ID: 1131464012

View in Genome Browser
Species Human (GRCh38)
Location 15:92640116-92640138
Sequence TTGTATCAGCATAAATTAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 194}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131464011_1131464012 -9 Left 1131464011 15:92640102-92640124 CCATATCTCACACTTTGTATCAG 0: 1
1: 0
2: 1
3: 16
4: 220
Right 1131464012 15:92640116-92640138 TTGTATCAGCATAAATTAGACGG 0: 1
1: 0
2: 0
3: 11
4: 194
1131464010_1131464012 -8 Left 1131464010 15:92640101-92640123 CCCATATCTCACACTTTGTATCA 0: 1
1: 0
2: 0
3: 20
4: 269
Right 1131464012 15:92640116-92640138 TTGTATCAGCATAAATTAGACGG 0: 1
1: 0
2: 0
3: 11
4: 194
1131464009_1131464012 -5 Left 1131464009 15:92640098-92640120 CCACCCATATCTCACACTTTGTA 0: 1
1: 0
2: 3
3: 17
4: 189
Right 1131464012 15:92640116-92640138 TTGTATCAGCATAAATTAGACGG 0: 1
1: 0
2: 0
3: 11
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131464012 Original CRISPR TTGTATCAGCATAAATTAGA CGG Intronic
902198190 1:14814000-14814022 GGGTATCACCATAACTTAGAGGG + Intronic
902774513 1:18666215-18666237 TTGAAACAGAATGAATTAGATGG - Intronic
907009391 1:50949260-50949282 TTGCATCAGAATAATTTGGAGGG - Intronic
907881576 1:58554265-58554287 TTATTTCAGCATAAAATAGGAGG + Intergenic
908017067 1:59853872-59853894 ATGTAACAGCATAAAGCAGAGGG - Intronic
909347886 1:74614025-74614047 GTGTATCAGCATCACCTAGAGGG + Intronic
911306667 1:96240659-96240681 TTGCAGAAGCATAAGTTAGATGG + Intergenic
911457647 1:98147199-98147221 TTGTATCTACATAAATTATTTGG - Intergenic
912204036 1:107491203-107491225 TTGGATCAGCCTAAATGAGCTGG + Intergenic
915827810 1:159097294-159097316 TCATAACAGAATAAATTAGAAGG + Intronic
916078729 1:161218691-161218713 TTGTCTCTGCAGAAATCAGATGG + Exonic
916605139 1:166334990-166335012 TTGTATCTGGACAAATAAGAAGG + Intergenic
918462844 1:184794070-184794092 TTGTTCTAGCATAAATTAAAAGG - Exonic
918783274 1:188731115-188731137 TTGAATCAGCATACAGTATATGG - Intergenic
920604134 1:207363604-207363626 TTGTATCACCAAAATCTAGAAGG - Intergenic
921007233 1:211106428-211106450 AGGTAACAGCATGAATTAGAAGG + Intronic
921153488 1:212419889-212419911 TGGGATCAGTAGAAATTAGAAGG + Intergenic
923024186 1:230191482-230191504 TTATTTGAGCAGAAATTAGAGGG + Intronic
1063806924 10:9655703-9655725 TTTTATCATCATAAAATTGAAGG + Intergenic
1066159257 10:32710980-32711002 ATGTATCAGCATAGATGGGAGGG + Intronic
1067393757 10:45891625-45891647 TATTATCAGTATAAATGAGATGG + Intergenic
1067862081 10:49860781-49860803 TATTATCAGTATAAATGAGATGG + Intronic
1068527433 10:58146259-58146281 TTCTATCATTATAAAGTAGATGG + Intergenic
1069735462 10:70651066-70651088 CTGTATCATCATGAATTTGATGG + Intergenic
1074828136 10:117229226-117229248 TTGTTTCATCATAAATTGGGTGG + Intergenic
1079929894 11:26545004-26545026 TTGTATTACCAAAATTTAGATGG + Intronic
1080505160 11:32905306-32905328 TTGGATCTGCTTAAATTAGATGG + Intronic
1081136574 11:39446942-39446964 ATGTATCAGCAAAATTTAAATGG + Intergenic
1083136781 11:60685998-60686020 TTGTAGCAGGATAATTTTGAGGG + Intergenic
1083180809 11:60983690-60983712 TTGTATCAGCATTAATTATCTGG - Intronic
