ID: 1131469103

View in Genome Browser
Species Human (GRCh38)
Location 15:92680552-92680574
Sequence TATCCCATTCCCATTGTTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 154}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131469099_1131469103 29 Left 1131469099 15:92680500-92680522 CCTGGAAAGTAAGCTGCCAGTAC 0: 1
1: 0
2: 0
3: 10
4: 137
Right 1131469103 15:92680552-92680574 TATCCCATTCCCATTGTTATAGG 0: 1
1: 0
2: 1
3: 10
4: 154
1131469100_1131469103 13 Left 1131469100 15:92680516-92680538 CCAGTACTGACATGTAACAGCCA 0: 1
1: 0
2: 0
3: 9
4: 86
Right 1131469103 15:92680552-92680574 TATCCCATTCCCATTGTTATAGG 0: 1
1: 0
2: 1
3: 10
4: 154
1131469101_1131469103 -7 Left 1131469101 15:92680536-92680558 CCATCCATTTTCTCGATATCCCA 0: 1
1: 0
2: 3
3: 8
4: 142
Right 1131469103 15:92680552-92680574 TATCCCATTCCCATTGTTATAGG 0: 1
1: 0
2: 1
3: 10
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131469103 Original CRISPR TATCCCATTCCCATTGTTAT AGG Intronic
901309677 1:8259386-8259408 TGTCCCATTCCCTTTCTTCTGGG + Intergenic
902212646 1:14914675-14914697 CATCCCAGTCCCATTGATAATGG + Intronic
906846802 1:49201181-49201203 TATCCCCTTCCCATTTTCCTTGG + Intronic
907421584 1:54351355-54351377 TACCCCATTCCCAAGGTTACCGG + Intronic
908668710 1:66521805-66521827 TATCCTCTTCCCAATTTTATGGG - Intergenic
908671936 1:66557597-66557619 TATCCCAATCCCATTGCCAGAGG - Intronic
908871076 1:68613241-68613263 TGCCTCATTTCCATTGTTATTGG + Intergenic
911869433 1:103075986-103076008 TAAGCCATTCCCAGTATTATAGG + Intronic
912803215 1:112734756-112734778 GATCCTATTACCATTGGTATAGG + Intergenic
914691945 1:150037383-150037405 TCTCCCATTCTCTTTGTTCTTGG - Intergenic
918783901 1:188738996-188739018 TTTTCCTTTCCCATTGATATTGG - Intergenic
919520215 1:198579339-198579361 TATCTCATTCCCCTTTTTAAGGG + Intergenic
919550741 1:198983405-198983427 TATCCCTTTCCCATTGGCATTGG + Intergenic
919576142 1:199311952-199311974 TACTACCTTCCCATTGTTATGGG - Intergenic
920313528 1:205062156-205062178 CATCCCAGTCCCATTGTCACAGG + Intronic
920835498 1:209507130-209507152 TATTGTATTCTCATTGTTATTGG - Intergenic
1065473192 10:26104445-26104467 TATCCTTTCCCCATTGTTCTTGG + Intronic
1068154291 10:53176906-53176928 TATACCATCCCCATAGTTTTGGG - Intergenic
1068939905 10:62670564-62670586 TAACTTATACCCATTGTTATGGG - Exonic
1069153566 10:64997341-64997363 TGTCCTATTCCCACTTTTATTGG + Intergenic
1069179206 10:65334827-65334849 GATGCCATTCCCATTATAATAGG + Intergenic
1071831073 10:89372717-89372739 AATGCCATTCCCATGGTTCTGGG - Intronic
1074628787 10:115225384-115225406 TATCCCATTCCCAATCTTAGAGG - Intronic
1074797839 10:116966821-116966843 TATACCATTGGCATTGTTACCGG - Intronic
1077180902 11:1215239-1215261 TATCCTTTTCCCATTGTTCATGG - Intergenic
1078717529 11:13854260-13854282 TACCCCATTCCCATGGTACTTGG + Intergenic
