAATAAGCATGG - Intronic
919860037 1:201733794-201733816 TGGCTGAAGCAGAGTTAGCAAGG + Intronic
920353520 1:205353396-205353418 TAGTTGCAACAGAGAGCGCATGG + Intronic
920796962 1:209148117-209148139 CAGTTGAACCAGAGTGGGCATGG - Intergenic
921164857 1:212499648-212499670 TGGCTGGAGCAGAGTGAGCAGGG + Intergenic
921181934 1:212638169-212638191 TGGGAGAAAGAGAGTGAGCTGGG - Intergenic
921740608 1:218680575-218680597 TGGCAGAAGCACAGTGAGCATGG + Intergenic
923123020 1:231011819-231011841 TGGTGCAAACTGAGTGAGGATGG + Intergenic
923167169 1:231376910-231376932 TGGCTGGAACACAGCGAGCACGG + Intronic
923660719 1:235954824-235954846 TGGCTGCAACAGTGAGAGCATGG - Intergenic
1063120997 10:3105716-3105738 AGGCTGAGACAGAGTGAGCCTGG + Intronic
1065045055 10:21739535-21739557 TGCTTGAAACACATTGAGCAGGG - Intronic
1065068695 10:22000486-22000508 TGGCTGGAGCAGAGTGATCAAGG - Intronic
1065226785 10:23551513-23551535 TGGTGGAAACAGGGTCAGCCAGG + Intergenic
1065797620 10:29321785-29321807 GGGCTGGGACAGAGTGAGCAGGG - Intergenic
1066565935 10:36722137-36722159 TGGTTGAAACAGAGGGAAAATGG - Intergenic
1067271649 10:44796756-44796778 TGGCTGAAGCAAAGTGTGCAAGG - Intergenic
1068492633 10:57743162-57743184 TGGCTGGAACAGAGTGAGCAAGG - Intergenic
1069160202 10:65083755-65083777 GGGCTGTAGCAGAGTGAGCAGGG + Intergenic
1069163183 10:65115221-65115243 TGATTGAAACAAAGTCAGTAAGG - Intergenic
1070338718 10:75477475-75477497 TGTTTGATTCAGAGTGAGCCTGG - Intronic
1070406851 10:76104875-76104897 TGGTTGGGACAGATTGAGAAAGG - Intronic
1070539571 10:77406498-77406520 TTGTTGAAACACAGTGTGCTGGG + Intronic
1070635683 10:78125376-78125398 CAGTAGAAACAGAGTGAGGAAGG + Intergenic
1071156044 10:82690919-82690941 TGGAAGAAAGAGAATGAGCAGGG - Intronic
1071757675 10:88562463-88562485 TGGTTGGAACAAAGTGTGGAAGG + Intronic
1073172025 10:101518663-101518685 TGGCTGGAACAGAGTGAGCAAGG - Intronic
1073709698 10:106022448-106022470 TGGTTGAAGGATAGTGAGAAAGG + Intergenic
1074246401 10:111698059-111698081 AGGGTGAAAGAGAGTGAGAAGGG + Intergenic
1075282459 10:121151664-121151686 TGGCTGGAACAGAGTAAACAAGG - Intergenic
1080062839 11:27975182-27975204 TGGTTGAATGAGACTGAGAAAGG - Intergenic
1080953203 11:37061550-37061572 TGGGTGAGAAAGAGTGAGCTAGG - Intergenic
1081468328 11:43345898-43345920 TGGCTGCAGCAGAGTGATCAAGG - Intergenic
1081633460 11:44704982-44705004 TGGCTGGAAAGGAGTGAGCAAGG - Intergenic
1081659551 11:44879638-44879660 TGGCTGGAACAGGGTGAGGAGGG + Intronic
1083948740 11:65941861-65941883 TGGTTGGATCGGAGTGAGAAGGG + Intergenic
1084020004 11:66411699-66411721 TGGGTGAACCATGGTGAGCAGGG - Intergenic
1084592527 11:70098829-70098851 TGGTGGATACACAGTGGGCAGGG - Intronic
1084971808 11:72776201-72776223 TGCTGGACACAGAGTGAGGATGG - Intronic
1087216764 11:95503293-95503315 AGGTTGGAACAGAGTCACCAAGG - Intergenic
1087311913 11:96554519-96554541 TGGCTGAAGAATAGTGAGCATGG + Intergenic
1088093041 11:106065416-106065438 TGAATGACACAAAGTGAGCAAGG + Intronic
1088279854 11:108124742-108124764 TGGCAAAAGCAGAGTGAGCACGG - Intronic
1088527528 11:110772985-110773007 TGGTTGAAGCAGAGCAAGCAAGG - Intergenic
1088565249 11:111165372-111165394 TGGTTGAACCACAGTGTGCCTGG - Intergenic
1088887860 11:114021606-114021628 TGGTTAAAACACAGTGTGCAGGG - Intergenic
1089611656 11:119672720-119672742 TGGCTGGAGCAGAGTGGGCAGGG - Intronic
1091206789 11:133827036-133827058 TGGCTGCAGCAGAGGGAGCAAGG - Intergenic
1091415605 12:280453-280475 TGGTTGAAAGAGCGGGGGCAGGG - Exonic
1092072078 12:5639648-5639670 TGGCTGACACTGAGTGAGCAAGG + Intronic
1092090557 12:5800240-5800262 TGGCTGGGGCAGAGTGAGCACGG + Intronic
1092658488 12:10713469-10713491 GGTTTTAAACAAAGTGAGCAAGG + Intronic
1092836456 12:12493610-12493632 TGGCTGGAGCAGAGTGAGCATGG - Intronic
1092994917 12:13940717-13940739 TGGTAGAAAAAAAGGGAGCAGGG + Intronic
1093349544 12:18080987-18081009 TGTGTGAAGGAGAGTGAGCAGGG + Exonic
1095516310 12:43009836-43009858 TGGTAAAAACAGATTTAGCATGG - Intergenic
1095683959 12:45010990-45011012 TGGATGCATCAGAGGGAGCATGG + Intergenic
1095991706 12:48039238-48039260 TGGCTGAGGCAGAGTGGGCAGGG + Intergenic
1098158938 12:67629295-67629317 TGGCTGAAGCGAAGTGAGCAAGG + Intergenic