1086261067 11:84941459-84941481 TTTTTTCAGCATCAATTAAAAGG + Intronic
1087033335 11:93728837-93728859 TTGTAATAGAATAAAATAGAAGG - Intronic
1087496219 11:98893880-98893902 TTGCATCAGCATAACTTGGATGG - Intergenic
1089355212 11:117845645-117845667 TTGTAATAGCATAAAATTGAGGG - Intronic
1090947376 11:131443290-131443312 TTGTAACAGAATAAAGAAGAGGG + Intronic
1091083936 11:132701903-132701925 ATTTATCAGCTTAAAGTAGACGG - Intronic
1094049733 12:26205732-26205754 ATGTATGATCATAAATGAGAAGG + Intronic
1094354251 12:29560873-29560895 TTGTCTAAGCAAAAAATAGAAGG + Intronic
1096961548 12:55583408-55583430 TAGCATCATCATAAATTTGATGG + Intergenic
1096993145 12:55821317-55821339 TTATATCAGGATAAAGGAGAGGG + Exonic
1097373124 12:58808403-58808425 TTCCTTCAGCATAAACTAGATGG + Intronic
1097927565 12:65146623-65146645 TTGACTCAGCTTAAGTTAGAGGG - Intergenic
1099328012 12:81244401-81244423 TTGTGTCAGCATTAATTTGGGGG + Intronic
1099567087 12:84265043-84265065 TTTTATAAACATAAATTACAAGG - Intergenic
1100164632 12:91902247-91902269 TTGTATTAGGATATATTTGATGG - Intergenic
1101220472 12:102633676-102633698 TTTTATCACCATGAATTAAATGG + Intergenic
1102521606 12:113480641-113480663 CTTTATCAGAATAAATCAGAGGG - Intergenic
1104342420 12:127963172-127963194 TTTTCTCAGTATAAATCAGAAGG + Intergenic
1107002002 13:35558712-35558734 TTGTATCAGAACCAACTAGAGGG - Intronic
1107235414 13:38162692-38162714 TTGTTTCAGCATACATTATTTGG + Intergenic
1107346781 13:39470032-39470054 ATGTATCTGCAGAACTTAGAGGG + Intronic
1109711483 13:66165815-66165837 CTACTTCAGCATAAATTAGAAGG + Intergenic
1111247587 13:85560872-85560894 TTCTATCACTATAAATTAGTTGG + Intergenic
1111377032 13:87393776-87393798 TTATAAGAGCATAAATTTGAAGG + Intergenic
1112693772 13:101924954-101924976 TTTTTTCAGCATAAATTTCAGGG - Intronic
1112841362 13:103582805-103582827 TTGTAACAGCACAAAGTAGTAGG + Intergenic
1112989873 13:105499791-105499813 ATATATCAGCACAAATTAGCAGG - Intergenic
1113717228 13:112519971-112519993 TTGTATCAGCATAACTTGACTGG - Exonic
1114871417 14:26663909-26663931 TTGTAGCAGCATCAATGAGGAGG + Intergenic
1115368765 14:32588356-32588378 TTGCAAAAGCATAAATAAGAAGG - Intronic
1115922377 14:38390402-38390424 TTGTATCATTATAAGTTAGTTGG + Intergenic
1116128243 14:40817623-40817645 TTGTATCAGCATAAAATATTGGG + Intergenic
1117929519 14:60825591-60825613 TTATATCTTCATAAAATAGATGG + Intronic
1121220996 14:92285270-92285292 TTGCCTAAGCATAAAATAGAAGG + Intergenic
1121305594 14:92904551-92904573 TTGGATCACCAGAAATCAGATGG + Intergenic
1125100163 15:35903057-35903079 TGGTTTCAGCAAAAATTACAAGG - Intergenic
1131464012 15:92640116-92640138 TTGTATCAGCATAAATTAGACGG + Intronic
1138860863 16:60754886-60754908 TTCTATCATCAGAAATTAGTTGG - Intergenic
1139054679 16:63168109-63168131 TTGTATCAGTATAAGTTTGTAGG - Intergenic
1139208781 16:65055686-65055708 TTGTTTCAGCATAAATTCTGAGG - Intronic
1141305881 16:82863665-82863687 TAGTAACAGCAGAAATTATAAGG - Intronic
1150304032 17:64069335-64069357 TGGTATCAGCATAGACTAAAAGG + Intronic
1155749436 18:29401751-29401773 TTTTATCAGCATAAGTTCTATGG + Intergenic
