ID: 1131441666

View in Genome Browser
Species Human (GRCh38)
Location 15:92464286-92464308
Sequence CAGCCCGCATACCATGCCCT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 89}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131441660_1131441666 4 Left 1131441660 15:92464259-92464281 CCTCAAGTATGGCTACACCTCCC 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1131441666 15:92464286-92464308 CAGCCCGCATACCATGCCCTTGG 0: 1
1: 0
2: 0
3: 10
4: 89
1131441657_1131441666 30 Left 1131441657 15:92464233-92464255 CCAGTCAAGTACCACTATTATGA 0: 1
1: 0
2: 0
3: 4
4: 93
Right 1131441666 15:92464286-92464308 CAGCCCGCATACCATGCCCTTGG 0: 1
1: 0
2: 0
3: 10
4: 89
1131441658_1131441666 19 Left 1131441658 15:92464244-92464266 CCACTATTATGACAGCCTCAAGT 0: 1
1: 0
2: 0
3: 8
4: 81
Right 1131441666 15:92464286-92464308 CAGCCCGCATACCATGCCCTTGG 0: 1
1: 0
2: 0
3: 10
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131441666 Original CRISPR CAGCCCGCATACCATGCCCT TGG Exonic
900403148 1:2480908-2480930 GAGCCAGCAAACCAGGCCCTGGG + Intronic
901740909 1:11341171-11341193 CAGACCGCATCCCAGGCTCTGGG + Intergenic
903336303 1:22626896-22626918 CAGCCCACAAGCCCTGCCCTAGG - Intergenic
903962698 1:27066775-27066797 CAAGCCCCATCCCATGCCCTGGG - Intergenic
904905688 1:33895744-33895766 CAGCCTGCATCCCATGCCTAGGG - Intronic
906151052 1:43588048-43588070 CTGCCCGCAGACCATGTCCCTGG + Intronic
917693728 1:177495988-177496010 CAGCCCGAATACCCTCCCCTTGG + Intergenic
919466135 1:197922864-197922886 CAGGCACCATACCAGGCCCTGGG - Intronic
921929442 1:220743071-220743093 AAGCCCCCATTCCAGGCCCTAGG - Intergenic
1064278465 10:13929396-13929418 CTGCCCGCCTACTACGCCCTGGG + Intronic
1072579621 10:96729385-96729407 CAGGCCCCATTCCATGTCCTGGG - Intergenic
1076368222 10:129935805-129935827 CAGCCCACATTCTATGCCCTTGG - Intronic
1076757205 10:132578815-132578837 CAGCCACCATGCCATTCCCTGGG - Intronic
1077027587 11:448165-448187 CCGCCCACAGACCATGTCCTCGG + Intergenic
1078510313 11:11979906-11979928 CAGCCTGCCTTCCAGGCCCTGGG + Intronic
1084000222 11:66292001-66292023 CAGCCAGGACACCATGCCCGAGG + Exonic
1091876074 12:3933936-3933958 CAGTCCCCACACCCTGCCCTTGG - Intergenic
1092260903 12:6952832-6952854 CAGCCCCCAGCCCATGCCTTTGG - Intronic
1094551062 12:31451973-31451995 CAGCCAGGATTCCATGTCCTGGG + Exonic
1095951403 12:47783804-47783826 CTGCCCGCCCACCATGCCCTTGG - Exonic
1097282062 12:57851133-57851155 CAGCCCCGATACTCTGCCCTGGG - Intergenic
1097473287 12:60021915-60021937 AAGCCCCCATTCCAAGCCCTAGG - Intergenic
1098247720 12:68537571-68537593 GAGGCCACAGACCATGCCCTGGG + Intergenic
1101353651 12:103956729-103956751 CAGCCTGCCGACCATGCCCGCGG - Exonic