1098404258 12:70107788-70107810 TGGTGGCAAGAGAGAGAGCAAGG + Intergenic
1098426674 12:70372181-70372203 AGGTTGGACCACAGTGAGCAAGG + Intronic
1098445739 12:70564019-70564041 TGGCTGGAACAGAGTGAGCGAGG - Intronic
1099048800 12:77757991-77758013 TAGTTGAAGCAAAGTAAGCAAGG - Intergenic
1100554519 12:95679858-95679880 TGGCTGGAACAGAGTAAGCTGGG - Intronic
1101139685 12:101782580-101782602 TGGTGGAAATAGACTGAGGAGGG - Intronic
1101168560 12:102063905-102063927 TAGCTGAAGCAGAGTGAGCAAGG + Intergenic
1101520740 12:105479762-105479784 TTGTTGTAACAGAGGGAGCAGGG + Intergenic
1101714855 12:107301804-107301826 TGGATGCAGCAAAGTGAGCAAGG - Intergenic
1102396356 12:112589394-112589416 TGGTTGGAACTGAGAGAGTAAGG - Intronic
1103643280 12:122370216-122370238 TAGCTGAAGCAGAGTGAGAAAGG + Intronic
1103952107 12:124556997-124557019 TGGCTGAGACAGAGCGGGCAAGG + Intronic
1103995851 12:124829547-124829569 TGGCTGGAGCAGAGTGAGCGAGG - Intronic
1104002423 12:124868716-124868738 TGGCTGGAGCAGAGTGGGCAAGG - Intronic
1104054753 12:125220886-125220908 TGGCTGACAAAGAGTGAGTAAGG - Intronic
1105438200 13:20395035-20395057 TGGATGAACCACAGTGAGAACGG - Intergenic
1106657264 13:31759547-31759569 TGGCTCAAGCAGAGTGAACAGGG + Intronic
1107060653 13:36156265-36156287 TACGTGAAACAGATTGAGCAAGG + Intergenic
1107299720 13:38952702-38952724 TGGGTGAAACTGTGTGAGCTTGG - Intergenic
1107355562 13:39561828-39561850 TTGTTGAATCAGAGTGAATATGG + Intronic
1107798454 13:44079690-44079712 TGGCTGAAGCAGAGCGAGCAAGG + Intergenic
1107799200 13:44088298-44088320 TGGCTGAAGCAGAGCGAGCAAGG - Intergenic
1108038303 13:46315432-46315454 TGGCTGGAACAAAGTAAGCAGGG + Intergenic
1108355478 13:49625592-49625614 TGGGTGACACAGAGAGAGAAGGG - Intergenic
1108421904 13:50259329-50259351 TGGAGGAAACAGAGTGTGTAGGG - Intronic
1110469441 13:75842265-75842287 GGGCTGGAACAGAGTGAGTAAGG - Intronic
1110753774 13:79147007-79147029 TGGTTGAAACAGAATTAGGGAGG - Intergenic
1110812420 13:79825623-79825645 TGGTTCAAGGTGAGTGAGCAAGG - Intergenic
1111552723 13:89836641-89836663 TGGTTGGAACAAAATGAGTAAGG + Intergenic
1111716292 13:91883623-91883645 TAGCTGAAGCAGAGTGAGGAAGG + Intronic
1111930285 13:94505631-94505653 GAGTTGAAAGAGAGTGAGTATGG + Intergenic
1112138507 13:96611784-96611806 TGGCTCAGGCAGAGTGAGCATGG + Intronic
1113281742 13:108796059-108796081 TGGCTGAAGCAGTGTCAGCAGGG + Intronic
1113545257 13:111143830-111143852 TTGTTGAATGAGAGTGAGCTGGG - Intronic
1114406784 14:22464184-22464206 TGGCTGAAAAAGAGTGAAGAGGG - Intergenic
1114456325 14:22856411-22856433 TGGCTGGAACAGAATGATCAAGG + Intergenic
1114846887 14:26333188-26333210 TGGCTGGAGCAGAGTGTGCAAGG - Intergenic
1115105574 14:29757758-29757780 TGGTTTAAAGGGAGTGAGAATGG + Intronic
1115321647 14:32086216-32086238 TGATTGAAGCAGAATGAGAAAGG + Intronic
1115829123 14:37315309-37315331 TGATTGAAGTACAGTGAGCAAGG + Intronic
1115963802 14:38864725-38864747 TGGTGGAAGGAGAGGGAGCATGG - Intergenic
1116986734 14:51227854-51227876 TGGATGGAGCAGAGTGAGGAAGG + Intergenic
1119939924 14:78629418-78629440 TGGTTGAAGCAGAGTTAGGAGGG + Intronic
1120782072 14:88494286-88494308 TGGCTGGAACAGAGCAAGCAGGG + Intronic
1121960917 14:98258643-98258665 TGGTTGAAGCAGAATGAGAAAGG - Intergenic
1122492852 14:102131510-102131532 TGGCTGGAGCAGAGTGAGCAGGG - Intronic
1122735740 14:103839744-103839766 TGGCTGGAGCAGAGTGAGTAAGG - Intronic
1123100201 14:105792526-105792548 TGGTAGAAAGGGAGTGGGCAGGG + Intergenic
1123459242 15:20453937-20453959 TGGTTGAAGCAGAATGTGCAGGG - Intergenic
1123658818 15:22546481-22546503 TGGTTGAAGCAGAATGTGCAGGG + Intergenic
1124265480 15:28229774-28229796 TGGTTGAAGCAGAATGTGCAGGG - Exonic
1124312683 15:28640973-28640995 TGGTTGAAGCAGAATGTGCAGGG + Intergenic
1125011109 15:34876776-34876798 TGGTTGAAGCTTAGTGAGTAAGG - Intronic
1127745817 15:61971084-61971106 TGGCTGAAGCAGAGTGAGCAAGG + Intronic
1128280037 15:66387037-66387059 TGGTTGAGAGAGAGAGAGGAAGG + Exonic
1128352893 15:66903235-66903257 TGGTAGAAACAGAATGAGCTGGG + Intergenic
1128831867 15:70776890-70776912 TGATTGGAACAGGGTGAGAAAGG + Intergenic
1129088659 15:73124671-73124693 TGTTTTAAACAGAGTGTTCAAGG - Intronic
1129099662 15:73248413-73248435 TGGTTGAAACAGAGTGGATATGG - Intronic
