ID: 1131439449

View in Genome Browser
Species Human (GRCh38)
Location 15:92447955-92447977
Sequence CTGGAGTCCTTGGGGATAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 211}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131439442_1131439449 10 Left 1131439442 15:92447922-92447944 CCTTCCTAGAAGGAGGAAACTCT 0: 1
1: 0
2: 2
3: 18
4: 190
Right 1131439449 15:92447955-92447977 CTGGAGTCCTTGGGGATAAGAGG 0: 1
1: 0
2: 3
3: 18
4: 211
1131439443_1131439449 6 Left 1131439443 15:92447926-92447948 CCTAGAAGGAGGAAACTCTTGAG 0: 1
1: 0
2: 0
3: 33
4: 323
Right 1131439449 15:92447955-92447977 CTGGAGTCCTTGGGGATAAGAGG 0: 1
1: 0
2: 3
3: 18
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131439449 Original CRISPR CTGGAGTCCTTGGGGATAAG AGG Intronic
900685429 1:3945069-3945091 CTGGAGTCCCTGGGGGGATGGGG + Intergenic
904221447 1:28973301-28973323 CTGGTGTCCTTGGGGATATTGGG + Intronic
904287336 1:29461019-29461041 ATGGTGGCCTTGGGGAAAAGGGG + Intergenic
904537170 1:31207556-31207578 CTGGGCTGCTTGGGGATGAGTGG - Intronic
904701881 1:32362593-32362615 ATGAAGTCCTTGGGGAGAAAAGG + Exonic
904752921 1:32752306-32752328 CTGGAGCCATCGGGCATAAGAGG + Intronic
905947266 1:41914055-41914077 CTGGAATTCTTGTGGATAAAGGG - Intronic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
908762606 1:67525927-67525949 CTGGAGACCTGAGGGAGAAGTGG + Intergenic
909019020 1:70411060-70411082 CTGGAGTCCCTGGGTCCAAGTGG - Intergenic
911823579 1:102450519-102450541 ATGGAGAGGTTGGGGATAAGGGG + Intergenic
913515373 1:119601005-119601027 CAGGAGTTCAAGGGGATAAGGGG + Intergenic
915840755 1:159211186-159211208 CTGGAGGACTTAGGGAGAAGAGG - Intergenic
916074732 1:161193787-161193809 CTGGGGTCCTTGGGGACCATGGG - Exonic
917293692 1:173496302-173496324 CTGGACTCCTTGGGAAAAATAGG + Intergenic
922793463 1:228323780-228323802 CTGGAGCCCCTTGGGGTAAGGGG + Intronic
923084773 1:230694939-230694961 CTGGAACCCGTGGGGATAAATGG + Intergenic
924181510 1:241443462-241443484 CTGGAGACAATGGGGATAATGGG + Intergenic
1063726965 10:8647851-8647873 CTGGGGTCCTTTGGGATGAACGG - Intergenic
1064323459 10:14327701-14327723 ATGGAGTCATCGGGGCTAAGGGG - Intronic
1065466434 10:26028805-26028827 CTAGAGTCCTAGGGGAAATGTGG + Intronic
1065816156 10:29484647-29484669 CAGGAGTACCTGGGGATAAGCGG + Exonic
1066253394 10:33655565-33655587 CTGGAGTTCTTGAGGAAAGGAGG - Intergenic
1066536195 10:36394854-36394876 CTGGAGACTTTGGGGAGAAATGG + Intergenic
1069937162 10:71925442-71925464 GTGGTGTCCCTGGGTATAAGGGG + Intergenic
1069952969 10:72032322-72032344 CTGGAGTCCTGGGGCCTGAGAGG - Intergenic
1070773827 10:79098479-79098501 CTAGAGTCCTTCGAGATAGGTGG - Intronic
1071836512 10:89423678-89423700 CTGGAGTCCTGGGAGAAAAGGGG - Intergenic
1073069844 10:100786534-100786556 CTGAGGTCTTTGGGTATAAGGGG + Intronic
