ID: 1131460427

View in Genome Browser
Species Human (GRCh38)
Location 15:92613981-92614003
Sequence CCTTGTTACAATGACCAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131460427_1131460437 7 Left 1131460427 15:92613981-92614003 CCCACCTGGTCATTGTAACAAGG No data
Right 1131460437 15:92614011-92614033 CACATGAGTGTGGACACCCGGGG No data
1131460427_1131460436 6 Left 1131460427 15:92613981-92614003 CCCACCTGGTCATTGTAACAAGG No data
Right 1131460436 15:92614010-92614032 GCACATGAGTGTGGACACCCGGG No data
1131460427_1131460433 -3 Left 1131460427 15:92613981-92614003 CCCACCTGGTCATTGTAACAAGG No data
Right 1131460433 15:92614001-92614023 AGGGGCCTCGCACATGAGTGTGG No data
1131460427_1131460435 5 Left 1131460427 15:92613981-92614003 CCCACCTGGTCATTGTAACAAGG No data
Right 1131460435 15:92614009-92614031 CGCACATGAGTGTGGACACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131460427 Original CRISPR CCTTGTTACAATGACCAGGT GGG (reversed) Intergenic
No off target data available for this crispr