1129138795 15:73578087-73578109 TGATTGGAACATAGTAAGCAAGG + Intronic
1129449460 15:75642343-75642365 TGGCTGGAGCAGAGTGGGCAAGG + Intronic
1131439282 15:92446859-92446881 TGGTTGAAACAGAGTGAGCAAGG + Intronic
1134379152 16:13708235-13708257 TGGTTGACACTGAGGGAGGATGG - Intergenic
1134692724 16:16201499-16201521 TGGCTGGAGGAGAGTGAGCATGG + Intronic
1134979121 16:18593182-18593204 TGGCTGGAGGAGAGTGAGCATGG - Intergenic
1135722569 16:24829775-24829797 TGTCTGAGACAGAGTGGGCAAGG + Intergenic
1135814643 16:25621407-25621429 TGGCTGAAATATAGTGAACACGG - Intergenic
1136044188 16:27602397-27602419 TGGCTGGAACAGACTGAACAAGG - Intronic
1136567194 16:31077528-31077550 TGCTTAGAACAGAGTGAGCAGGG - Exonic
1137753061 16:50880732-50880754 TGTTGGAAACAGCCTGAGCAAGG + Intergenic
1138653276 16:58473975-58473997 TGGCTGGAGCAGAGTGAGCCAGG - Intronic
1138697506 16:58829047-58829069 TGGTTGTGACAGAGACAGCATGG + Intergenic
1140113500 16:72022821-72022843 TAGTGGAAACAGACTGAGCCCGG + Intronic
1141011804 16:80407784-80407806 TGGGTGAGACAGAGTAAGCATGG + Intergenic
1141339270 16:83188028-83188050 TGGCTGAAGCAGAGGGAGCAAGG + Intronic
1141360924 16:83394496-83394518 TGGATGAAATAAAGTGAGAAGGG + Intronic
1141609333 16:85172204-85172226 TGTTTCAAACCGGGTGAGCACGG - Intronic
1143071570 17:4299709-4299731 TGGTTGCTTCAGAGTGGGCAAGG - Intronic
1143496678 17:7316380-7316402 TGGTTGGAACAGACTTTGCAAGG - Intronic
1145963220 17:28899634-28899656 TGGCTGGAACAGAGTGAGGGGGG - Intronic
1146634513 17:34494233-34494255 TAGTGGAAGCAGAGTGAACATGG + Intergenic
1148638662 17:49168723-49168745 TTGCTGGAACAGAGTGAGAATGG + Exonic
1149734773 17:58982763-58982785 TGGTTGAAAAGGAGTCAACATGG + Exonic
1150005370 17:61465748-61465770 GAGATGGAACAGAGTGAGCAAGG - Intronic
1150333330 17:64311982-64312004 TGGTTGAAACAGACTAATCCAGG - Intergenic
1150507718 17:65716485-65716507 TGGTTGAAAGAGACTGAGCGGGG + Intronic
1150599227 17:66636174-66636196 TGATAGAAACACAGTGAGCCTGG + Intronic
1150943203 17:69715989-69716011 TGGGTGAGAGAGAGTGAGCAGGG + Intergenic
1151284543 17:73100508-73100530 TGGATGAAGCAGAGTGAGGAAGG - Intergenic
1151985957 17:77543918-77543940 TTGTTGAAACAGAGTCAGGGTGG + Intergenic
1152097450 17:78280171-78280193 TGGTGGAAACAGGCAGAGCACGG + Intergenic
1156140420 18:34101961-34101983 TGGTTGGAACAGAATGTTCAAGG - Intronic
1156898436 18:42273141-42273163 TGATTGAAGAAAAGTGAGCAGGG + Intergenic
1157446950 18:47753304-47753326 TGGCTGGAACAAAATGAGCAGGG - Intergenic
1159807543 18:72974352-72974374 TGGCTGGAACAGAATGAGCAGGG - Intergenic
1160433163 18:78826211-78826233 CGGCTGAACCAGGGTGAGCATGG - Intergenic
1161226158 19:3146918-3146940 TGGCTGGAGCAGAGTGAGGAGGG - Intronic
1161239336 19:3213344-3213366 TGGCTGGAGCAGAGTGAGCTGGG + Intergenic
1161243053 19:3233655-3233677 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161243336 19:3235072-3235094 TGGCTGGAACAGAGGGAGCGAGG - Intronic
1161253090 19:3291727-3291749 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161257297 19:3316485-3316507 TGGCTGGACCAGAGTGAGGAGGG + Intergenic
1161257915 19:3320138-3320160 TGGCTGGAGCAGAGTGAGGAGGG + Intergenic
1161267901 19:3373442-3373464 TGGCTGGAGCAGAATGAGCAAGG - Intronic
1161274291 19:3406976-3406998 TGGCTGGAGCAGAGTGAGCGAGG + Intronic
1161289397 19:3484998-3485020 TGGCTGGAGCAGAGTGAGCCGGG + Intergenic
1161488310 19:4547815-4547837 TGGCTGGAGCACAGTGAGCAAGG - Intronic
1161503813 19:4633203-4633225 TGGCTGGAATAGAGTGAGCTAGG + Intergenic
1161599168 19:5170422-5170444 TGGCTGCAGCAGAGTGAGCCAGG + Intronic
1161623205 19:5310064-5310086 TGGCTGGAGCAGAGTGAGGAGGG - Intronic
1161625400 19:5323636-5323658 TGGCTGGAACAGAGTGAGGACGG + Intronic
1161633273 19:5370219-5370241 TGGCTGGAGCACAGTGAGCAAGG - Intergenic
1161634217 19:5377170-5377192 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161642950 19:5435715-5435737 TGGCTGGAGCAGAGTGAGGAGGG - Intergenic
1161644512 19:5444743-5444765 TGGCTGCAGCAGAGGGAGCAAGG - Intergenic
1161649338 19:5474753-5474775 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161649887 19:5477958-5477980 TGGCTGCAGCAGAGTGAGGAGGG - Intergenic
