ID: 1131441660

View in Genome Browser
Species Human (GRCh38)
Location 15:92464259-92464281
Sequence GGGAGGTGTAGCCATACTTG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 70}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131441660_1131441666 4 Left 1131441660 15:92464259-92464281 CCTCAAGTATGGCTACACCTCCC 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1131441666 15:92464286-92464308 CAGCCCGCATACCATGCCCTTGG 0: 1
1: 0
2: 0
3: 10
4: 89
1131441660_1131441669 13 Left 1131441660 15:92464259-92464281 CCTCAAGTATGGCTACACCTCCC 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1131441669 15:92464295-92464317 TACCATGCCCTTGGAGTTTAAGG 0: 1
1: 0
2: 3
3: 13
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131441660 Original CRISPR GGGAGGTGTAGCCATACTTG AGG (reversed) Exonic
904011043 1:27390886-27390908 GGGAGGTGTAGGCATGCAGGTGG - Intergenic
904341586 1:29838364-29838386 GGGAGGAGTGGCCAGACATGGGG + Intergenic
906803386 1:48756818-48756840 GGGTGGTCTATGCATACTTGGGG + Intronic
908961770 1:69706790-69706812 GGAAGCTGTGGCCATACTGGTGG - Intronic
915602135 1:156929191-156929213 GGTAGCTATACCCATACTTGGGG - Intronic
915920638 1:159973132-159973154 GCAAGGTGTGGCCATCCTTGTGG + Intergenic
1067056986 10:43058180-43058202 GGAAGGTGTATCCATCCTTGAGG - Intergenic
1074260802 10:111851430-111851452 GGGAGGTGTTTGCATCCTTGCGG - Intergenic
1075062614 10:119267440-119267462 GGGAGCTGGGGTCATACTTGTGG + Intronic
1075112302 10:119597040-119597062 GGGTAGTGTAGTCATACGTGAGG + Intergenic
1076844070 10:133060520-133060542 GGGAGCTGCAGCCATCCCTGGGG - Intergenic
1082026580 11:47576986-47577008 GTGAGATATAGCCATACTTAAGG - Intronic
1083593552 11:63908666-63908688 GGGAGGAGAAGCCAGCCTTGGGG - Intronic
1084857625 11:71999109-71999131 GGGAGATGTAGCCGACCTTGGGG + Exonic
1084960985 11:72716607-72716629 GGGAGTTGAAGCCACACCTGTGG + Intronic
1087242835 11:95799344-95799366 GGCAAGTGTAGGCTTACTTGGGG - Exonic
1091473961 12:753637-753659 CGGAGCTGGAGCCATTCTTGGGG - Exonic
1094348450 12:29497510-29497532 GGGTGGTATAGCCACACCTGAGG - Intronic
1097394921 12:59061574-59061596 GGGAGCTGAAGCCAGACTGGTGG + Intergenic
1103342033 12:120225887-120225909 GGTAGGTGTGGCCAGCCTTGAGG - Intronic
1108344081 13:49527217-49527239 TGGAGGTGTAGCCTGTCTTGAGG - Intronic
1110950608 13:81485252-81485274 GAGACGTGTTGCCACACTTGAGG + Intergenic
1121968203 14:98330021-98330043 GGGAGGTATATAAATACTTGAGG + Intergenic
1130183488 15:81654190-81654212 GAGAGGTGAAGCCAGACTTCTGG - Intergenic
1131441660 15:92464259-92464281 GGGAGGTGTAGCCATACTTGAGG - Exonic
1136006934 16:27337181-27337203 GGGAGGTGGAGCCCTGCTGGGGG + Intronic
1137885534 16:52098989-52099011 GGGGGGTGTAACCATCCTTGTGG + Intergenic
1138431051 16:56969491-56969513 CAGTGGTGTAGCCATACTTCAGG - Exonic
1139132670 16:64164936-64164958 GTGATGTGAAGCCATATTTGTGG + Intergenic
1141982927 16:87561058-87561080 TGGAGGTGGGGCCATGCTTGAGG + Intergenic
1142173209 16:88633616-88633638 GGGATGGGTAGCCACACCTGGGG - Intergenic
1142472952 17:173217-173239 GGAGGGTGCAGCCATAATTGGGG + Intronic