1079777609 11:24553224-24553246 TATCACTTTCACATTGTTTTTGG - Intronic
1082737670 11:56874254-56874276 TACCCCCTTCCCAGTGTTACTGG - Intergenic
1085958259 11:81427737-81427759 CAGCCCATTCCCAGAGTTATTGG - Intergenic
1087517413 11:99181419-99181441 TATCCCACCCCCATTGGTATTGG + Intronic
1088969325 11:114758385-114758407 TTTCCCAGTCCCAATGTTAAAGG - Intergenic
1093107629 12:15108428-15108450 TGTCCTATTGCCTTTGTTATAGG + Exonic
1095379310 12:41570410-41570432 TATCCCCTTTCCCTTGTTATTGG - Intronic
1095408890 12:41900449-41900471 TATCCCTTTCCCATTGTGTGTGG - Intergenic
1100219294 12:92486629-92486651 CAACCCATTGCCATTGGTATTGG + Intergenic
1100681737 12:96931016-96931038 TATCCCATTTCCATTCTCAGTGG - Intronic
1102930483 12:116858303-116858325 TTTCCTATTCTCTTTGTTATTGG - Exonic
1104871796 12:132004355-132004377 TATCCTTTGCCCACTGTTATTGG + Intronic
1105988475 13:25593216-25593238 TGTCCCATCTGCATTGTTATTGG - Intronic
1106448535 13:29858753-29858775 TACCCCACTCACATTGTTGTTGG - Intergenic
1108776678 13:53773419-53773441 TATCCCATTTAATTTGTTATTGG - Intergenic
1109935725 13:69281379-69281401 TATGCCTTACCTATTGTTATGGG - Intergenic
1110026170 13:70542557-70542579 TATCACACACCCATTGTCATGGG + Intergenic
1110616704 13:77549877-77549899 TATCCCAGTCCCATCCTCATGGG - Intronic
1111085318 13:83369074-83369096 GATGCCATTACCATTGTTTTTGG - Intergenic
1111158626 13:84362910-84362932 CATCGCATTCCCAGAGTTATGGG + Intergenic
1111785669 13:92783661-92783683 TATCATATTCTCATTGTTTTTGG - Intronic
1112360358 13:98711871-98711893 TATTCCACTCCCAATGTTCTGGG - Exonic
1115792989 14:36900534-36900556 AATCCCAGTACCATTGTCATTGG - Intronic
1116612964 14:47101651-47101673 TCTCTCATTCCTATTGTTTTTGG - Intronic
1118295497 14:64564917-64564939 AATACCATTCCCATTATTCTAGG + Intronic
1119812870 14:77538333-77538355 GATCCCATCCCCATTATGATGGG - Intronic
1202927725 14_KI270725v1_random:6464-6486 TATTCCATTGCCAGTGATATGGG + Intergenic
1126212949 15:46120398-46120420 TACCCCTTTCCCAATGCTATAGG - Intergenic
1131469103 15:92680552-92680574 TATCCCATTCCCATTGTTATAGG + Intronic
1139178628 16:64719262-64719284 TTTCCCTTTCCTATTGTTTTGGG - Intergenic
1144090492 17:11851686-11851708 AATCCCATTCTCAATGTTGTCGG - Intronic
1144740859 17:17581459-17581481 TATCCTTGTCCCATTTTTATGGG - Intronic
1147502990 17:40983889-40983911 TATCCTGTTCACATTGTTCTTGG + Exonic
1147937446 17:44020747-44020769 TATCCCACTCCCATTGGTATTGG + Intronic
1148630523 17:49104755-49104777 TATGCCACTGCCATTGTCATGGG - Intergenic
1155673357 18:28399126-28399148 TATCCACTTCCCAATGTTACAGG + Intergenic
1159231197 18:65609190-65609212 TATCTAATTTGCATTGTTATTGG + Intergenic
1162225726 19:9220663-9220685 TATCGCACTCCCATGTTTATTGG - Intergenic
1162804088 19:13127908-13127930 TGTCCCATTCCCATTCTAGTAGG + Intronic
1168442615 19:56383127-56383149 TACCCAATTCCCCTTGTTATTGG - Exonic
