ID: 1131462106

View in Genome Browser
Species Human (GRCh38)
Location 15:92624739-92624761
Sequence CTTTCCACACATAAGAAGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 160}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131462098_1131462106 0 Left 1131462098 15:92624716-92624738 CCACACCCCCACGGGGCCACATC 0: 1
1: 0
2: 4
3: 24
4: 241
Right 1131462106 15:92624739-92624761 CTTTCCACACATAAGAAGCCGGG 0: 1
1: 0
2: 1
3: 10
4: 160
1131462102_1131462106 -8 Left 1131462102 15:92624724-92624746 CCACGGGGCCACATCCTTTCCAC 0: 1
1: 0
2: 1
3: 17
4: 149
Right 1131462106 15:92624739-92624761 CTTTCCACACATAAGAAGCCGGG 0: 1
1: 0
2: 1
3: 10
4: 160
1131462099_1131462106 -5 Left 1131462099 15:92624721-92624743 CCCCCACGGGGCCACATCCTTTC 0: 1
1: 0
2: 0
3: 7
4: 124
Right 1131462106 15:92624739-92624761 CTTTCCACACATAAGAAGCCGGG 0: 1
1: 0
2: 1
3: 10
4: 160
1131462101_1131462106 -7 Left 1131462101 15:92624723-92624745 CCCACGGGGCCACATCCTTTCCA 0: 1
1: 0
2: 1
3: 6
4: 125
Right 1131462106 15:92624739-92624761 CTTTCCACACATAAGAAGCCGGG 0: 1
1: 0
2: 1
3: 10
4: 160
1131462100_1131462106 -6 Left 1131462100 15:92624722-92624744 CCCCACGGGGCCACATCCTTTCC 0: 1
1: 0
2: 0
3: 14
4: 192
Right 1131462106 15:92624739-92624761 CTTTCCACACATAAGAAGCCGGG 0: 1
1: 0
2: 1
3: 10
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131462106 Original CRISPR CTTTCCACACATAAGAAGCC GGG Intronic
903052002 1:20608283-20608305 CATTTCACAGATGAGAAGCCAGG - Intronic
904479296 1:30783948-30783970 CCTTCCACCCATGAGTAGCCAGG + Intergenic
904702493 1:32366193-32366215 CTGTCCATACATAAGCAGGCAGG - Intronic
904968323 1:34398405-34398427 CTTTCTGCACATATAAAGCCTGG + Intergenic
905459666 1:38114280-38114302 CTTGCCACCCACAGGAAGCCTGG - Intergenic
905557490 1:38898906-38898928 GTTTCCACACATCATAAGTCTGG + Intronic
907673440 1:56497062-56497084 CTTTCCTCACAAAGGAATCCAGG + Intronic
913264620 1:117032273-117032295 CATTCCACACATGGGAACCCAGG - Intronic
913717340 1:121549968-121549990 GTTTCTACACAAATGAAGCCAGG - Intergenic
915170652 1:153974943-153974965 CTATACACACAATAGAAGCCTGG - Intronic
915561625 1:156691424-156691446 CTTTCCACACTGAAGAACCCAGG + Intergenic
916007491 1:160675500-160675522 CTTTGCACAAATAAGCAGCTTGG - Intergenic
916371956 1:164108243-164108265 CTTTCCTCTCATAAGAGCCCAGG - Intergenic
920203921 1:204277728-204277750 CTGTCCACACAGAAGAAGGCTGG - Intronic
920872717 1:209807238-209807260 CTTTCTACAGATAAGACACCAGG - Intergenic
922624349 1:227022672-227022694 CATACCACACATAAAATGCCAGG - Intronic
923549551 1:234952258-234952280 CTTTCCACAAAGAAGACTCCAGG + Intergenic
924676121 1:246179778-246179800 CTATCAACACATAGAAAGCCTGG - Intronic
