ID: 1131467528

View in Genome Browser
Species Human (GRCh38)
Location 15:92667688-92667710
Sequence GATGCATCCTAGACCCACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 78}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131467520_1131467528 13 Left 1131467520 15:92667652-92667674 CCCACAGTGTGGAGCCCAAACCT 0: 1
1: 0
2: 1
3: 8
4: 131
Right 1131467528 15:92667688-92667710 GATGCATCCTAGACCCACTTTGG 0: 1
1: 0
2: 0
3: 6
4: 78
1131467518_1131467528 20 Left 1131467518 15:92667645-92667667 CCTGTTCCCCACAGTGTGGAGCC 0: 1
1: 0
2: 1
3: 35
4: 194
Right 1131467528 15:92667688-92667710 GATGCATCCTAGACCCACTTTGG 0: 1
1: 0
2: 0
3: 6
4: 78
1131467519_1131467528 14 Left 1131467519 15:92667651-92667673 CCCCACAGTGTGGAGCCCAAACC 0: 1
1: 0
2: 1
3: 8
4: 141
Right 1131467528 15:92667688-92667710 GATGCATCCTAGACCCACTTTGG 0: 1
1: 0
2: 0
3: 6
4: 78
1131467523_1131467528 -2 Left 1131467523 15:92667667-92667689 CCAAACCTTCACCCCTGTGTTGA 0: 1
1: 0
2: 1
3: 9
4: 139
Right 1131467528 15:92667688-92667710 GATGCATCCTAGACCCACTTTGG 0: 1
1: 0
2: 0
3: 6
4: 78
1131467524_1131467528 -7 Left 1131467524 15:92667672-92667694 CCTTCACCCCTGTGTTGATGCAT 0: 1
1: 0
2: 1
3: 5
4: 153
Right 1131467528 15:92667688-92667710 GATGCATCCTAGACCCACTTTGG 0: 1
1: 0
2: 0
3: 6
4: 78
1131467522_1131467528 -1 Left 1131467522 15:92667666-92667688 CCCAAACCTTCACCCCTGTGTTG 0: 1
1: 0
2: 2
3: 16
4: 236
Right 1131467528 15:92667688-92667710 GATGCATCCTAGACCCACTTTGG 0: 1
1: 0
2: 0
3: 6
4: 78
1131467521_1131467528 12 Left 1131467521 15:92667653-92667675 CCACAGTGTGGAGCCCAAACCTT 0: 1
1: 0
2: 2
3: 7
4: 135
Right 1131467528 15:92667688-92667710 GATGCATCCTAGACCCACTTTGG 0: 1
1: 0
2: 0
3: 6
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131467528 Original CRISPR GATGCATCCTAGACCCACTT TGG Intronic
901269836 1:7943154-7943176 GATCCCTCCTTGCCCCACTTTGG + Exonic
905549796 1:38828009-38828031 GTTGCACACTAGAACCACTTGGG - Intergenic
906607520 1:47182334-47182356 GCTGCATCCTAAACCCAATGAGG + Intergenic
908031507 1:60004903-60004925 GCTGCATGTTAGACCCACCTGGG + Intronic
912222590 1:107695402-107695424 AATGCATCCTAGAGAGACTTAGG + Intronic
920258405 1:204672372-204672394 GTTGCTCCCTAGCCCCACTTGGG - Intronic
924146697 1:241083926-241083948 GAAGCATCTTAGAACCACCTAGG + Intronic
924658604 1:245995803-245995825 GATGCATCCTTGCCACACATAGG - Intronic
1064770743 10:18719802-18719824 GATGAATCCTAGATCCACCAAGG + Intergenic
1068196421 10:53723311-53723333 GATGCATATTAGACTCACTGGGG - Intergenic
1078844550 11:15109522-15109544 GATGCATCATTAACTCACTTGGG - Intergenic
1085363190 11:75911517-75911539 CACGGATCCTCGACCCACTTTGG - Intronic
1088992110 11:114962655-114962677 AATGCATCCTAGAGCCAGTGAGG + Intergenic
1097602108 12:61705939-61705961 GATGCATGCTAGAATCACCTGGG + Intergenic
1100694729 12:97079961-97079983 GATGGAGCTTAGACCCATTTTGG + Intergenic
1102949880 12:117024325-117024347 GGTGCATTCTAGACACTCTTGGG + Intronic
1103211227 12:119167988-119168010 GATTCATGCTAGAGCAACTTGGG - Intergenic
1104063813 12:125289788-125289810 CATGCACCCTGGAGCCACTTGGG - Intronic
1106891213 13:34247717-34247739 GATGCATATTAGACTCACCTGGG + Intergenic
1111757339 13:92414987-92415009 GATACATCCTAGCCCCATTTAGG - Intronic
1113887758 13:113669981-113670003 AATGCACCCTGGACCCACATCGG + Intronic
1124603963 15:31156986-31157008 GCTGCATCCTTGACCTCCTTGGG + Intronic
1126334002 15:47566275-47566297 GATTCATGCTAGGCCCACTTTGG + Intronic
1129669338 15:77598509-77598531 GCTGCAGCCTGGACCCTCTTGGG + Intergenic
1131467528 15:92667688-92667710 GATGCATCCTAGACCCACTTTGG + Intronic
1141036205 16:80628452-80628474 GATGCATCCAACAACCACGTGGG + Intronic
1149759460 17:59216498-59216520 ACTGCAGCCTAGACCCACTGGGG - Intergenic
1151220819 17:72611690-72611712 GATCCATGCTAGTCCCACTTGGG + Intergenic
1151893278 17:76963716-76963738 GCTGCCTCCTAGGCCCACCTTGG - Intergenic
1157075650 18:44464426-44464448 GATGCAATATTGACCCACTTTGG - Intergenic