1202631470 1_KI270706v1_random:3994-4016 CATGTCATTCCCATTGTTTTGGG + Intergenic
926627858 2:15108376-15108398 TATCCCATATCCATCCTTATTGG - Intergenic
926860317 2:17301890-17301912 TGTCCAATACCCATTTTTATTGG - Intergenic
935448125 2:103178265-103178287 CATCCCAGTTACATTGTTATGGG - Intergenic
941905168 2:170712964-170712986 TTTCACATCCCCATAGTTATGGG - Exonic
943341081 2:186683102-186683124 CTTTCCATTCCCATTGTTACTGG - Intergenic
944906306 2:204265250-204265272 CAGCCCATTCCCATTTTTCTAGG + Intergenic
946872198 2:224094243-224094265 TACCCCATTCCCATGGTGATGGG + Intergenic
1168939976 20:1701026-1701048 GATCCCATTCTCATTGCCATTGG - Intergenic
1171952705 20:31435566-31435588 TTTTCCTTTCCCATTGTTTTGGG - Intergenic
1174564943 20:51457831-51457853 CTTCCCATTCCCATTCTAATTGG - Intronic
1174684220 20:52438149-52438171 AATCCCATTCCCAAAGTTGTTGG + Intergenic
1175337281 20:58204914-58204936 AATCCCATACCCATTTTTCTGGG + Intergenic
1176589745 21:8635124-8635146 TATTCCATTGCCAGTGATATAGG + Intergenic
1176643689 21:9329935-9329957 CATGTCATTCCCATTGTTTTGGG + Intergenic
1177168132 21:17626034-17626056 CTTCCCTTCCCCATTGTTATGGG + Intergenic
1180272579 22:10612139-10612161 TATTCCATTGCCAGTGATATAGG + Intergenic
1180369245 22:11969286-11969308 CATGTCATTCCCATTGTTTTGGG - Intergenic
1182936494 22:34227647-34227669 TAACACATTTCCATTGTTTTAGG - Intergenic
1185307643 22:50129885-50129907 TATCCAATTTTCATTGTTGTGGG + Intronic
949137546 3:586577-586599 TATTCCATTGCCAGTGATATAGG - Intergenic
954893621 3:53956144-53956166 GATCACATTCCCATTTTTCTTGG + Intergenic
956133629 3:66077526-66077548 TATCCCTTTTCCATAGTGATTGG - Intergenic
957732309 3:84154904-84154926 TATTCCATACCCACTGTTAGAGG - Intergenic
958559303 3:95723438-95723460 TATCCAATTCACATTTTTTTGGG - Intergenic
960826671 3:121793423-121793445 TTTCCCCTTCCCATGGTTTTGGG - Intronic
960837583 3:121923090-121923112 TATCCCATTGCCCATGTTCTGGG + Exonic
963888171 3:150603714-150603736 TTCCCCATTCCCACTGTTCTAGG - Intronic
966769230 3:183489198-183489220 TATGCCAGTACCATTGTCATTGG + Exonic
1202743193 3_GL000221v1_random:75094-75116 CATGTCATTCCCATTGTTTTGGG - Intergenic
969231569 4:5835431-5835453 CATTCCATGCCCATAGTTATGGG - Intronic
970638909 4:18041510-18041532 TATCCCTTACACTTTGTTATGGG - Intergenic
970640018 4:18053462-18053484 TATCTCATTCCCTTTGCTGTTGG + Intergenic
971002333 4:22337328-22337350 TATCCCACCCCCATTGGTATTGG + Intergenic
971551721 4:27965813-27965835 GAACCCATACCCATGGTTATGGG + Intergenic
974144735 4:57933138-57933160 GATACCATTACCATTGTGATTGG - Intergenic
975648795 4:76571530-76571552 TCTCCCATTTCTATTTTTATTGG - Intronic
978924189 4:114222696-114222718 CAATACATTCCCATTGTTATAGG + Intergenic
980407620 4:132373951-132373973 TATCCCATTCCCCTTTCAATGGG - Intergenic