1063602376 10:7494006-7494028 CTGTCCACACACAAGAGGCAAGG + Intergenic
1063943798 10:11157776-11157798 CTCTACACACTTCAGAAGCCTGG - Intronic
1064267602 10:13837478-13837500 CTTTCCACAGATCAGAAAGCTGG + Intronic
1065890657 10:30118535-30118557 CCTTCCCCACAGTAGAAGCCAGG + Intergenic
1068878594 10:62024589-62024611 CTTTGAACAGATAAGAAGCTAGG + Intronic
1069909094 10:71749048-71749070 CTCTCCACACAGCAGCAGCCAGG + Exonic
1073076676 10:100828845-100828867 CTTTCCACAAAGCAGCAGCCTGG - Exonic
1073167738 10:101472466-101472488 CTTTCCTAACATAGGAAACCTGG + Intronic
1073674902 10:105634861-105634883 CTTAGCATACATAAGAAGCTTGG + Intergenic
1075288103 10:121204545-121204567 CTTTCTTCCCATAAGAAACCAGG - Intergenic
1075329908 10:121566521-121566543 CTGTCCCTACAGAAGAAGCCTGG - Intronic
1078144773 11:8715205-8715227 ATTTTCACACATAGGCAGCCAGG - Intronic
1078625265 11:12950064-12950086 ATTTCCACACAGAAAAACCCAGG + Intergenic
1078663032 11:13302376-13302398 CTTTCTACAGATAAGAGGACAGG - Intronic
1078667349 11:13337291-13337313 CTATAGACACATAAGAAGACTGG + Intronic
1084464307 11:69313308-69313330 CTGTCCACACTTACAAAGCCAGG - Intronic
1085084610 11:73658540-73658562 CTTTCCACACATCAGCCACCAGG - Intronic
1085633936 11:78143297-78143319 GTTTCCTCACATAATAAGTCTGG - Intergenic
1086012958 11:82127219-82127241 CTTGACAAAGATAAGAAGCCAGG + Intergenic
1086750831 11:90491260-90491282 CGTTCCACACCTAAGAGACCTGG + Intergenic
1087070746 11:94077842-94077864 CATTCCAGGCATAAGGAGCCTGG - Intronic
1088247258 11:107830883-107830905 CTTTCAAAACATAAGATTCCTGG + Intronic
1089857044 11:121555033-121555055 CTTTCCAGACACATGAAGCCAGG - Intronic
1091092302 11:132783172-132783194 CTTGCCTCACATAAGAAGATAGG - Intronic
1091399675 12:174449-174471 CTCTCCACCCACAAGAAGACTGG - Intronic
1092937563 12:13378245-13378267 CTGTCCACACATAGGAAGGCAGG + Intronic
1096160226 12:49370333-49370355 AGTTACACACATGAGAAGCCAGG - Intronic
1099511887 12:83548915-83548937 CTTTCCAAACATAGCAAGGCAGG - Intergenic
1102535495 12:113577563-113577585 CATTCCACCCACAAGAAGACAGG - Intergenic
1103717376 12:122952914-122952936 CTGTCCACACAGTAGAAGGCAGG + Intronic
1104217553 12:126749140-126749162 CTTTCTATAAATAATAAGCCAGG + Intergenic
1105295961 13:19088131-19088153 CTGTCTACACATATGCAGCCAGG - Intergenic
1105719157 13:23096642-23096664 CATTGCCCACATCAGAAGCCTGG - Intergenic
1106209997 13:27633237-27633259 TTATACACACATAAGAAGGCAGG + Intronic
1107716829 13:43208383-43208405 ATTTCCAAACATTTGAAGCCTGG + Intergenic
1109713992 13:66196867-66196889 CTTACCAAACAGAAAAAGCCCGG + Intergenic
1110228773 13:73147008-73147030 GTTTCTACACAAAAGAAGTCAGG + Intergenic
1110760471 13:79225211-79225233 CACTCCAGACATAAGAAGACAGG - Intergenic
1113780590 13:112974476-112974498 CTTTCCACACCCAAGGGGCCAGG - Intronic