1161663815 19:5563082-5563104 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161719745 19:5896218-5896240 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161756423 19:6137447-6137469 TGGCTGCAGCAGAGTGAGGAGGG + Intronic
1161760584 19:6168176-6168198 TGGCTAGAACAGAGTGAGCAAGG - Intronic
1162110352 19:8396690-8396712 TGGCTGGAGCAGAGTGAGCCGGG + Intronic
1162370201 19:10274099-10274121 TGGCTGGAGCTGAGTGAGCAAGG - Intronic
1162543001 19:11309410-11309432 GTGCTGGAACAGAGTGAGCAAGG - Intronic
1162553137 19:11369518-11369540 TAGTTGGCACAGGGTGAGCAAGG + Intergenic
1162589807 19:11584115-11584137 TGGCTGGAGCAGAGTGAGCAAGG + Intronic
1162844455 19:13381678-13381700 TGGCTGGAACAGAGTGAGTGAGG - Intronic
1162844470 19:13381799-13381821 TGGCTGAAGCAGAGCGAGCAAGG + Intronic
1163113505 19:15175858-15175880 TGGCTGGAACAGAGTGAGTGAGG + Intronic
1164828955 19:31305695-31305717 TGCTCTAAACAGAGTGGGCAGGG - Intronic
1164860668 19:31559859-31559881 TGGCTGAAACCGAGTGAGAAAGG - Intergenic
1165746229 19:38231238-38231260 TGACTGGAGCAGAGTGAGCAGGG + Intergenic
1165771020 19:38380399-38380421 TTTTTGGAACAAAGTGAGCAGGG + Intronic
1165846057 19:38818388-38818410 AGGTGGAAACAGGGAGAGCAGGG - Intronic
1166171695 19:41032198-41032220 TGGCTGAAATAGAGTGAAGAAGG + Intergenic
1166891550 19:45997066-45997088 TGGCTGCAGCAGAGTGAGCCAGG - Intronic
1167289614 19:48617148-48617170 TGGTTGGAACTGAGTGTCCATGG - Intronic
1167531896 19:50022970-50022992 TGGCTGACTCAGCGTGAGCAAGG - Intronic
1167702061 19:51054648-51054670 TGGCTGGAGCTGAGTGAGCAAGG - Intergenic
1167970098 19:53183843-53183865 TGGCTGGAGCAGAGGGAGCAAGG + Intronic
1168311352 19:55462438-55462460 TGGCTGGAGCGGAGTGAGCAGGG - Intergenic
1168468975 19:56625645-56625667 TGGCTGAAGCAGAGTGAGCAGGG - Exonic
1168472923 19:56654334-56654356 TGGCTGGAACAGAGTGAGAAAGG + Intronic
925627238 2:5853377-5853399 TGGGTGAAAAAGAGGAAGCAAGG + Intergenic
926862894 2:17327504-17327526 TGGCTGGAGCAGAGTGTGCATGG - Intergenic
930203274 2:48564361-48564383 TGGCAGAAAGAGAGTGAGCTAGG + Intronic
930511410 2:52349908-52349930 TGGCTGCAACAGAGTGGGCAAGG - Intergenic
930559318 2:52940637-52940659 TGGTAGAAACAGAATGATAATGG - Intergenic
930870594 2:56166996-56167018 TGTTTGAGGCAGAGTGAACAAGG + Intergenic
931146717 2:59527262-59527284 TGGCTTGAGCAGAGTGAGCAGGG - Intergenic
931743072 2:65266426-65266448 TGGCTGGAGCAGAGTGAGCAAGG + Intronic
932212673 2:69945435-69945457 TGCATGGAACAGAGTGGGCAGGG - Intergenic
932933231 2:76067556-76067578 TGGTTGAAATACAGCAAGCAAGG - Intergenic
933303153 2:80565595-80565617 TGGTAGAAACAGTGTGTGCATGG + Intronic
933699455 2:85244153-85244175 TGGCTGGAGCAGAGTGGGCAAGG + Intronic
933831945 2:86218294-86218316 TGGTGGGGAGAGAGTGAGCAGGG - Intronic
935279379 2:101504568-101504590 TTGTTGAAACACAGTGGGCTGGG - Intergenic
936893998 2:117406077-117406099 TGGGTGAAGCTAAGTGAGCATGG + Intergenic
939120090 2:138105869-138105891 GGGTTGAAGCAAATTGAGCAGGG - Intergenic
939134211 2:138274419-138274441 TGGGGGAAACACAGTGAGCCAGG + Intergenic
939680753 2:145129224-145129246 TGGCTGTAATAGGGTGAGCAAGG + Intergenic
940452568 2:153858283-153858305 TGATTGAAGCAGAGTAAGAAAGG + Intergenic
941414866 2:165207302-165207324 TAGTTGAGAGACAGTGAGCAGGG - Intergenic
942363063 2:175193136-175193158 TGTGTGAAGCAGAATGAGCAAGG - Intergenic
942786337 2:179706668-179706690 GGGTTGAAACTGACTGAGCAAGG + Intronic
946261169 2:218492340-218492362 TCGTTAAAATAGAATGAGCAAGG + Intronic
946364681 2:219241623-219241645 TGGCTGGAGCAGAGTGAACATGG + Intronic
946378049 2:219325898-219325920 TGTTTGAAAATGAGTGAGAAAGG + Intergenic
947010534 2:225561380-225561402 TGGCTGGAACAGAGTGAACCTGG + Intronic
948030546 2:234814160-234814182 TGGGTAAAACAGGGTGGGCAGGG + Intergenic
1169104541 20:2983291-2983313 TGGCTGAAATTGAGTGAGCAAGG + Intronic
1170175200 20:13461038-13461060 TGGCTGGAGCAGTGTGAGCAAGG - Intronic
1170852925 20:20020469-20020491 TGGCTGGTACAGAGTGAGCATGG + Intronic
1171298868 20:24041998-24042020 TGGCTGAAACAGAGTGAGCAAGG - Intergenic
1172027961 20:31962362-31962384 TGGCTGGAACAGAGTGAGCAAGG + Intergenic
1172115144 20:32569253-32569275 TGGCTGAAGGAAAGTGAGCAGGG + Intronic