1144703741 17:17354230-17354252 GGGAGCTGCAGCCAGACCTGAGG + Intergenic
1147038433 17:37699150-37699172 GGGAGGTGTGGGAATACTGGGGG + Exonic
1149685579 17:58532687-58532709 GGGCGGTGTAGCCTTGCCTGTGG + Intronic
1150288252 17:63966179-63966201 AGCTGGTGTAGCCATAGTTGGGG + Exonic
1162734585 19:12739148-12739170 GGGAGAAGTAGTCAGACTTGAGG + Intronic
1163112983 19:15172592-15172614 GGGAGGTGTAGCTATTGTTGAGG - Intronic
1163544065 19:17930439-17930461 GGGAGGTTTGGCCATTTTTGTGG + Intergenic
931748907 2:65313959-65313981 GGTAGTTGTAGTCATGCTTGGGG + Exonic
934165329 2:89289004-89289026 GGGAGGTGTATACATACATGTGG + Intergenic
934201945 2:89893458-89893480 GGGAGGTGTATACATACATGTGG - Intergenic
934942102 2:98510162-98510184 GGGAGTTGAAGTCGTACTTGTGG + Intronic
937081177 2:119141075-119141097 GGGAGCGGTGGCAATACTTGGGG + Intergenic
938717779 2:134036582-134036604 TTGATGTGTAGCCATACTTAAGG + Intergenic
946759708 2:222981460-222981482 GTGAGATGTTGCCATCCTTGGGG + Intergenic
1169206738 20:3744980-3745002 GGGCGGTGTAGCCAAAGCTGTGG - Exonic
1171180077 20:23085394-23085416 TGAAGTTGCAGCCATACTTGGGG + Exonic
1177513987 21:22123654-22123676 GGGAAGTTCAGCCATTCTTGAGG + Intergenic
1179808467 21:43854961-43854983 GGGAGGGGTGGCCATGCTGGAGG - Intergenic
953404433 3:42653650-42653672 GGGAGATGCAGCCAGGCTTGCGG - Intergenic
954396409 3:50295652-50295674 GGAAGGTGTGGCCATAGCTGCGG - Intronic
956241019 3:67130701-67130723 GGGAGAGGTAGCTATACTTGAGG + Intergenic
960854901 3:122092741-122092763 GGGTGCTGTAGCCAAACTTCAGG - Intronic
973687953 4:53393221-53393243 GGGAGCTGTTGCCATACTATGGG + Intronic
976730208 4:88253812-88253834 GGAAAGTGAAGCCATAATTGTGG + Intergenic
976997781 4:91457118-91457140 GAGACGTGTAGCCATTCTTTAGG - Intronic
987229503 5:15878851-15878873 GGGAGATGTAGCCAGAGTTCAGG - Intronic
993413909 5:87602176-87602198 GGGAGGTGTAGCACTGCTTTTGG + Intergenic
994714481 5:103305342-103305364 GGGAGGTGGAGCCTAACTGGAGG - Intergenic
996919903 5:128755816-128755838 GGCAGATGTAGACATGCTTGTGG - Intronic
1001864550 5:175092086-175092108 GGGAGATGGGGCCATCCTTGAGG + Intergenic
1006093721 6:31643084-31643106 TGGCGGTGGAGCCATACCTGGGG + Exonic
1008018483 6:46548341-46548363 AGGAGGGGTAGGCATCCTTGAGG - Intergenic
1012616269 6:101283274-101283296 GGGAGGTGTAGCCCTGCTACTGG - Intergenic
1013861988 6:114646887-114646909 GCAAGATGTAGCCTTACTTGTGG + Intergenic
1013864182 6:114675007-114675029 GGGAGCTGGAGCTATACTTACGG + Intergenic
1015379372 6:132549210-132549232 GGTATCTGTAGCCATACATGGGG - Intergenic
1019256517 7:55943-55965 GGGAGCTGTGAGCATACTTGTGG - Intergenic
1022163983 7:27740149-27740171 GGGAGGTGTAGCCGGTCTTTGGG + Intronic
1027485139 7:78752216-78752238 GGGAAGTTTAGTCATTCTTGTGG + Intronic
1032424749 7:131813479-131813501 GGCAGGTCTTGCCTTACTTGAGG - Intergenic
1036206081 8:6806504-6806526 GGGAGGCAAAGCCATACTCGTGG - Intergenic
1043866713 8:85383136-85383158 GGAAGGTGTGGCCATGATTGTGG - Intronic
1049488248 8:142877496-142877518 GTGAGGTGGTGCCAGACTTGGGG - Intronic
1186291347 X:8103254-8103276 GGGAGGTGTAGGCAATTTTGAGG - Intergenic
1196070930 X:111520961-111520983 GGGGGGTGTTGCCAGTCTTGAGG - Intergenic