1156022355 18:32614490-32614512 ATGTATAAACATAGATTAGAAGG - Intergenic
1156602120 18:38619995-38620017 ATATATCAACATAAATTATATGG + Intergenic
1157460925 18:47892842-47892864 TTTCATAAGCATAAATTAAAAGG - Intronic
1158687575 18:59628642-59628664 TTGTCTCAGGTTAGATTAGAAGG - Intronic
1159370594 18:67523009-67523031 TTGTATCACCATGAAGGAGAAGG - Intergenic
1159471591 18:68864245-68864267 TTGTTTCAGAATAAACTAGAAGG - Intronic
1165540133 19:36486286-36486308 TTCTATCAGCATAAATTTCCTGG + Intronic
925229322 2:2218729-2218751 TTAAAACAGCATAAATGAGAGGG + Intronic
926907421 2:17818385-17818407 TTGTATCAGCAAAAAAAAAATGG - Intergenic
929846122 2:45529895-45529917 TGGTATCACCAAAAATTTGAGGG - Intronic
931100164 2:58990013-58990035 ATATATTAGAATAAATTAGATGG + Intergenic
931102397 2:59017120-59017142 TTGGAACAGAATAAATTAAATGG + Intergenic
931407401 2:61992955-61992977 TTTTATAAGTATAAATCAGAGGG - Intronic
934552808 2:95272501-95272523 TTCTAACAGCCTAAATTGGAGGG + Intergenic
936473697 2:112821580-112821602 TTGTACCTACATAAATCAGATGG - Intergenic
939073009 2:137566429-137566451 TTTTATAAGCATAAATAACAAGG + Intronic
939109183 2:137986859-137986881 ATGTATCAGCATAAATCAATGGG - Intronic
939815479 2:146891237-146891259 TTGCATGAGCATAAAGTAAAAGG + Intergenic
941107992 2:161382570-161382592 TTGTACCAGAAAAAATTAAATGG + Intronic
941200081 2:162497379-162497401 TGAAATCAGCATAAAGTAGATGG + Intronic
943821176 2:192323610-192323632 CTGTGTCATTATAAATTAGACGG - Intergenic
944353871 2:198762152-198762174 TTATATTACCATAAATTACATGG + Intergenic
947197080 2:227578978-227579000 TTGTGTCAGAATAACTCAGAGGG + Intergenic
1168743632 20:216607-216629 TTTTATCTGCATAAAATATATGG - Intergenic
1172865108 20:38089903-38089925 TTGTACCAGCAGAAAGAAGAGGG + Exonic
1172991867 20:39042573-39042595 CTGTTTCATCACAAATTAGAAGG - Intergenic
1174670024 20:52298348-52298370 TTGTATCAGCAAGAAATACATGG + Intergenic
1177696132 21:24574415-24574437 TTGTGGCAGAATAAAGTAGATGG - Intergenic
1178634577 21:34290940-34290962 TTGTATCAGCATCTAATACATGG + Intergenic
1181296201 22:21841443-21841465 TAGTATCAACATAAATTATTTGG - Intronic
1184811477 22:46836389-46836411 TGTTATCAGCCTAAAATAGATGG + Intronic
949531059 3:4955709-4955731 TTGTATCAGATTAAATTATTTGG - Intergenic
950256383 3:11510106-11510128 TGGTGTCTGCAGAAATTAGAAGG + Intronic
951228914 3:20153840-20153862 TTCTATCAGCATAAATAAAATGG + Exonic
951379330 3:21964097-21964119 TTGTATTAGATTGAATTAGAAGG - Intronic
951990866 3:28675177-28675199 TGTTATAAACATAAATTAGATGG + Intergenic
952012152 3:28911814-28911836 TTGTTTCAGCCGGAATTAGATGG + Intergenic
952310785 3:32187421-32187443 TTGTACCAGCACAAATATGAAGG + Intergenic
952583975 3:34869182-34869204 TTTAATCAGCATAATTTAAAGGG - Intergenic
955456805 3:59130736-59130758 ATGTCTAAGCATAAATAAGATGG - Intergenic
955649147 3:61174770-61174792 TTGTAGCTACATAAATTAAATGG + Intronic
956688068 3:71850481-71850503 TTGTGTCAAAATAACTTAGAAGG - Intergenic
957836815 3:85604873-85604895 TTATATCATCATATAATAGATGG + Intronic
958178576 3:90027587-90027609 TTGTATCAACATCAATAACATGG - Intergenic
959132873 3:102379469-102379491 ATCTATCAGTATAAATTATATGG - Intronic
