ID: 1131441657

View in Genome Browser
Species Human (GRCh38)
Location 15:92464233-92464255
Sequence TCATAATAGTGGTACTTGAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 93}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131441657_1131441659 -8 Left 1131441657 15:92464233-92464255 CCAGTCAAGTACCACTATTATGA 0: 1
1: 0
2: 0
3: 4
4: 93
Right 1131441659 15:92464248-92464270 TATTATGACAGCCTCAAGTATGG 0: 1
1: 0
2: 1
3: 7
4: 114
1131441657_1131441661 6 Left 1131441657 15:92464233-92464255 CCAGTCAAGTACCACTATTATGA 0: 1
1: 0
2: 0
3: 4
4: 93
Right 1131441661 15:92464262-92464284 CAAGTATGGCTACACCTCCCAGG 0: 1
1: 0
2: 0
3: 5
4: 73
1131441657_1131441666 30 Left 1131441657 15:92464233-92464255 CCAGTCAAGTACCACTATTATGA 0: 1
1: 0
2: 0
3: 4
4: 93
Right 1131441666 15:92464286-92464308 CAGCCCGCATACCATGCCCTTGG 0: 1
1: 0
2: 0
3: 10
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131441657 Original CRISPR TCATAATAGTGGTACTTGAC TGG (reversed) Exonic
901366287 1:8752059-8752081 TAATAATAGTGGCCCTTGAATGG - Intronic
903199648 1:21724258-21724280 TCATAGGAGTGGCACTTAACTGG - Intronic
903532267 1:24040503-24040525 TCATAATAGTGGTGGTTACCAGG + Intergenic
903600575 1:24535642-24535664 TCATAAAAATGGTACTGTACTGG - Exonic
905445415 1:38025589-38025611 TCATCATAGTGATACTAGACAGG + Intergenic
906447368 1:45914025-45914047 TCAAAACAGTGGTCCTTGGCAGG + Intronic
912105836 1:106273460-106273482 TCATATTTGTGGAACTTGAAGGG - Intergenic
913223647 1:116679693-116679715 ACATAATAGTGGGATTTGAAAGG + Intergenic
918364828 1:183796674-183796696 TCATAATAGTGGTATTGAAATGG - Intronic
918921248 1:190713162-190713184 TGAAACTAGTGGTACTGGACAGG - Intergenic
1063675630 10:8138908-8138930 GCAAAATAGTGGAACTTGCCTGG - Intergenic
1064452645 10:15457168-15457190 TGATAATAGAGGTATTAGACAGG - Intergenic
1064631713 10:17320993-17321015 TCATAATAGTGATGGCTGACAGG + Exonic
1068030009 10:51694666-51694688 TCATAATAGTTGAAGATGACAGG - Intronic
1071278688 10:84079580-84079602 TCATAAAAGGGGTTCTGGACTGG - Intergenic
1079394819 11:20052641-20052663 TCAGAATAGAGATACATGACAGG + Intronic
1085916247 11:80891597-80891619 TCTAAATAGTGTTACTTGCCAGG + Intergenic
1092300118 12:7239809-7239831 TCATCATAGTTGTCCTTGATAGG - Intergenic
1093669206 12:21852650-21852672 TAATAATCATGGTACCTGACAGG - Intronic
1099553860 12:84083761-84083783 TCATAAAAGTGGTTATTGATGGG + Intergenic
1102941497 12:116946601-116946623 TCAGAACAGTGGTTCTCGACTGG - Intronic
1105433733 13:20359949-20359971 TCATAAAAGTTGAACCTGACTGG - Intergenic
1106731943 13:32550697-32550719 TGATAATAGTTCTACTTCACAGG + Intergenic
1107506297 13:41037315-41037337 TCATTATTCTGTTACTTGACTGG - Intronic
1111738371 13:92171191-92171213 ACAAAAAAGTGGTCCTTGACAGG - Intronic
1115292562 14:31788972-31788994 TTATACTACTGGTACATGACAGG + Intronic
1118471815 14:66081386-66081408 TTAGAATAGTGATTCTTGACTGG - Intergenic
1121182171 14:91937395-91937417 TCATGATGGTGGTATTTGAAAGG - Intronic
1121962334 14:98273123-98273145 TGATAATGGTGGTACTTGTCAGG + Intergenic
1125668725 15:41454018-41454040 TCATAATAGTAGATCTTAACAGG - Intronic
1131441657 15:92464233-92464255 TCATAATAGTGGTACTTGACTGG - Exonic
1139198898 16:64952152-64952174 TCATAACAGTTGTACTTCTCAGG + Intronic
1146272359 17:31492708-31492730 TCATAATACTGTTAATTGAATGG + Intronic
1158428027 18:57356764-57356786 ACATAATTGTGGTCCTTGAAGGG - Intronic
1166886721 19:45965832-45965854 TCATGATAGTGCTACTTCATGGG + Intronic
941711574 2:168719635-168719657 TCAGAATATTGGTAATTGATGGG + Intronic
942577231 2:177376841-177376863 TCATTATAGTTGTTCTTGAGGGG - Intronic
944691132 2:202159543-202159565 TAATAATACTGGGACCTGACAGG + Intronic
1170053326 20:12171418-12171440 ACTCAATAGTGGTAATTGACTGG + Intergenic
1173369656 20:42423777-42423799 TCATGATAGTGTCACTTGATGGG + Intronic
1176550288 21:8217912-8217934 TCAGAGTAGTGGTATTTCACCGG - Intergenic
1176569216 21:8400950-8400972 TCAGAGTAGTGGTATTTCACCGG - Intergenic