1114904356 14:27107507-27107529 CTTTCCACACAGAAAATTCCAGG + Intergenic
1115013744 14:28584108-28584130 CTTTCCACAAAGAAAAACCCAGG - Intergenic
1115532980 14:34343991-34344013 CTTTCCACAGCTAGGAAGACCGG + Intronic
1115955587 14:38775542-38775564 CATTCAACACATGAAAAGCCGGG - Intergenic
1118444843 14:65841438-65841460 CTCTTCACTCAGAAGAAGCCTGG - Intergenic
1122373133 14:101240323-101240345 CTTTCCCCATATGAGAAGGCAGG - Intergenic
1122854770 14:104554788-104554810 CTGTCCCCACACAACAAGCCAGG + Intronic
1131462106 15:92624739-92624761 CTTTCCACACATAAGAAGCCGGG + Intronic
1131908526 15:97170697-97170719 CTTTGCACCCACAAGAAGCCTGG - Intergenic
1133206840 16:4239167-4239189 CTTTCCAGAAATAACCAGCCAGG + Intronic
1133300160 16:4777620-4777642 CTATCCACAAATAAAAAGGCTGG - Intergenic
1135956271 16:26958959-26958981 CTGACCACACAGATGAAGCCAGG - Intergenic
1137025304 16:35468212-35468234 CTTCCCACACATAGATAGCCTGG - Intergenic
1139217582 16:65143550-65143572 CTTTCTAAACCTAAGAAGCAAGG - Intergenic
1140835368 16:78788905-78788927 CTTTCCCCACATACTAAGCAGGG - Intronic
1141461167 16:84179588-84179610 CTGTCCACACAGGAGGAGCCAGG + Exonic
1143987430 17:10926852-10926874 TTTTCCACACATCAGAAGCCAGG + Intergenic
1148452768 17:47790535-47790557 CCTTCTCCACTTAAGAAGCCCGG - Intergenic
1151253155 17:72853608-72853630 GTTTTCACACATTGGAAGCCTGG - Intronic
1151977354 17:77490256-77490278 CTTTCCCCACATCAGACCCCAGG + Intronic
1154532264 18:15359166-15359188 CTTTCCAAACATAAAAAAACAGG + Intergenic
1156229096 18:35136697-35136719 CCTTCCACAGCTAGGAAGCCAGG + Intronic
1156890769 18:42187180-42187202 CTGTGCACACACATGAAGCCTGG + Intergenic
1160464338 18:79063563-79063585 CTTTCCCCAGATGAGGAGCCTGG - Intergenic
1165285193 19:34835946-34835968 CTTGCCAGCCATAGGAAGCCAGG - Intergenic
1165440074 19:35820738-35820760 CTTTCTTTACATCAGAAGCCGGG - Intergenic
1166410330 19:42552410-42552432 CTTTCCACACAGGAGCATCCAGG - Intronic
929600465 2:43201259-43201281 CTTTGGACACATCAGAAGACAGG - Intergenic
932498657 2:72160634-72160656 CTTTCTTCACAGAAGAAGCTGGG - Intergenic
932627030 2:73305709-73305731 TTTTCAACACCTAAAAAGCCAGG - Intergenic
934510078 2:94930945-94930967 CTTTCAAGACATAATAGGCCAGG + Intergenic
939553323 2:143642844-143642866 CTTTCCACAAAACAGCAGCCTGG - Intronic
939616653 2:144368922-144368944 CTTTCCAAAAATGTGAAGCCAGG - Intergenic
945794637 2:214347152-214347174 CTTTCCACAGCTACGTAGCCAGG - Intronic
945823281 2:214690158-214690180 CTTCCCACAAAGAAAAAGCCTGG + Intergenic
946033312 2:216722378-216722400 CTTTTCACAGATAATAAACCTGG + Intergenic
946169371 2:217885479-217885501 CTTGTCACCAATAAGAAGCCAGG + Intronic
948130497 2:235597134-235597156 CTTTCCACATAGAAGAACTCAGG - Intronic