959908347 3:111734796-111734818 GTGGATAAGCATAAATTGGAGGG + Intronic
960408572 3:117292820-117292842 TTGTAACAGTATTAATTATAGGG - Intergenic
963686741 3:148444741-148444763 TGGCATCAGCATAAATTTCATGG + Intergenic
964163940 3:153678757-153678779 TTGTATCCTCCCAAATTAGAGGG - Intergenic
964440950 3:156709008-156709030 TTTCATCAGCATTAATTAGTTGG + Intergenic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
964797917 3:160519875-160519897 TTGTATCAAAATAAATTTGGAGG + Intronic
965128110 3:164656560-164656582 TTGTTTCTGTATATATTAGATGG - Intergenic
972389635 4:38602546-38602568 TGGTATCAGCGTGAACTAGAGGG + Intergenic
973298114 4:48549655-48549677 TTATATTGGCAGAAATTAGATGG - Intronic
975647337 4:76558184-76558206 TTATATCACCATCTATTAGAAGG - Intronic
975749286 4:77506402-77506424 TAGTATCAAAATAACTTAGAAGG + Intergenic
976988468 4:91331946-91331968 ATGTATCAGCCTAATTTTGATGG - Intronic
977525910 4:98144637-98144659 TTGTATCCTCATAACTTAGCAGG - Intergenic
977977801 4:103287131-103287153 TTGTATCAGCATGACCCAGATGG + Intergenic
979087528 4:116432037-116432059 CTGTATCAAAAGAAATTAGAAGG + Intergenic
980806425 4:137820555-137820577 TTGTATCACCATCAATTCAAAGG - Intergenic
981481360 4:145242687-145242709 TAGCATCAACATAAATTAAAAGG - Intergenic
982556434 4:156872186-156872208 TTATATTAGCATATATTAAATGG - Intronic
986544682 5:8882569-8882591 TTGTATCACCCTATTTTAGAAGG - Intergenic
986970524 5:13331431-13331453 TTGTATAAGAATAAATTTTATGG - Intergenic
987765744 5:22226939-22226961 TTGTCTCAGTATAAACAAGAGGG + Intronic
987851526 5:23361666-23361688 TTGCATCAGCATGACCTAGATGG - Intergenic
988246973 5:28698229-28698251 TTATATCAGCATAAAATCTAAGG + Intergenic
989741650 5:44780368-44780390 TTAGATCAACATAAATTTGAAGG + Intergenic
991169788 5:63609136-63609158 TTTTATAAGCAAAAATTAGAAGG - Intergenic
991293507 5:65057311-65057333 TTATATCATGATAAATTAAAGGG - Intergenic
993243360 5:85419581-85419603 TTCTATCAACATAACTTAGTAGG - Intergenic
993767635 5:91880632-91880654 TTGTGTCATCATCAAATAGATGG - Intergenic
995323214 5:110860538-110860560 TTGTAACAGCAAAAATTGGAAGG + Intergenic
995447640 5:112263676-112263698 TTGTATTAGCATGCACTAGAAGG - Intronic
996465636 5:123799423-123799445 CAGTATCAGCATCACTTAGATGG - Intergenic
997376709 5:133402760-133402782 TTGAATCATAATAAACTAGAAGG + Intronic
997717756 5:136054723-136054745 TTGTATGGGCATCAATTGGAGGG - Exonic
1000149810 5:158488596-158488618 TGGTTTCAGCCAAAATTAGAAGG + Intergenic
1003437762 6:6109271-6109293 TTGTATCAGCTTAAAATAATGGG - Intergenic
1004868501 6:19878414-19878436 GTGTATCAGCATATATTATTTGG - Intergenic
1005250357 6:23938562-23938584 TTATTTCAGCATCACTTAGAGGG + Intergenic
1005267856 6:24131758-24131780 TTGTATAAGCATTAAATAGAAGG + Intronic
1007990355 6:46248883-46248905 TTTTATCAGGAAAAATTTGAGGG - Exonic
1008751436 6:54737830-54737852 TTGGATTAGCAAAAATTAGGTGG - Intergenic
1009967687 6:70594337-70594359 TTGTAACAGTATTAATGAGATGG + Intergenic
1010956572 6:82097158-82097180 TTGCATCAGCACGAATAAGAAGG - Intergenic
1011187229 6:84690994-84691016 TTGTAACACCATAAAATATATGG + Intronic