1103175874 12:118862621-118862643 CAGCCTCCATCCCACGCCCTTGG - Intergenic
1110634821 13:77754623-77754645 CAGTCCAAATACCATGCCTTTGG + Intronic
1113567807 13:111329210-111329232 CAGCCTGCACAGCACGCCCTCGG + Intronic
1118036941 14:61877966-61877988 CTGCCAGTATACCTTGCCCTGGG + Intergenic
1120385987 14:83846533-83846555 CAGCCTGCATGCCATACCATTGG + Intergenic
1120902331 14:89586657-89586679 CTGCCCGCATCCCCTGCACTGGG - Intronic
1129380821 15:75165002-75165024 CACCCCACATACCTTGACCTAGG + Intergenic
1130040913 15:80404579-80404601 CAGCCCGCAGGCCTTGCCCGGGG + Intronic
1131148998 15:90035204-90035226 CAGCCCCCACACCATGCCCCAGG - Intronic
1131441666 15:92464286-92464308 CAGCCCGCATACCATGCCCTTGG + Exonic
1132972892 16:2697552-2697574 CCCCCAGCATACCATGGCCTCGG + Intronic
1135989963 16:27212345-27212367 CAACCCACACCCCATGCCCTTGG - Intronic
1137619731 16:49868385-49868407 TAGCTCGCAGACCATGCCCAGGG - Intergenic
1145272925 17:21414155-21414177 CAGGCCGCATTCTAGGCCCTGGG + Intronic
1145311128 17:21701591-21701613 CAGGCCGCATTCTAGGCCCTGGG + Intronic
1149430880 17:56594783-56594805 CGGCTTGCACACCATGCCCTCGG - Exonic
1152014530 17:77741787-77741809 CAGCCCTGAGACCCTGCCCTGGG + Intergenic
1152423180 17:80204966-80204988 CAGCCAGCCTACCCTGCCCCGGG - Intronic
1153585292 18:6614641-6614663 CAGCAAGAATACCATGACCTGGG + Intergenic
1156456812 18:37299427-37299449 CGGCCCCCATACCAGGCCCCTGG - Intronic
1161397304 19:4051678-4051700 CAGCCCGGAGACCTTGCCGTGGG - Intronic
1162373768 19:10293436-10293458 CCGCCCAAATACCACGCCCTAGG - Intronic
1163811927 19:19438485-19438507 CTGCCCTCAAACAATGCCCTGGG - Intronic
1166054043 19:40278009-40278031 CACCCCCAATACCATGACCTTGG - Intronic
1167373913 19:49101301-49101323 CAGCCTGCACACCAGGCCCTGGG - Intronic
925296934 2:2783514-2783536 GAGCCCGTATCCCATGCCCTGGG - Intergenic
925360679 2:3278305-3278327 CTGCCCACATGCCCTGCCCTTGG + Intronic
929533612 2:42767257-42767279 CAGCCCAGATGCCATGCCCCTGG - Exonic
938910768 2:135883893-135883915 ACCCCCACATACCATGCCCTTGG - Intergenic
944315387 2:198279804-198279826 CAGCTTCCATACCAAGCCCTAGG - Intronic
944758370 2:202787637-202787659 CACTCCACATATCATGCCCTTGG + Intronic
945504456 2:210621125-210621147 CAGCTTCCCTACCATGCCCTTGG - Intronic
948013985 2:234672801-234672823 CAGACCCCATACCCTTCCCTAGG - Intergenic
948262042 2:236611708-236611730 CAGCCCTCATGACTTGCCCTGGG - Intergenic
1170798978 20:19574855-19574877 GAGATCCCATACCATGCCCTGGG + Intronic
1172007776 20:31829303-31829325 CAGCCCACAGGCCATGTCCTGGG + Intronic
1175777817 20:61664037-61664059 CAGCCCCCACACAATGCCCTTGG - Intronic
1179255689 21:39713352-39713374 CAGCCAGCCCACCATGACCTGGG - Intergenic