1073196155 10:101694188-101694210 ATGGAGGCCTTGGGGAGGAGGGG + Intronic
1076745773 10:132512778-132512800 CCTGGGTCATTGGGGATAAGAGG - Intergenic
1077484869 11:2833997-2834019 CTGCACTCCTTGTGGCTAAGTGG - Intronic
1078817001 11:14835235-14835257 CAGTAGAACTTGGGGATAAGTGG - Intronic
1079902460 11:26204311-26204333 GTGTTGTCCTGGGGGATAAGTGG - Intergenic
1082808496 11:57464442-57464464 CTGGTGAGCTTGTGGATAAGGGG + Intronic
1084005747 11:66322720-66322742 CTGGAGGCCATGGGGAAGAGAGG + Intergenic
1084721189 11:70906713-70906735 CTGGGGTCTTTGGGCATCAGTGG - Intronic
1088359389 11:108975099-108975121 CTGGTGTCATTGGGGAGACGTGG + Intergenic
1090188356 11:124752378-124752400 CTTCAGACCTTGGGGAGAAGAGG - Intergenic
1090249968 11:125244401-125244423 CTGGAAGGGTTGGGGATAAGGGG - Intronic
1091139146 11:133220490-133220512 CTGGAGTCCTGGGGAGTCAGAGG + Intronic
1092254518 12:6919011-6919033 CTGGAGCCCTTGGGAATACTGGG + Intronic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1097298479 12:57992832-57992854 TTGGAGTGTTTGGGGATAATGGG + Intergenic
1097952294 12:65445306-65445328 CTGGAGGGATTCGGGATAAGAGG - Intronic
1098998266 12:77146969-77146991 TTGGAGTCATTGGGATTAAGAGG + Intergenic
1101188549 12:102307063-102307085 CTGGATTCCTTGGGAAAAACAGG + Intergenic
1103262275 12:119597676-119597698 CTGGGGTCCTGGGGGTTAGGAGG + Intronic
1104281432 12:127381463-127381485 CTGGAGTGCCCTGGGATAAGGGG + Intergenic
1104365541 12:128173299-128173321 CTGGAGTCCTGGAGGAGATGTGG - Intergenic
1105071233 12:133235603-133235625 CAGGAGTCCCTGAGGGTAAGGGG - Exonic
1105628924 13:22141703-22141725 ATGGAGTCCTGAGGGACAAGGGG + Intergenic
1111771310 13:92599666-92599688 CTGGCTTCCTTGCTGATAAGCGG + Intronic
1114246328 14:20917956-20917978 CTGGAGTCCTTAGGTAAATGTGG - Intergenic
1116252608 14:42506111-42506133 CTGGAGTCCTTGGTGGAAAATGG - Intergenic
1116626592 14:47272591-47272613 CTGGAGTACTAGGGAAAAAGTGG - Intronic
1120498023 14:85260417-85260439 CTGGAATCCTGAGGGAGAAGAGG + Intergenic
1120666189 14:87309428-87309450 CTGAAGTCATTGGTGATATGTGG - Intergenic
1120760579 14:88281113-88281135 CTGGAGTCCAGAGGGAAAAGGGG - Intronic
1121820844 14:96964632-96964654 CTGGTGTCCATGGGAACAAGGGG - Intergenic
1122634051 14:103122109-103122131 CTGGAGTCCTAGGAGAGAAGGGG + Intergenic
1202903314 14_GL000194v1_random:55324-55346 CTGGGGTCCCTCGGGATAAGTGG + Intergenic
1127431511 15:58914517-58914539 GTGGAGTCCTTGGGGAGCAGGGG + Intronic
1128209738 15:65888000-65888022 CTGCAGTCATTCGGGACAAGTGG - Exonic
1129681807 15:77662375-77662397 CTGGAGCCCTTGGGGATGAGGGG + Intronic
1130892883 15:88148604-88148626 GAGGAGTGCTTTGGGATAAGGGG + Intronic
1131293921 15:91130710-91130732 CTGCAGTCCTGGGGGCAAAGAGG + Intronic
1131439449 15:92447955-92447977 CTGGAGTCCTTGGGGATAAGAGG + Intronic
1132192947 15:99884718-99884740 CTGGCTTCCTTGCTGATAAGGGG - Intergenic