1172503036 20:35440492-35440514 GGGTTGAACCAGAGAGAGCCTGG - Intronic
1172577389 20:36019667-36019689 TGGCTGGAACAGACTAAGCAAGG + Intronic
1173164606 20:40678169-40678191 TGGCTGGAACAGAGTGAGCAAGG + Intergenic
1173367131 20:42396494-42396516 TGGTTGGAATAGAGTGAGTAAGG - Intronic
1173693595 20:44986417-44986439 TTGTTGAAACAGATTGAGCAAGG + Intronic
1174196298 20:48775053-48775075 TGGTGGAAACCGTGTGAGCAAGG - Intronic
1174222809 20:48970765-48970787 TGTGTGAAACAGAGTGAGCCAGG + Intronic
1174313949 20:49682433-49682455 TGGCTGGAACAGAGTGAGTGAGG - Intronic
1174405108 20:50297709-50297731 TGGTTGCAGCAGAGAGAGGAAGG - Intergenic
1177079390 21:16619824-16619846 TGGCTGAAGGAGAATGAGCAAGG + Intergenic
1177926696 21:27225790-27225812 TGGTAGAAACAGAAGGAGGAGGG + Intergenic
1182257414 22:29049163-29049185 TGGAGGAAACAGAGTAGGCAGGG - Intronic
1182735535 22:32530087-32530109 TGGTGGAGACATAGTAAGCAAGG - Intronic
1182874150 22:33675565-33675587 TGGGTGAAACAGGGTGAACAAGG + Intronic
1182908588 22:33959992-33960014 TGTTTCAAACAGCGTGGGCAAGG - Intergenic
1182936464 22:34227443-34227465 GGGCTAAACCAGAGTGAGCAAGG - Intergenic
1184096735 22:42320145-42320167 TGACTGGAGCAGAGTGAGCAGGG - Intronic
1184327186 22:43797825-43797847 TGGTTGAGGCAGAGGGAGCCGGG - Intronic
949371893 3:3344179-3344201 TGGTTGGAGCAGGATGAGCAAGG - Intergenic
949870335 3:8582730-8582752 TGGCTGGAGCACAGTGAGCAAGG - Intergenic
950863877 3:16173782-16173804 TGGCTGAAGCAAAGAGAGCAGGG - Intergenic
950908918 3:16567052-16567074 TGGTTGAAGTAGAGTGAGGGAGG - Intergenic
951238229 3:20259943-20259965 TGGTAGGAAGAGAGTGACCAAGG + Intergenic
952062926 3:29532398-29532420 TGGGGGAAACTGAGTGAACAGGG + Intronic
952235230 3:31472499-31472521 TGGCTGAAGCTGAGTGAGCAAGG - Intergenic
953066299 3:39474040-39474062 TGGTTGAAACACAGAGAGACAGG + Intronic
953955006 3:47225032-47225054 TGGCTGGAGTAGAGTGAGCAAGG + Intergenic
954235445 3:49253540-49253562 TGGCTGAAACATGGTGAGCAAGG - Intronic
954652091 3:52171318-52171340 TGGTTGGAGCAGGGAGAGCAGGG - Intergenic
955018566 3:55096310-55096332 TGGCTGCAGCAGAGTGAGCAAGG - Intergenic
955243876 3:57205530-57205552 TGGCTGGAACACAGTGAACATGG - Intronic
955663435 3:61325805-61325827 TGGATGAAAGAGAGGGAGTAAGG + Intergenic
955961795 3:64348301-64348323 TGGCTCAAACACAGGGAGCAGGG + Intronic
956084136 3:65591714-65591736 TGGCAGAAATAGAGTGAACAAGG - Intronic
956576692 3:70760047-70760069 TGGCTGGAGCAGAGTGAACAAGG + Intergenic
956869693 3:73404559-73404581 TGGTGGAAAGAGAGTGAGTTTGG + Intronic
956946797 3:74232493-74232515 TGGCTGGAACAGAGTGAGTAAGG + Intergenic
957854827 3:85860953-85860975 TGTCTGAAGCAGAGTGAGCTAGG + Intronic
958024920 3:88039348-88039370 GGGTAGAAACAGTGTGTGCAGGG + Intergenic
958192766 3:90204639-90204661 TGGTTAAAGCATAGTGAGCAAGG - Intergenic
958624562 3:96607320-96607342 TGGGTGCAGCACAGTGAGCATGG - Intergenic
958642256 3:96820069-96820091 TAGTGGAAACTGACTGAGCAAGG + Intronic
959501815 3:107115142-107115164 TTGTTGAAACACAGTTAACATGG - Intergenic
960104217 3:113776401-113776423 TGGATGAAATATAGTGAACAGGG - Intronic
960294591 3:115927635-115927657 TGGCCGAAGCAGAGTGAGCAAGG - Intronic
962607150 3:137042060-137042082 TGCTGGAAAAAGAGTGAGAAGGG - Intergenic
962904263 3:139787949-139787971 TGGTTGTAGCAGATTAAGCAAGG - Intergenic
964361954 3:155907913-155907935 TGGTTGGAGCAGAGTAAGCATGG + Intronic
964682829 3:159361419-159361441 TGGCTGAAGCAGAGAGAGCAAGG + Intronic
964747666 3:160027089-160027111 TGGTTAAAGCAAAGTGGGCAAGG + Intronic
965315979 3:167191063-167191085 TGGTTGAAACAGAGAAAGGTTGG - Intergenic
965537320 3:169836836-169836858 TGGCTGGAGCAGAGTGAGCCAGG + Intronic
966390409 3:179447257-179447279 AGGCTGGAAGAGAGTGAGCAGGG + Intronic
966497081 3:180593307-180593329 TGGCAGGAACAGAGTGAGCATGG - Intergenic
966605853 3:181820929-181820951 TGGCTGGAGCAGAGTGAGCAGGG - Intergenic
966723528 3:183088040-183088062 TGGCTGGAACACAATGAGCAAGG + Intronic
967188329 3:186964306-186964328 GGGTTGAAAGAGAGAGAGCGTGG - Intronic
967417759 3:189237966-189237988 TTGTTAAAAGAGAGTGAACATGG - Intronic
968675675 4:1877672-1877694 TGGCTGGAACAGAATGAGAATGG - Intronic
968768930 4:2491137-2491159 TGGTTCATTCAGTGTGAGCATGG + Intronic