1158226559 18:55207312-55207334 GATGACTCCTAGACCCAGTGTGG + Intergenic
1158848721 18:61472238-61472260 GATGCAGCCTAAAGCGACTTAGG - Intronic
1159622304 18:70652131-70652153 CATGCATTCTAGACCTAATTTGG - Intergenic
1162335704 19:10058959-10058981 GAAGCATCCCACACCCACTAGGG - Intergenic
1162785519 19:13032346-13032368 GATTCATCCTACAAACACTTTGG + Intronic
1165789695 19:38483895-38483917 GATGCACCCTAGAGTCTCTTGGG + Intronic
930991241 2:57657681-57657703 GATACATCCTAGAATCACTTGGG - Intergenic
935352581 2:102166215-102166237 CATGCATCCTACACATACTTGGG + Exonic
941655957 2:168145097-168145119 GCTGGCTCCAAGACCCACTTTGG - Intronic
942010991 2:171762157-171762179 TATGCTGCCTGGACCCACTTAGG + Intergenic
943404956 2:187470510-187470532 GGTGAATCCTAGAACCATTTGGG + Intronic
943675850 2:190715939-190715961 GCTGCATCTTAGATTCACTTGGG + Intergenic
948515400 2:238500248-238500270 AATGCAGCCCAGCCCCACTTTGG + Intergenic
1173155794 20:40607579-40607601 GATGCATCCTTGACCCACCCTGG + Intergenic
1173509949 20:43619507-43619529 GAGGCAGCCTAGAGCCAATTAGG + Intronic
1173524708 20:43722787-43722809 AATTCATCCCAGCCCCACTTTGG - Intergenic
1174212573 20:48891631-48891653 AATGCTTCCTAGAACCAGTTGGG + Intergenic
1174900222 20:54491728-54491750 GATGCTGCGGAGACCCACTTGGG - Intronic
1177518036 21:22179888-22179910 GATGCATATAAGACCCACGTTGG + Intergenic
953233655 3:41086856-41086878 GATGCTTCCTAGACCTACAAAGG + Intergenic
954943245 3:54393986-54394008 GAAGCATCCTAGACCCTGTATGG - Intronic
955027115 3:55178977-55178999 GATGTATCCTCGGCCCTCTTTGG - Intergenic
958907116 3:99954320-99954342 TATTCATGCTAGACACACTTTGG + Intronic
961461294 3:127052024-127052046 GCTGCTTCCATGACCCACTTTGG + Intergenic
966665812 3:182470043-182470065 GTTGCACCATAGCCCCACTTAGG + Intergenic
966687261 3:182709542-182709564 GCTGCTTCCTAGAACCACCTGGG - Intergenic
968975539 4:3820449-3820471 GATGCATCCTTTACTCCCTTGGG - Intergenic
971002495 4:22338657-22338679 GAGACATCATAGTCCCACTTGGG - Intergenic
971946578 4:33286783-33286805 GATCCCTCCTTGTCCCACTTAGG + Intergenic
988307840 5:29516252-29516274 GGTGCATCCTAGACTCCCTCGGG - Intergenic
995712415 5:115049134-115049156 GATGGCTCCTAGAGCCATTTAGG - Intergenic
997574972 5:134967780-134967802 AATCCATGATAGACCCACTTGGG + Exonic
1001214864 5:169846186-169846208 CAGCCATCCTATACCCACTTGGG - Intronic
1004793108 6:19050983-19051005 GATGCATCCTAGGTCCAATGGGG - Intergenic
1005559310 6:27021352-27021374 GATACATGCAAGACCCATTTAGG - Intergenic
1008872655 6:56290474-56290496 GATGCATATTAGAATCACTTAGG + Intronic
1030941457 7:115655222-115655244 GATGCATCCAAGATCCAATTGGG + Intergenic
1033273401 7:139952753-139952775 GATGCCTCCTATGCCCACATGGG - Intronic
1035265893 7:157690236-157690258 GGCCCACCCTAGACCCACTTGGG + Intronic
1036048057 8:5166062-5166084 GAAGCTTCCAAAACCCACTTTGG - Intergenic
1039162359 8:34636764-34636786 GATGCCTCCTAAAACCACCTTGG + Intergenic
1046272662 8:111916707-111916729 CTTGCATCCTAGACACACTGGGG + Intergenic
1048993506 8:139775062-139775084 GATGCTTCCTGGGCCCACTCTGG - Intronic
1050375442 9:4967782-4967804 GCTGCACATTAGACCCACTTGGG + Intergenic
1051434249 9:17013971-17013993 GATGCAGCCTACCCACACTTGGG - Intergenic
1056218381 9:84427187-84427209 AATGGACCCTAGAGCCACTTTGG + Intergenic
1056770808 9:89476782-89476804 GATGCCTCCAATCCCCACTTCGG + Intronic
1058282405 9:103131890-103131912 CATGCATCCTAGCCCTGCTTGGG + Intergenic
1059057350 9:110997907-110997929 CTTTCAACCTAGACCCACTTTGG - Intronic
1187381375 X:18804951-18804973 GGTGCATCCCAGAACAACTTGGG - Intronic
1189029574 X:37436868-37436890 GACGCATCCCAGACCCTCCTTGG + Intronic
1190643062 X:52498936-52498958 GAAGCATCTTACACCCACCTTGG - Intronic
1190644611 X:52513931-52513953 GAAGCATCTTACACCCACCTTGG + Intronic
1192215632 X:69156330-69156352 CATCCATCCTAGTCCCACTGTGG - Intergenic
1201730866 Y:17201361-17201383 GCAGCCTCCTAGACCCACTGTGG - Intergenic