1013269678 6:108534333-108534355 TTGTCATAGCATAAGTTAGAGGG + Intergenic
1014318754 6:119899054-119899076 GTTTATCAGCATAGAGTAGAGGG - Intergenic
1015336264 6:132042748-132042770 TTGTATCACAAAAAAATAGATGG - Intergenic
1016068900 6:139713892-139713914 TTGTATCATAATATATTACAGGG - Intergenic
1016511201 6:144845351-144845373 GTCTATCAGCAAAAATTAGTTGG - Intronic
1017238163 6:152139038-152139060 TTGTATCTGCATGAATTTGTGGG - Intronic
1019877688 7:3829184-3829206 TTTTTTCATCATAAATTTGAAGG - Intronic
1022754761 7:33275390-33275412 TTGTATCAGATTTACTTAGAAGG + Intronic
1023629212 7:42146931-42146953 CTGTATCTGCAGAAATAAGATGG + Intronic
1024289041 7:47787021-47787043 TTGTATCTTTATAAACTAGAAGG - Intronic
1027332424 7:77112696-77112718 TTGTATCAGTGTAAAATAAAAGG + Intergenic
1027974229 7:85128799-85128821 CTGTATCAGCATAAATAATTGGG + Intronic
1028757268 7:94452111-94452133 TTGAATAATGATAAATTAGAAGG + Intergenic
1030275062 7:107711846-107711868 TAGTATGAGAATGAATTAGAGGG - Intronic
1032003173 7:128279341-128279363 TTGTATCAGCATCAATTTCCGGG + Intergenic
1032182927 7:129696818-129696840 TTGTATCTTTATAAATGAGAAGG + Intronic
1032873692 7:136013649-136013671 TTCTATATGCAAAAATTAGATGG - Intergenic
1035849934 8:2908424-2908446 TTGTGTAAACATAAATTGGAAGG - Intergenic
1039340902 8:36648803-36648825 TTGAAACAGCATAAATTGGAGGG + Intergenic
1041174486 8:55180287-55180309 ATGAATGAGCATAAATTGGATGG + Intronic
1041470317 8:58200873-58200895 TGCTATCAGGATAAATAAGATGG - Intronic
1043208400 8:77477141-77477163 TTGTATCATAATAAATTAGTTGG - Intergenic
1043813669 8:84774840-84774862 TTGTATAAGCAGATATGAGAAGG - Intronic
1044420866 8:91994411-91994433 TATTATCAGCATAAATCAGCTGG + Intronic
1044799452 8:95938334-95938356 TTGTGTCAGCATTATTCAGAAGG - Intergenic
1046372255 8:113324881-113324903 TTGCATCAGCATGACTCAGATGG + Intronic
1046884630 8:119351980-119352002 TTGTATCATTATACATTAGTGGG + Intergenic
1051779684 9:20676037-20676059 TTTTATCACCATAAGTTATAAGG - Intronic
1051989642 9:23136851-23136873 TTTTATAAACATAAATCAGATGG + Intergenic
1056367998 9:85925305-85925327 TTGTATCTGGATAAAATAAATGG + Intergenic
1058213409 9:102201730-102201752 TTGTAACAGCTTTAATTATACGG - Intergenic
1058793591 9:108474901-108474923 TCGTTTCTGCTTAAATTAGATGG - Intergenic
1060246535 9:121951130-121951152 ATTTCTCAGCATAAATTAAATGG + Intronic
1186008386 X:5100929-5100951 TTTTATTTACATAAATTAGAGGG - Intergenic
1186815538 X:13234288-13234310 TTGAAGCAAAATAAATTAGATGG - Intergenic
1186970387 X:14835486-14835508 GTGTATCAGAATAACCTAGAGGG + Intergenic
1188150285 X:26666218-26666240 TAGCATAAGCAAAAATTAGAAGG + Intergenic
1189155762 X:38755470-38755492 TTGTATCAGAATCACATAGAGGG - Intergenic
1191987755 X:67000815-67000837 TTGTATCAGCTGATATTAGGTGG - Intergenic
1194097785 X:89665372-89665394 TTATAGCAGGATAAATTATATGG - Intergenic
1196233605 X:113253700-113253722 TGTTATCAGCATAAAATAAAAGG - Intergenic
1199043277 X:143139486-143139508 TTGCATCAGCATAACCTGGATGG + Intergenic
1199047006 X:143186335-143186357 TTGTATCAATATCAATTACATGG - Intergenic
1200450805 Y:3326760-3326782 TTATAGCAGGATAAATTATATGG - Intergenic