948245579 2:236481366-236481388 TTTTCCACACATGAGGTGCCTGG + Intronic
948742630 2:240057560-240057582 CATCCCACACATAAGATTCCAGG - Intergenic
1169285073 20:4301040-4301062 CTTTCCAGTGATAAGATGCCAGG + Intergenic
1170061747 20:12266147-12266169 CATGGCACACATAAGAAGACAGG + Intergenic
1173363650 20:42366284-42366306 CTCTGCACAGATAACAAGCCTGG - Intronic
1179050030 21:37881217-37881239 CTTTCTCCACATCAGAATCCCGG - Intronic
1179196840 21:39172038-39172060 CTTTCCATGCATAAGTAGCCAGG + Intergenic
1179803000 21:43820289-43820311 CTTTCCAGACATCAGAAGCTGGG - Intergenic
1184519192 22:44982415-44982437 CCTTCCACAGATGAGAAACCTGG + Intronic
949450170 3:4176135-4176157 CTTTCCCAACCTAAGAAGACAGG + Intronic
952213129 3:31249539-31249561 CTTTTAAAACATAAGAAGACAGG + Intergenic
952610297 3:35200831-35200853 CTTTCCACACACAATAAGAGAGG - Intergenic
955080073 3:55650095-55650117 CTTTCCAGTCATAAATAGCCAGG - Intronic
960362079 3:116725098-116725120 CTTTCCACACATGATAGGACGGG - Intronic
962233805 3:133691287-133691309 ATTTCCATCCATAAGAAGTCAGG - Intergenic
964583200 3:158263648-158263670 CTTTCCACAAAGAAAAATCCAGG - Intronic
969270067 4:6093775-6093797 CTTTCCTCAAAGAAGGAGCCAGG + Intronic
970648135 4:18146715-18146737 CTTTGCACACAAAAAAAGTCAGG - Intergenic
972903887 4:43720909-43720931 TTTTCCACACAATAGAAGCCAGG - Intergenic
973075723 4:45923473-45923495 CTTTCCACCCATAATGAACCTGG - Intergenic
973129312 4:46630539-46630561 CATTCAACACATAATAAGCATGG + Intergenic
976220613 4:82754119-82754141 TTTCCTCCACATAAGAAGCCAGG - Intronic
977942685 4:102876244-102876266 CTTTACAGACAAAAGAAACCTGG + Intronic
978419076 4:108511060-108511082 CTTTCCACACAGAAGAGGAGGGG - Intergenic
979574404 4:122270839-122270861 CTTTGAACTCATAAAAAGCCTGG + Intronic
980973511 4:139588753-139588775 ATGTCCACACCTCAGAAGCCAGG - Intronic
984898536 4:184563923-184563945 CTGTCCTCACTTGAGAAGCCTGG + Intergenic
985077865 4:186235671-186235693 CTTTCCACTCCTAAGAAGTATGG - Intronic
986250580 5:6054103-6054125 CTTTCTACAGATAAGAACCAAGG + Intergenic
986342089 5:6798685-6798707 ATTTCCACACAAAAAAACCCAGG - Intergenic
987010682 5:13760768-13760790 CTCTCCTCACTTAAGAAGCAGGG + Intronic
987209762 5:15668700-15668722 TTTTCCTCATATAAAAAGCCTGG - Intronic
990140618 5:52698998-52699020 GTTCCCACACATATGAAACCAGG - Intergenic
990792276 5:59495651-59495673 CTTGCCACCCAGAAGAAACCTGG - Intronic
992024210 5:72654496-72654518 CTTTCCACAGCTAAGGAGACAGG + Intergenic
992195374 5:74334062-74334084 ATTTTCTCACATAAGAAGTCTGG + Intergenic
996405084 5:123095817-123095839 CTCTCCACACACCAAAAGCCCGG + Intronic
997471773 5:134121105-134121127 CTTTCCCCTCCTAAGAATCCTGG - Intronic
1003584839 6:7378612-7378634 CTTTCCTTACATAAGAAGCTTGG + Exonic