1179435316 21:41358602-41358624 CAGCCTGCAAGCCCTGCCCTGGG + Intergenic
1179667010 21:42919903-42919925 CTGCCCGGGTACCTTGCCCTGGG + Intergenic
1180181193 21:46119360-46119382 CAGCCCTCACAGGATGCCCTGGG - Intronic
1182123882 22:27802546-27802568 CGGGCCGCACACCTTGCCCTGGG + Intergenic
1183484254 22:38080949-38080971 CAGCGCGCCCACCATGCCGTAGG + Exonic
1184792394 22:46708075-46708097 CAGCCTGCACACCTGGCCCTTGG + Intronic
1185026350 22:48415699-48415721 CAGCCTTCATGCCATCCCCTCGG + Intergenic
1185310740 22:50152881-50152903 CTGCCCCCAGACCAAGCCCTTGG - Intronic
949204652 3:1423635-1423657 CAGCCATCATACCACGCACTTGG + Intergenic
950217304 3:11168734-11168756 CAGCCCGCACCCCCAGCCCTGGG - Intronic
952324911 3:32312487-32312509 CTGCCCACATGCCTTGCCCTGGG - Intronic
952945216 3:38474393-38474415 CAGCCTGCAGCCCAAGCCCTAGG - Intronic
961618543 3:128204730-128204752 CAGCACACTTACCATGCCCTGGG - Intronic
969931645 4:10636667-10636689 CAGCTCTCATACCGTGCACTTGG + Intronic
970663105 4:18308115-18308137 CAGCCAGCAGAGCATGTCCTGGG + Intergenic
972766173 4:42153456-42153478 CAACCAGCATACCCTGCCCCAGG + Intergenic
997362110 5:133301717-133301739 CAGCCTGCAAGCTATGCCCTTGG - Intronic
1000302912 5:159972177-159972199 CAGCCAGCGGACCCTGCCCTCGG + Exonic
1021191204 7:17621694-17621716 CAGTCACCATACCATGCCTTTGG - Intergenic
1035047018 7:155974294-155974316 CAGCCTGCAGACCCAGCCCTGGG - Intergenic
1036630620 8:10511700-10511722 CTTCCCCCATACCTTGCCCTGGG - Intergenic
1041513401 8:58675283-58675305 CAGCCCGCATATAATGCCAGGGG + Intergenic
1042334659 8:67617592-67617614 CAGCCAGCATACCAAGCCACTGG + Intronic
1048645482 8:136414741-136414763 CAGCCCGCATCCCAGGCACTGGG - Intergenic
1057190564 9:93084721-93084743 CAGCCCGCAGCATATGCCCTAGG + Exonic
1058957591 9:109963587-109963609 CAGCCCCCATACTGGGCCCTGGG + Intronic
1061639957 9:131945589-131945611 CAACCCCCATGCCAAGCCCTTGG + Intronic
1061723387 9:132567585-132567607 CAGCCCTCAAGCCATTCCCTGGG - Intronic
1061933501 9:133845297-133845319 CAGCCCGCATGGCACGCCCAAGG + Intronic
1061974905 9:134063124-134063146 CAGCTCTCAGACCATCCCCTTGG + Intronic
1186194727 X:7099001-7099023 TGGCCCAGATACCATGCCCTGGG + Intronic
1189135643 X:38546759-38546781 CTGCCAGCATACCTTGTCCTAGG + Intronic
1189373071 X:40445408-40445430 CAGCCTCCCCACCATGCCCTAGG + Intergenic
1193012189 X:76688413-76688435 CAGGCAGCAGACCATGCCATGGG - Intergenic
1194165422 X:90508513-90508535 CAGCAGGCCTACCAGGCCCTGGG - Intergenic
1195122992 X:101775370-101775392 AAGCCCCCATTCCAAGCCCTAGG - Intergenic
1199276140 X:145944755-145944777 CAGCCAGCATATAATGCCCTAGG - Intergenic
1200511690 Y:4086323-4086345 CAGCAGGCCTACCAGGCCCTGGG - Intergenic