1135171421 16:20187283-20187305 CTGGAGTTCTTAGGGCTGAGAGG - Intergenic
1135723919 16:24839938-24839960 TTGGAGTCCTTGGTGTTAAGAGG - Intergenic
1136084708 16:27876687-27876709 CTGGAGGCCTGGGGGCCAAGGGG - Intronic
1141688827 16:85585269-85585291 CTGGAGCCCTTGGGGACCAATGG - Intergenic
1142210835 16:88807741-88807763 CTGCAGTCCTTGGTCAGAAGGGG + Intronic
1143153752 17:4822925-4822947 CCTCAGTCCTTGGGGTTAAGGGG - Exonic
1144726459 17:17504895-17504917 CTGGAGTCCTGGGGGCTGAGGGG + Intergenic
1145127426 17:20313904-20313926 CTGAAGTCCTTGAGGGGAAGGGG + Intronic
1145832308 17:27926523-27926545 CTGAAGTATTTGGGAATAAGGGG + Intergenic
1145902630 17:28498322-28498344 CTGGAGTCCATGAGGATGTGGGG - Intronic
1146307477 17:31741700-31741722 CTGGAATATTTGGGGATAACTGG - Intergenic
1146624988 17:34428253-34428275 CAGGAGTCCTGGGAGGTAAGGGG - Intergenic
1148107493 17:45127234-45127256 CTGGAGGCCATGGGACTAAGGGG - Intronic
1149610963 17:57957418-57957440 CTGGAGCCCTGGGGGCTCAGAGG - Intergenic
1150101044 17:62423931-62423953 CTGCAGTCCTCGCCGATAAGAGG + Exonic
1151708565 17:75785863-75785885 CAGGAGCCCATGGGGATGAGAGG - Intronic
1152467312 17:80473686-80473708 CTGGCATCCTTGGGGAGATGGGG + Intronic
1153996645 18:10447877-10447899 CAGGAGTCTCTGGGCATAAGAGG - Intergenic
1155183826 18:23370640-23370662 CTGTAGTCCTGGGGGAAAAACGG - Intronic
1159652784 18:70997349-70997371 CTGGAGTACTCAGGGATAGGAGG + Intergenic
1162013383 19:7830883-7830905 CTGGTCTCCTTGGGGAGAGGTGG - Intronic
1162114512 19:8420614-8420636 CTGGAGGCTTTGAGGGTAAGAGG + Intronic
1162140649 19:8583731-8583753 CTGTAGTCCTTGGGGAGACTTGG + Intronic
1162338080 19:10073859-10073881 CTGGTGCCCCTGGGGATATGGGG - Intergenic
1162796597 19:13090473-13090495 CTGGAGTCCTTGGGGCTAACAGG + Intronic
1163701986 19:18790703-18790725 AGGGAGTCCTTGGCGAAAAGAGG - Intronic
1163731807 19:18953951-18953973 CTGGAGTCCTGTGGGAGGAGGGG + Intergenic
1165988345 19:39790290-39790312 CTGGGGTCATTGGGGGTAAAGGG + Intergenic
1166965673 19:46528268-46528290 CCGGGGTCCTGGGGGGTAAGGGG + Intronic
1167144453 19:47673434-47673456 CTTGAGTCCATGGGGATAGATGG - Intronic
1167263169 19:48470150-48470172 CTTGAGTCCTGGGGGACAAGGGG - Intronic
1167342143 19:48922254-48922276 CTGGGGTCCTGGGGGAGGAGGGG + Intronic
1167696804 19:51019732-51019754 CCGGACTCCTTGGGGTTAAAAGG - Intronic
1167743981 19:51340381-51340403 AGGGGGTCCTTGGGGAGAAGCGG - Intronic
1167793064 19:51692564-51692586 CTGGGTTCCTTGGGGAGGAGGGG + Intergenic
1168423065 19:56217724-56217746 CTGCAGTCCTTGGGGAAGCGGGG + Intergenic
925352139 2:3208872-3208894 CTGGAGGCCTTGTGGGGAAGAGG - Intronic
927510184 2:23639469-23639491 CTGGAGTCCTTGAGTAGCAGAGG - Intronic
927785650 2:25972627-25972649 CTGGTGTCCTTGGGGACATGTGG + Intronic
927910567 2:26895715-26895737 CTGGAGTAGTTGGGGTAAAGGGG - Intronic