1176577130 21:8445182-8445204 TCAGAGTAGTGGTATTTCACCGG - Intergenic
1177436576 21:21062396-21062418 TCATGAAAGTGATATTTGACTGG + Intronic
1179135888 21:38679230-38679252 TCATCATAGTTGTTCTTGTCTGG + Intergenic
1203255183 22_KI270733v1_random:134250-134272 TCAGAGTAGTGGTATTTCACCGG - Intergenic
1203263239 22_KI270733v1_random:179329-179351 TCAGAGTAGTGGTATTTCACCGG - Intergenic
950515480 3:13462160-13462182 TCATAATAGTCGTACCTGCACGG + Intergenic
950803111 3:15571298-15571320 TCATAATAGTGGAAGTGGATGGG - Intronic
951317733 3:21206485-21206507 TCATCAATGTGGTCCTTGACTGG + Intergenic
959927803 3:111944227-111944249 TCATAAGGGTGGAAGTTGACAGG + Intronic
960266487 3:115626212-115626234 TCATCATCGTAGTACTTAACAGG + Intronic
969920591 4:10535890-10535912 TCATAATAATGGTACATAAGTGG + Intronic
970144499 4:13020841-13020863 CAATAATAGTGGGATTTGACAGG - Intergenic
972009045 4:34151941-34151963 TAATAATAGTGCTACATCACAGG - Intergenic
973918099 4:55656978-55657000 TCATAGGACTGGTCCTTGACTGG - Intergenic
974510800 4:62837949-62837971 TCATAATAGGGGGACCTGTCAGG + Intergenic
975432281 4:74307766-74307788 TCATTATGTTGGTACTTTACTGG + Intergenic
978095025 4:104765854-104765876 TCAGAACAGTGGTTCTTAACTGG - Intergenic
978154595 4:105474324-105474346 TCATGATAGTAATTCTTGACGGG - Intergenic
978661299 4:111129739-111129761 TGAGAATAGTAATACTTGACAGG - Intergenic
979626207 4:122848153-122848175 TCCTAACAGAGGTACTAGACTGG + Intronic
982844679 4:160235032-160235054 TCATATTAATGGTACTTCCCTGG - Intergenic
983840255 4:172449309-172449331 TCATAATGGTGGTACTTGGAGGG - Intronic
984241954 4:177228478-177228500 TCATCATAGTTTTACATGACAGG - Intergenic
984424676 4:179567970-179567992 TCATAATAATGGTTTTTGTCTGG + Intergenic
984870674 4:184322292-184322314 TCATAAGAATAGTACCTGACAGG + Intergenic
992003478 5:72456613-72456635 TCAGAAAAGTGGTGATTGACAGG + Intronic
992502097 5:77352882-77352904 TCATAATAATGGCACTTCTCAGG - Intronic
997182806 5:131849168-131849190 TCATGGGAGTGGTACTTCACAGG + Intronic
1004542100 6:16560717-16560739 TCAAAAAAGTTGTGCTTGACAGG - Intronic
1008273999 6:49522232-49522254 TAATAATAGTCCTACTTCACAGG - Intronic
1009192208 6:60642791-60642813 TGCAAATAGTGGTACTAGACTGG + Intergenic
1010397249 6:75406594-75406616 TCATAATACTTGTATTTGATGGG - Intronic
1020359140 7:7308460-7308482 TCTAAATAGTGGGACTTAACAGG - Intergenic
1026297131 7:69062777-69062799 TCAGAGTAGTGGTAGTTCACCGG - Intergenic
1032461643 7:132115777-132115799 TCATAATAGTGTTACTGGAAAGG - Intergenic
1032800372 7:135312951-135312973 TCACAATAGTGGTTCTTAATGGG - Intergenic
1034309580 7:150075162-150075184 TCTTAATTGTGATAGTTGACAGG + Intergenic
1034797279 7:154025479-154025501 TCTTAATTGTGATAGTTGACAGG - Intronic
1038358010 8:26848254-26848276 CCATATTAGTGGTACTTGCATGG - Intronic
1041452764 8:58024949-58024971 TTATAATAATGGTATTTGCCTGG + Intronic
1045613021 8:103870249-103870271 TGATAATAATAGTACTTCACAGG + Intronic
1051208761 9:14719236-14719258 TCATAATATAGGTACTTGTTTGG + Intergenic
1056143999 9:83711164-83711186 TGATAATAAAGGTATTTGACTGG - Intergenic
1059831342 9:118099772-118099794 TCATGATATTGGCAGTTGACTGG - Intergenic
1203471581 Un_GL000220v1:117387-117409 TCAGAGTAGTGGTATTTCACCGG - Intergenic
1203479402 Un_GL000220v1:161359-161381 TCAGAGTAGTGGTATTTCACCGG - Intergenic
1186534554 X:10332768-10332790 TCATTCTAGTGATACTTAACAGG - Intergenic
1187874497 X:23792937-23792959 ACATAATAATGCTACTTGAAAGG - Intergenic
1188464126 X:30459299-30459321 TCATAATAATCGTATTTGAAGGG + Intergenic
1190006090 X:46739540-46739562 TCACAATAGTTGTTCTTGCCAGG + Intronic
1194858351 X:98962214-98962236 TCATATTAGTTGAGCTTGACAGG - Intergenic
1195830633 X:109054501-109054523 TCAGAGTAGTGGTATTTCACCGG - Intergenic
1196740317 X:119019321-119019343 CCATACTTGTGGTACTTTACAGG - Intergenic
1197011113 X:121564790-121564812 GCATACTAATGGCACTTGACAGG + Intergenic
1201352685 Y:13062538-13062560 TCATAATATTGTTATTTGAAAGG - Intergenic
1202111694 Y:21427680-21427702 TCATCAAAATGGAACTTGACAGG - Intergenic