969587372 4:8102163-8102185 TGGCTGAAGCAGAATGACCAAGG - Intronic
970102815 4:12544781-12544803 TGATTGAAACAGAGGGAAAAAGG + Intergenic
972202729 4:36734661-36734683 TAGTTGAAACAGAGTGCGGAGGG - Intergenic
972462350 4:39316328-39316350 TGGTTGGAGCATAGTGACCAAGG - Intronic
973027669 4:45293210-45293232 AGGTGGAAACAGAGTCAGCCAGG - Intergenic
973167658 4:47097243-47097265 TGGCTGGAGCAGAGTGAGAAAGG - Intronic
974133070 4:57780332-57780354 TGGATGCATCATAGTGAGCAAGG + Intergenic
974805628 4:66876754-66876776 TGGTAGGAATAGAGTGAGAAGGG + Intergenic
975124688 4:70768435-70768457 TGGTTGAATCATAGTCATCATGG - Intronic
975496871 4:75045239-75045261 TGGTTATAGCAGAGGGAGCAAGG + Intronic
975881169 4:78909536-78909558 TGGCTGGAATATAGTGAGCAAGG - Intronic
976347468 4:84021255-84021277 TGGCTAAGACAGAGTGAACATGG + Intergenic
976380024 4:84388594-84388616 TTCTGGAAACAGTGTGAGCAGGG + Intergenic
976447479 4:85148339-85148361 AGGATGAAACATAGTCAGCATGG + Intergenic
977163171 4:93662024-93662046 TAGCTGGAACAGAATGAGCAAGG - Intronic
977370708 4:96131292-96131314 TGGCTGAAACAAAGTGAGTAAGG - Intergenic
978312409 4:107399039-107399061 TGGCTAAAACAGAGTGAACAAGG + Intergenic
978349319 4:107804790-107804812 TCGGTGGAACAGAATGAGCAAGG + Intergenic
978515245 4:109561514-109561536 TGTTTGAAAGAGAATGAGGAAGG + Intronic
978705449 4:111703889-111703911 TTCTTGAACCAGTGTGAGCAAGG - Intergenic
978787531 4:112626458-112626480 TGGTTGGAACAGAGTGAGCAAGG - Intronic
980088940 4:128421371-128421393 TGGTGGAAACAGAGGCAGCAAGG + Intergenic
980716276 4:136634285-136634307 TGATTGAACCAGAGAGACCATGG + Intergenic
982014790 4:151142650-151142672 TGGTTGAATCAGACAGATCATGG - Intronic
982228265 4:153185394-153185416 AGGTTGAAACTGAGTAAACATGG - Intronic
982515520 4:156343593-156343615 TGGTTGAAACAAAGAGATAAAGG + Intergenic
982992276 4:162291522-162291544 TGGTGGAAATACAGTGAACAGGG + Intergenic
983671313 4:170241043-170241065 TGGCTGAAGTAGAGTGAGCAGGG - Intergenic
983819403 4:172173868-172173890 TGGCTAAAACACAGTAAGCAGGG + Intronic
986688417 5:10294133-10294155 TGGCTGCAACAGAAAGAGCAAGG + Intronic
987397216 5:17435978-17436000 TGGTTGGGACAGAGTGAAAAAGG + Intergenic
988960546 5:36366802-36366824 TGGTTGAAGCTGGGTGAGGAAGG - Intergenic
989711942 5:44409105-44409127 TAGCTGGAACAGAATGAGCAAGG + Intergenic
990046977 5:51444840-51444862 TGAAGGATACAGAGTGAGCAGGG + Intergenic
991392397 5:66160496-66160518 TGGTTGAAGCATAGTGAGTGAGG + Intronic
992498865 5:77322056-77322078 TGGGTGAGGCAGGGTGAGCAGGG + Intronic
993130045 5:83885225-83885247 GGAGTGAAACAGAGTGAGAATGG + Intergenic
994105283 5:95941065-95941087 GGGTTGAGACAGAATAAGCAAGG + Intronic
996190408 5:120533673-120533695 TGGCTGGAACAGAGGGAGCAAGG + Intronic
996485323 5:124026884-124026906 TGATTGAAGCAGAGTGAGCAAGG + Intergenic
997467808 5:134099927-134099949 GGGTTGAGACAGAGTGGGAAGGG + Intergenic
997656807 5:135561325-135561347 TGTTTGAAAAAGAGTGAGTTAGG + Intergenic
997741700 5:136260549-136260571 GGGCTGAAACAGAGTGAGTGAGG + Intronic
998102671 5:139447221-139447243 CTGTAGAAACCGAGTGAGCAGGG - Intergenic
998672659 5:144371174-144371196 TTGTTGAAGCAGAGTGAGGCAGG - Intronic
998784654 5:145695769-145695791 TGAATGACCCAGAGTGAGCAAGG + Intronic
998956201 5:147441038-147441060 TGGTTGAAAATCAGTTAGCATGG + Intronic
999632037 5:153581411-153581433 TGGCTCAAGCACAGTGAGCAAGG - Intronic
999857721 5:155613445-155613467 TGGATGGAGCAGAGTGAGCCAGG + Intergenic
1000158376 5:158574631-158574653 AGGCTGGAACAGAGTGAGCAAGG + Intergenic
1000448680 5:161357375-161357397 TGGCTGGAACAGAATGTGCAAGG + Intronic
1000986079 5:167861885-167861907 TGGATTAAAAAGAGAGAGCAAGG + Intronic
1001209503 5:169796841-169796863 TGGTTGGAACAGAGAGAGGGAGG + Intronic
1001751795 5:174137062-174137084 TGGCTGGAACTGAGTGAGCAAGG + Intronic
1001956054 5:175848908-175848930 TGGCTGAAGCAGAGTGAGCCGGG + Intronic
1003519078 6:6842198-6842220 TAAGTGAAAGAGAGTGAGCAAGG - Intergenic
1003939384 6:11009203-11009225 GGGTTGAAACAGAATGATGAGGG + Intronic
1004956262 6:20731086-20731108 TGGCTGAAACAGAGTGAATGAGG + Intronic
1005648072 6:27861031-27861053 TGGCTGGAACAGAGGGAACAAGG - Intronic
1006178350 6:32137713-32137735 TGAGTGGAGCAGAGTGAGCAAGG + Intergenic