928682660 2:33718229-33718251 CTGGACACTTTGGGGATAGGAGG - Intergenic
928699860 2:33887710-33887732 TTGGAGTCCTTCTGGTTAAGAGG + Intergenic
929019625 2:37538691-37538713 CTGAAGTCCTTGAGAAGAAGGGG + Intergenic
930165005 2:48196174-48196196 CTGGGGTCCTAAGAGATAAGAGG + Intergenic
930762617 2:55051581-55051603 CTGGAGGCCCTGGAGAGAAGAGG + Intronic
931826580 2:66006597-66006619 CTGAAGGCCTTGGAGACAAGAGG + Intergenic
931937966 2:67219148-67219170 GAGGAGTTCTTGGGGACAAGTGG - Intergenic
932160897 2:69458542-69458564 CTGGAGTTCTTCGCGATAAAAGG - Intronic
933614278 2:84468399-84468421 CTGGACTCCTTGGGGTAAACAGG - Intergenic
934503350 2:94875074-94875096 CTGGGGTCCCTCGGGATAAATGG - Intronic
937303346 2:120856652-120856674 CTGCAGTCCCTGGAGATTAGGGG - Intronic
937851932 2:126643620-126643642 CAGGAGTCCATGGGGACATGGGG + Intergenic
942319188 2:174721296-174721318 TTGGTGTCCTTGGGGACATGGGG - Intergenic
948727453 2:239943843-239943865 CAAGACTCCTTGGGGATGAGGGG + Intronic
948788154 2:240363789-240363811 CTGCTGTCCTTGGGGAGATGTGG - Intergenic
1169425415 20:5493041-5493063 CTGAAGTCCTTGAGGATACCTGG - Intergenic
1172467749 20:35169006-35169028 CTCGAGTCCTTGTGCATATGTGG - Intergenic
1173875409 20:46367391-46367413 CTGGGCTCCTTGGGGATGGGGGG + Exonic
1174453010 20:50631247-50631269 CTGGAGCCCTTGAGGATGGGGGG - Intronic
1175638147 20:60602673-60602695 CTGGAGTGCTGGGGGTGAAGGGG + Intergenic
1175820717 20:61907395-61907417 CTGCAGTCCTTGGGTGTGAGAGG - Intronic
1176622679 21:9070092-9070114 CTGGGGTCCCTCGGGATAAGTGG + Intergenic
1177009607 21:15716095-15716117 CTGCAGTCCTTGGGGATGTATGG + Intergenic
1177626275 21:23664666-23664688 CTGGAGTACCTCGGGATTAGGGG + Intergenic
1179597578 21:42453096-42453118 CTGTCGGCCTTGGGGATGAGGGG - Intergenic
1181592474 22:23893965-23893987 CTGGAGCCCTTGAGGACATGTGG + Intronic
1182841707 22:33395956-33395978 TTAGAGTCCTGGGGGAAAAGGGG - Intronic
1184409896 22:44320375-44320397 CAGCAGGCATTGGGGATAAGTGG + Intergenic
949507806 3:4743266-4743288 CAGGAGTCCTTGAGGATTATTGG + Intronic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950364723 3:12474896-12474918 CTGGAGGCCTGGGGGCTGAGAGG - Intergenic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
951109654 3:18786793-18786815 CTGGAGTCTTTGGGGTAAAGGGG - Intergenic
952404365 3:32992392-32992414 CTGGAAACCTGGGGGACAAGAGG - Intergenic
952990915 3:38829855-38829877 CTGAAGCCCTGGGAGATAAGTGG + Intergenic
954622111 3:52002266-52002288 ATGGAGTCCTTGGGCATGACTGG + Intergenic
955410656 3:58653485-58653507 GTGGAGTCCATGGGGAACAGAGG - Intronic
956937083 3:74115243-74115265 TTGGAGTCCTTGAGGATACAGGG - Intergenic
960208877 3:114935768-114935790 CATGAGGCCTTGGGGGTAAGAGG - Intronic
962834857 3:139181135-139181157 CTGGAGTCCTTGGGAAGTATGGG + Intronic
963495400 3:146053163-146053185 GTGGAGACTGTGGGGATAAGGGG + Intergenic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
