ID: 1131460909

View in Genome Browser
Species Human (GRCh38)
Location 15:92616917-92616939
Sequence GAGTAGCTCCTCAGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131460900_1131460909 26 Left 1131460900 15:92616868-92616890 CCTGGAGAACCTTAGTCACTGCT No data
Right 1131460909 15:92616917-92616939 GAGTAGCTCCTCAGGGAGGAGGG No data
1131460899_1131460909 27 Left 1131460899 15:92616867-92616889 CCCTGGAGAACCTTAGTCACTGC No data
Right 1131460909 15:92616917-92616939 GAGTAGCTCCTCAGGGAGGAGGG No data
1131460902_1131460909 17 Left 1131460902 15:92616877-92616899 CCTTAGTCACTGCTACAGTGGTA No data
Right 1131460909 15:92616917-92616939 GAGTAGCTCCTCAGGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131460909 Original CRISPR GAGTAGCTCCTCAGGGAGGA GGG Intergenic
No off target data available for this crispr