1006459319 6:34149206-34149228 TTGTTGAAATAAAGTGAGCCTGG + Intronic
1006470784 6:34227466-34227488 TGGTTGAATGAGAGTGAAAAGGG - Intergenic
1007256007 6:40529165-40529187 TGGAAGAAGCAGAGAGAGCAGGG + Intronic
1007823410 6:44579156-44579178 AGGTTGAGACAGAGAGAGGAGGG - Intergenic
1008609750 6:53174798-53174820 TGGCTGGAGCAGAGTGAGCCAGG - Intergenic
1008928610 6:56913650-56913672 TGTTAGAAACAGAGTGCTCAAGG - Intronic
1009822803 6:68826433-68826455 TGGCTGGAGCAGAGTGATCATGG + Intronic
1010769724 6:79814514-79814536 TGGTAAAAACAGTGTGAGCCTGG + Intergenic
1012415142 6:99005013-99005035 TGGCTGGAGCAGAGTGAGCCAGG - Intergenic
1012417734 6:99027779-99027801 TGGCTGCAGCTGAGTGAGCAAGG + Intergenic
1013548448 6:111183178-111183200 TGGCAGAAGCAGAGTGGGCAAGG - Intronic
1013635404 6:112024607-112024629 TGGCTGAAATGGAGTGAGAAAGG - Intergenic
1015600158 6:134903839-134903861 TGGGTGAGACAGAGGGAGGAGGG + Intergenic
1016913027 6:149217547-149217569 TGATTGAAACAGAGACAGCATGG + Intergenic
1017132182 6:151117032-151117054 TGGTTAAAACAAGCTGAGCATGG + Intergenic
1017930080 6:158944562-158944584 ACATTGAAACAGAGGGAGCATGG - Intergenic
1018864229 6:167734950-167734972 GGGTTGCAACAGAGCGAGGAGGG + Intergenic
1019057022 6:169231362-169231384 TGGGAGAAGCAGAGGGAGCACGG + Intronic
1020909608 7:14112047-14112069 TGGTTGAAACAAAGTGAGCAAGG - Intergenic
1020963249 7:14832771-14832793 TAGTGGAAGCAGATTGAGCAAGG - Intronic
1021052734 7:16009003-16009025 TGGCTGAACCATAGTGAGCAGGG + Intergenic
1021077302 7:16320661-16320683 TACTTGAAACATTGTGAGCATGG - Intronic
1021363243 7:19743463-19743485 TGATACAAACAGAGAGAGCATGG - Intronic
1021979939 7:26044468-26044490 TGGCTGGAGCAGAGTCAGCAAGG - Intergenic
1022479764 7:30735070-30735092 TGGAAGAAACAGATTGTGCAGGG - Intronic
1023934188 7:44727498-44727520 TGGCTGGAGCATAGTGAGCAAGG + Intergenic
1024872982 7:53987484-53987506 TGCTTCAAAGAGAATGAGCAAGG - Intergenic
1026019586 7:66697071-66697093 TGGTTGACACAGAGGGAAGATGG - Intronic
1027438563 7:78193824-78193846 TGGTTGAAAAATAGTTAGGATGG - Intronic
1027602941 7:80261918-80261940 TGGTTGCAGCATAGTGAGGAAGG - Intergenic
1027814092 7:82946657-82946679 TGGTCGGAGCAGAGTGAGGAGGG + Intronic
1028205889 7:88016759-88016781 TGGTTGATAGAGACTGAGAAAGG + Intronic
1028850339 7:95530616-95530638 TGGCTGAAGTGGAGTGAGCAAGG + Intronic
1029869758 7:103677952-103677974 TAGTTGGACCAGAGAGAGCAGGG - Intronic
1030603750 7:111617183-111617205 TGAGAAAAACAGAGTGAGCAAGG - Intergenic
1030831449 7:114227217-114227239 TGGTGGAATCATTGTGAGCATGG + Intronic
1030977779 7:116148196-116148218 TGGATGGAACCCAGTGAGCAGGG + Intronic
1031080923 7:117256226-117256248 TTGTTTAGAAAGAGTGAGCAAGG + Intergenic
1031150692 7:118050566-118050588 TGATTGGCACAGAGTAAGCAAGG - Intergenic
1032445138 7:131975889-131975911 TGGATGGAGCAGAGTGAACAAGG - Intergenic
1033871432 7:145758735-145758757 TGGCTGAAGCTGAGTGAGTAGGG - Intergenic
1033998541 7:147384143-147384165 TGGCTGAAACATGGTGACCAAGG + Intronic
1034913703 7:155019377-155019399 TGGTTAAAACAGGCTGGGCATGG - Intergenic
1034915139 7:155032679-155032701 TCTTTGAAAGAGATTGAGCAGGG + Intergenic
1037269330 8:17108897-17108919 TGGTTGGTGCAGAGTGAGCTAGG - Intronic
1037924384 8:22833025-22833047 TGGGTGAGACAGGGTAAGCAGGG - Intronic
1038576892 8:28712267-28712289 TGGCTGAAGCTGAGAGAGCAAGG + Intronic
1039615240 8:38950399-38950421 TGCTGGAAACAGAGTGGGCAGGG - Intronic
1039719892 8:40151893-40151915 TGGTCAGAGCAGAGTGAGCAGGG - Intergenic
1039907042 8:41794281-41794303 TGGTTGAAGCAGAGTGAGGCAGG - Intronic
1041863148 8:62536969-62536991 TTGTTGAAACTCAGGGAGCAGGG + Intronic
1042973684 8:74439753-74439775 TGGTTTAAAGAGAGTGATAATGG - Intronic
1043199281 8:77344147-77344169 TGGGTGAAACAGAGAGTGTAAGG - Intergenic
1044003892 8:86918192-86918214 TGGTTGTAGCATAGTTAGCACGG + Intronic
1044130534 8:88518143-88518165 TGGTTAGAACAGAGTGAGCAAGG - Intergenic
1044230627 8:89773446-89773468 TGGCTGGAATACAGTGAGCAAGG + Intronic
1044287677 8:90428048-90428070 TAGCTGGAACAGAGTCAGCAAGG + Intergenic
1044576287 8:93773268-93773290 TGGCTGGAGCAGAGTGAGCAGGG + Intronic
1044693550 8:94901201-94901223 TGGCTGGAACGTAGTGAGCAAGG + Intronic
