ID: 1131441666

View in Genome Browser
Species Human (GRCh38)
Location 15:92464286-92464308
Sequence CAGCCCGCATACCATGCCCT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 89}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131441660_1131441666 4 Left 1131441660 15:92464259-92464281 CCTCAAGTATGGCTACACCTCCC 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1131441666 15:92464286-92464308 CAGCCCGCATACCATGCCCTTGG 0: 1
1: 0
2: 0
3: 10
4: 89
1131441657_1131441666 30 Left 1131441657 15:92464233-92464255 CCAGTCAAGTACCACTATTATGA 0: 1
1: 0
2: 0
3: 4
4: 93
Right 1131441666 15:92464286-92464308 CAGCCCGCATACCATGCCCTTGG 0: 1
1: 0
2: 0
3: 10
4: 89
1131441658_1131441666 19 Left 1131441658 15:92464244-92464266 CCACTATTATGACAGCCTCAAGT 0: 1
1: 0
2: 0
3: 8
4: 81
Right 1131441666 15:92464286-92464308 CAGCCCGCATACCATGCCCTTGG 0: 1
1: 0
2: 0
3: 10
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131441666 Original CRISPR CAGCCCGCATACCATGCCCT TGG Exonic