965710050 3:171548159-171548181 CTGGAGTCTCTGGGTATCAGAGG - Intergenic
968380978 4:95546-95568 CTGGAGTCCTTGGTCAGAGGAGG - Intergenic
968600683 4:1507886-1507908 CAGGAGTCCATGTGGAAAAGTGG - Intergenic
969422487 4:7105393-7105415 CTGGAATCCGAGGGGATCAGGGG - Intergenic
971431812 4:26576427-26576449 CTGCAGCCCCTGGGGAGAAGGGG - Intronic
972818986 4:42677212-42677234 CTGGACTCCTTGGGAAAAATGGG + Intergenic
975389659 4:73801999-73802021 CTGGAGGCCGCGGGGATAGGGGG - Intergenic
978066698 4:104413297-104413319 CTTGAATCCTTGGGTATAAGAGG + Intergenic
981836194 4:149057281-149057303 CTGAACTCTTTGGGAATAAGAGG + Intergenic
984949645 4:184997408-184997430 CTGGAGACCGTGGGGATGAGAGG + Intergenic
987335906 5:16897676-16897698 ATGGAGGCCGTGGAGATAAGTGG - Intronic
989506787 5:42235558-42235580 CTGCACTCTTTGGGGATAGGTGG - Intergenic
991134482 5:63165344-63165366 CTCTGGTCCTTGGGGAGAAGTGG + Intergenic
996293391 5:121881402-121881424 CTTGAGTCCTTGGTTATAAGTGG + Intergenic
998410853 5:141910210-141910232 ATGGAAGCCATGGGGATAAGGGG - Intergenic
999641557 5:153678174-153678196 TTGGGCTCCTTGGGGAGAAGAGG + Intronic
1003042195 6:2698832-2698854 CTGAAGTCCTGGGTGATAAAAGG + Intronic
1003146273 6:3513012-3513034 CTGGTGGCCTGGGGGATAACTGG + Intergenic
1004401902 6:15296609-15296631 CTGAAGTATTTGGTGATAAGGGG - Intronic
1004765243 6:18719610-18719632 TTGAAGTCATTGGGAATAAGAGG - Intergenic
1006813845 6:36838076-36838098 CTTGAAGACTTGGGGATAAGTGG - Intronic
1007302051 6:40874965-40874987 CTGGAGCCCCTGGTCATAAGTGG - Intergenic
1008157715 6:48037383-48037405 CTGCATCCCTTGTGGATAAGCGG + Intronic
1010921137 6:81682698-81682720 GTGGAGTCTTTGGAGAAAAGGGG - Intronic
1014698605 6:124655548-124655570 CTGGTGTGCTTGGGACTAAGGGG + Intronic
1016838043 6:148498779-148498801 CTGGGGAAGTTGGGGATAAGAGG + Intronic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1019345253 7:526599-526621 CTGAAGCCCTTGGGGATGGGAGG - Intergenic
1019514727 7:1434665-1434687 CTGGAGGCCTAGGGGACAGGTGG + Exonic
1021500240 7:21324650-21324672 CTGGAGAACTTGGGGATACTTGG + Intergenic
1021898195 7:25257337-25257359 CTCCACTCTTTGGGGATAAGTGG + Intergenic
1022677848 7:32516508-32516530 CTGGATTACTAGGGGCTAAGTGG + Intronic
1023022006 7:36019129-36019151 CAGGAGTCCTTGGGGCTTAGGGG + Intergenic
1023396817 7:39759242-39759264 CTTGAGTCCTAAGGGAGAAGAGG - Intergenic
1024675479 7:51634391-51634413 CTGGAGTCCTCTTGGCTAAGAGG + Intergenic
1024750528 7:52459932-52459954 CTGGACTTTTTGGGGGTAAGTGG - Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1027539828 7:79453347-79453369 CTGGGCTCCTTGGGGTTAGGGGG + Exonic
1030363889 7:108624697-108624719 GTGGAGCCCTTGGGGGAAAGGGG + Intergenic
1032121541 7:129160492-129160514 CTGGAGGCCTGGGGGCTAGGGGG + Intronic
1034679245 7:152915970-152915992 GTGGAGCCCTTGGTTATAAGTGG - Intergenic