1003688676 6:8329952-8329974 TTATGCATACATAAGAAGCCAGG - Intergenic
1005043033 6:21616367-21616389 TTTTCCCCACATAAGAAGTTTGG - Intergenic
1005615763 6:27571571-27571593 CTATCCACACATCAAGAGCCAGG - Intergenic
1007235876 6:40391259-40391281 CTCCCCACACGTAAGAACCCAGG + Intergenic
1009645074 6:66391067-66391089 CTATCCAGGCATAAGCAGCCTGG - Intergenic
1012480581 6:99662584-99662606 CTTACAACACATAATAACCCTGG - Intergenic
1013311451 6:108898357-108898379 GTGTCCACACAGAAGATGCCTGG - Intronic
1013799799 6:113930054-113930076 CTTTCCATACAGAAAAAGCGAGG - Intergenic
1014266672 6:119285695-119285717 CTTTCCATATATAAGAAAGCAGG + Intronic
1014976153 6:127886639-127886661 CTTTCCACACAAAAAAACCTCGG + Intronic
1018725529 6:166610237-166610259 CTTTCCACTCCTGAGCAGCCTGG + Intronic
1022340626 7:29464062-29464084 CAATGCACACATAAGAAGACTGG - Intronic
1023100253 7:36710567-36710589 GTTTCTGCACATCAGAAGCCTGG - Intronic
1023204140 7:37729845-37729867 CATTCCAAATACAAGAAGCCAGG - Intronic
1024995103 7:55268101-55268123 CTTGACAGGCATAAGAAGCCAGG - Intergenic
1026126989 7:67587729-67587751 CATTCTACACATAAGAAGAATGG - Intergenic
1028380043 7:90190074-90190096 CTTTCCTCACTGCAGAAGCCAGG + Intronic
1029200026 7:98833272-98833294 CTTTCCAGGCATAAGTATCCAGG - Intergenic
1036940868 8:13050411-13050433 CTTTAAACACTTTAGAAGCCAGG - Intergenic
1038575457 8:28700814-28700836 GTTTCCACACTTGAGAAGTCAGG - Intronic
1041413250 8:57579570-57579592 CATTACACACAAAAAAAGCCTGG + Intergenic
1043457653 8:80428328-80428350 TTTTCTACTCATAAGATGCCTGG + Intergenic
1044481153 8:92690180-92690202 CTTTCCACAAAGAAAAACCCAGG - Intergenic
1044661634 8:94597220-94597242 CTTTCCCCACAAAAGTGGCCGGG + Intergenic
1048082178 8:131140200-131140222 CTATCTAAACATAAGAAGGCAGG - Intergenic
1048678785 8:136815063-136815085 CATTTCACAGATGAGAAGCCTGG + Intergenic
1049035362 8:140071391-140071413 CCTTGCCCACAGAAGAAGCCTGG - Intronic
1050213865 9:3298706-3298728 CTTTCCACACTTTAGAAGATGGG - Intronic
1051500368 9:17770432-17770454 CTTGCCACACTTACCAAGCCTGG - Intronic
1055476510 9:76668537-76668559 CTTTTCACAGATCAGAATCCTGG - Intronic
1055490978 9:76805112-76805134 CTGTTCCCACATAAGAAGCCTGG + Intronic
1056942950 9:90970889-90970911 TTCTCGACACATAAGAGGCCTGG + Intergenic
1057219138 9:93246554-93246576 CTCTCCACACCTGAGGAGCCTGG + Intronic
1061936593 9:133861049-133861071 CTCTCCACACATCAGAACCGGGG - Intronic
1062136932 9:134934065-134934087 CATGCCCCACATGAGAAGCCAGG + Intergenic
1187760032 X:22572666-22572688 TTTTCCACACATAGGAATCGGGG - Intergenic
1189217786 X:39342039-39342061 ATATTCACACTTAAGAAGCCTGG - Intergenic
1199702679 X:150395560-150395582 CTTTCCAAACAGAAGGCGCCAGG - Intronic