ID: 1131450179

View in Genome Browser
Species Human (GRCh38)
Location 15:92532860-92532882
Sequence CTGGTTTAGGGGTAGGCAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131450179_1131450188 5 Left 1131450179 15:92532860-92532882 CCTGTTGCCTACCCCTAAACCAG No data
Right 1131450188 15:92532888-92532910 GAGGGCTGAGCAATGTCTGGAGG No data
1131450179_1131450189 18 Left 1131450179 15:92532860-92532882 CCTGTTGCCTACCCCTAAACCAG No data
Right 1131450189 15:92532901-92532923 TGTCTGGAGGTGATCATCTTAGG No data
1131450179_1131450187 2 Left 1131450179 15:92532860-92532882 CCTGTTGCCTACCCCTAAACCAG No data
Right 1131450187 15:92532885-92532907 ACTGAGGGCTGAGCAATGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131450179 Original CRISPR CTGGTTTAGGGGTAGGCAAC AGG (reversed) Intergenic
No off target data available for this crispr