1040999029 8:53431465-53431487 CTGGAGTGCTTGGGAAAATGTGG - Intergenic
1041170066 8:55132324-55132346 GTGTATTCCTTGTGGATAAGGGG - Intronic
1041184657 8:55286487-55286509 CTGGCTTCCTAGGGGATACGGGG + Intronic
1044514969 8:93127169-93127191 CTGGGGTGCGTGGGGATATGTGG + Intergenic
1045227005 8:100258176-100258198 CTTGAGGCTTTAGGGATAAGTGG - Exonic
1048233148 8:132663656-132663678 CTGGAGTCCATGGGGCCAGGAGG + Intronic
1048829504 8:138462546-138462568 CTGGAGTCACTGGGGAGAGGAGG + Intronic
1049154728 8:141059641-141059663 CAGGAGTCCTTGAGCCTAAGTGG + Intergenic
1049273341 8:141707678-141707700 CTGGAGTTCCTGGGGTTGAGGGG - Intergenic
1049629213 8:143643244-143643266 CTGGAGGCCCTGGGGAAAACTGG - Intronic
1050265004 9:3880694-3880716 CTGGAGAGGTTGGGGAAAAGTGG - Intronic
1050800549 9:9607248-9607270 CTGGAGTCTATGGGGATTACTGG + Intronic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1052991645 9:34522242-34522264 CTGGAGTCCTGGGAGAGAGGAGG - Intronic
1053278292 9:36799656-36799678 CTGGAGTCCTTGAGGACAGTGGG + Intergenic
1053776770 9:41551603-41551625 CTGGAGTCTTTTAAGATAAGAGG - Intergenic
1054364959 9:64326882-64326904 CTGGAGTCTTTTAAGATAAGAGG + Intergenic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1056833398 9:89934514-89934536 CTTGATTCCTTGAGCATAAGAGG + Intergenic
1057187132 9:93063177-93063199 CTGCAGACCTTGGGGATCAAGGG + Intronic
1059437622 9:114285970-114285992 GTGGGGTCCTTGGGAATGAGAGG + Intronic
1059570874 9:115434060-115434082 CTTGAGTCCTTAGGGAAAAATGG - Intergenic
1060036241 9:120258280-120258302 CTGGGGTCCCTGGGGATTATGGG + Intergenic
1203745870 Un_GL000218v1:40520-40542 CTGGGGTCCCTCGGGATAAGTGG + Intergenic
1203564239 Un_KI270744v1:78962-78984 CTGGGGTCCTTCGGGATAAGTGG - Intergenic
1185503345 X:615385-615407 CTGGTGTCTTTGGGGAAAAAGGG - Intergenic
1188919454 X:35954445-35954467 CTGTATTCCTTGGGCATAAATGG + Intronic
1189915748 X:45854010-45854032 CAGAATTCCTTGGGGATAATGGG - Intergenic
1191199719 X:57766747-57766769 CTGAAGTTCTTGGGGATAGATGG - Intergenic
1192560341 X:72124045-72124067 TTGGAGTCCCTGGGGAGAAGTGG + Intergenic
1192571172 X:72206758-72206780 CTGCAGTCTTTGGGGATAGCTGG - Exonic
1193726171 X:85041706-85041728 CTGGAGGCCTTGGGAATAGAGGG + Intronic
1195525320 X:105882299-105882321 CTGAAGACCTTGAGGCTAAGTGG - Intronic
1195769141 X:108330448-108330470 CTTGCATCCTTGGGAATAAGTGG + Intronic
1195853598 X:109308148-109308170 CTGGAGTTTTTGGGCCTAAGAGG + Intergenic
1196111703 X:111953582-111953604 CTGGAGGCCTCAGGGATGAGGGG - Intronic
1196401389 X:115320535-115320557 GTGGGGTGCTTGGGGAGAAGTGG + Intergenic
1201159196 Y:11155532-11155554 CTGGGGTCCCTCGGGTTAAGTGG + Intergenic
1201784352 Y:17757782-17757804 CTGTTGTCCTTGGGGTTCAGTGG + Intergenic
1201817201 Y:18148205-18148227 CTGTTGTCCTTGGGGTTCAGTGG - Intergenic