1045152969 8:99429956-99429978 TGGCTTCAGCAGAGTGAGCAAGG - Intronic
1045706268 8:104926625-104926647 TGGAAGCAACAGAGTTAGCATGG + Intronic
1045831622 8:106468537-106468559 TGGTGGAAAGAGAGTGAACAAGG + Intronic
1046635403 8:116669900-116669922 TGGTAGAAGCAGAGTGTGTAGGG - Intronic
1046823502 8:118661575-118661597 TGGCTGGAACAGAGAGAGTAAGG + Intergenic
1047171062 8:122492626-122492648 TGGCTGCAGCAGAGTTAGCAAGG + Intergenic
1047367884 8:124228983-124229005 TGGCTGGAGCAGAGTGAGCTTGG + Intergenic
1047544915 8:125806311-125806333 TGGTTGTAACAGAGAGTGTATGG + Intergenic
1049137470 8:140916367-140916389 TGGCTGGAACAGAGTGAATACGG - Intronic
1049169121 8:141147502-141147524 TTGTGGAAACAGCGTGTGCAAGG - Intronic
1049719903 8:144111002-144111024 TGGTGAGGACAGAGTGAGCAAGG + Intronic
1049760543 8:144330253-144330275 CGGTTGGACCAGAGTGGGCAGGG - Intergenic
1050151122 9:2621036-2621058 TGTTTGAAAGAGAGTGCGCGCGG - Intergenic
1050694845 9:8267147-8267169 TGGCTGAAACAGAATGTGAAAGG + Intergenic
1050760587 9:9065262-9065284 TGTTTGAAATAGAGAGATCAGGG + Intronic
1051056199 9:12989934-12989956 TGGTTAGAACAGAGTGAGTGAGG + Intergenic
1051358551 9:16262081-16262103 TGGTTAATAAAGACTGAGCACGG - Intronic
1052030109 9:23618936-23618958 TTGCTGGAGCAGAGTGAGCAGGG - Intergenic
1054742755 9:68825352-68825374 TGGTGGAAACCGAGTGAACAGGG - Intronic
1055315036 9:75026565-75026587 TAGTAGTAACAGAGGGAGCAAGG - Intronic
1055350601 9:75382870-75382892 TGGTTGAGACAGAGTGAGCAAGG + Intergenic
1057775798 9:98008284-98008306 TTTTTGAAAGAGAGTGAGCCAGG + Intronic
1057953755 9:99390933-99390955 GGGTTGCAGCTGAGTGAGCAAGG + Intergenic
1058478767 9:105369502-105369524 ATGTTGAAACATAGTCAGCAAGG - Intronic
1058982894 9:110186637-110186659 GGGTTTCAAGAGAGTGAGCAGGG + Intergenic
1059189490 9:112310909-112310931 TGGCTGAAAGAGAATGAGCAAGG + Intronic
1059406601 9:114102144-114102166 TGGTTGGAACACAGTTAGCAAGG + Intergenic
1060960978 9:127680455-127680477 TGGCTGATGCAGAGTGAGCGAGG - Intronic
1061455743 9:130696271-130696293 GGGTTGGAACAGAGTGAGTGAGG + Intronic
1061726253 9:132583451-132583473 TGGTGGAGACAGTGTGGGCAGGG + Intronic
1062441980 9:136574618-136574640 TGGTTAAAACAGAGTGATACTGG - Intergenic
1185908471 X:3960108-3960130 TGGTCAAAACAGAGTGAGTGGGG + Intergenic
1186981680 X:14963890-14963912 TAGTTGCAACAAAGAGAGCATGG - Intergenic
1187002069 X:15192244-15192266 TGGATGAAACAGAGTGTCTAGGG - Intergenic
1187265337 X:17726846-17726868 TGGATAAACCAGAGTGAACAAGG + Exonic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1187549522 X:20287952-20287974 TGGCTGAAGCAGAGACAGCAAGG - Intergenic
1187731379 X:22258642-22258664 TGGCTGGAGCAGAGCGAGCAAGG + Intergenic
1188583567 X:31745236-31745258 TGGTTGAGAAAGAGTGGGAAGGG + Intronic
1189012182 X:37056880-37056902 TGGATGCAACAGAGAGAACACGG + Intergenic
1189012559 X:37060990-37061012 TGGTTGAGATAGAATGAGGAGGG + Intergenic
1189036529 X:37499403-37499425 TGGATGCAACAGAGAGAACACGG - Intronic
1189044382 X:37574749-37574771 TGGTTGAAGAAGAATGAGCAAGG - Intronic
1189942734 X:46142720-46142742 TGGTTGATAAAGCGTGGGCAGGG + Intergenic
1190216093 X:48480402-48480424 TGGTTGGAACAGAGTGAGGGGGG + Intronic
1190389017 X:49913065-49913087 TGGTGGAAACAGTATGAGCGAGG + Intergenic
1191135997 X:57066327-57066349 TGGCTGGAGCTGAGTGAGCAAGG - Intergenic
1192223550 X:69213462-69213484 TAATTGGAACAGAGTGAGTAAGG + Intergenic
1192322081 X:70098119-70098141 TGGCTGGAGCAGAGTGAACAAGG + Intergenic
1193331254 X:80237847-80237869 TGGTTGGTCCAGAGTGTGCAAGG + Intergenic
1194643675 X:96432044-96432066 TGGCTGGAACATAGTGAGGAAGG - Intergenic
1195005013 X:100677277-100677299 TGGTTGAAGCATAGTGAGCAAGG + Intronic
1195122048 X:101764660-101764682 TGGTTGAAGCACAGGGACCAAGG + Intergenic
1195661252 X:107380888-107380910 TGATTGGAGCAGAGTAAGCAAGG + Intergenic
1196236032 X:113281403-113281425 TGGTTGGAATAGAGTGATCAAGG + Intergenic
1199069214 X:143457025-143457047 TGTTTGACTCAGAGTCAGCAAGG + Intergenic
1199392736 X:147299835-147299857 TGGTTAGAACAGGGTGAACAAGG - Intergenic
1199965171 X:152814071-152814093 GGGTGGAAAGAGAGTTAGCATGG - Intergenic
1200259262 X:154603508-154603530 TGGCTGCATCAGCGTGAGCAAGG + Intergenic