980624342 4:135354268-135354290 TCTCCCATTCCCTCTGTAATAGG + Intergenic
982777919 4:159461083-159461105 TATCCCTGCCCCTTTGTTATGGG - Intergenic
984138509 4:175972669-175972691 TATCACATTACCTTTGTTTTGGG + Intronic
987388299 5:17351321-17351343 TATCCCATTGCCACTGCTTTTGG + Intergenic
988268740 5:28986524-28986546 TACTCCATTCCCATTGGTAGTGG - Intergenic
991478545 5:67050486-67050508 TTTCCCCTTCCCATTCTTCTCGG + Intronic
995046736 5:107658417-107658439 TGTCCCATTACCTTTGTTAGTGG + Intronic
996675918 5:126174078-126174100 TAGCCCATTTACATTGTTATTGG - Intergenic
996969057 5:129341791-129341813 TATCTCATGCCCATGCTTATAGG - Intergenic
997008507 5:129848865-129848887 TATCCCATTCTCATTCTTGTAGG + Intergenic
997434591 5:133865247-133865269 TATCCCATTCACATCTTTGTGGG - Intergenic
1002543865 5:179925330-179925352 TATCCCAGTCCCAATCTTTTGGG - Intronic
1003438765 6:6120736-6120758 AATCCCATTGCCACTGTTATGGG - Intergenic
1004149203 6:13098925-13098947 TATCCCATTACCATGGCTACAGG - Intronic
1004991340 6:21141759-21141781 TATCCCATTCACAGTCTTAAGGG - Intronic
1010182198 6:73100163-73100185 TATCCCATTGGTTTTGTTATAGG - Intronic
1011097159 6:83679115-83679137 TATAGCATTCCCATTGTATTAGG + Intronic
1011995543 6:93582590-93582612 CATCAAATTCCCATTGTTCTTGG - Intergenic
1012347314 6:98206701-98206723 TATCCCACTCTCTTTGTTCTTGG - Intergenic
1017073596 6:150598708-150598730 TAACCCAGTCCCATAGTTTTAGG + Intergenic
1017353890 6:153479101-153479123 TATCAAAGTCCCATTGTAATTGG + Intergenic
1018178736 6:161201871-161201893 TTTCCCATTTCCAGTGTTCTTGG + Intronic
1023491561 7:40748134-40748156 TATCTCGGTCCCATTGTTGTGGG + Intronic
1028202600 7:87979522-87979544 TATGACATTGCCATTTTTATAGG + Intronic
1029175901 7:98664285-98664307 TATTCCTGCCCCATTGTTATAGG - Intergenic
1031043719 7:116863897-116863919 TGTCCCATTCCCAATGTGAATGG + Intronic
1031691576 7:124794605-124794627 AATCCCATTCCCAATATTCTGGG + Intergenic
1033137866 7:138799550-138799572 TATGAAATTGCCATTGTTATAGG - Intronic
1036426703 8:8651456-8651478 TTTGCCATTCCCAGTATTATAGG + Intergenic
1037226642 8:16600522-16600544 TTTTCCATTTCCTTTGTTATAGG + Intergenic
1041417485 8:57627545-57627567 TTTCCCATTACTATTGTAATGGG + Intergenic
1042136661 8:65639144-65639166 TATCAGATTCCCATTAATATTGG - Intergenic
1043853726 8:85242398-85242420 TATCCCTCTCCCTCTGTTATTGG + Intronic
1044111350 8:88279261-88279283 TATCCCATTAATATTTTTATTGG + Intronic
1046772666 8:118131975-118131997 TATACCATACCCATTATAATAGG - Intergenic
1046828003 8:118712677-118712699 TCTCCCATTCCCATAGTGAGGGG + Intergenic
1049131392 8:140846678-140846700 TTTCCCATTCCTTTTGTTGTAGG - Exonic
1050627890 9:7525110-7525132 TATCCCATTACTTTTTTTATAGG + Intergenic
1051451884 9:17206173-17206195 TACCCCACCCCCATTGGTATCGG - Intronic
1053470459 9:38342572-38342594 GATCCAATTCCCATTTTTAGTGG - Intergenic
1057667851 9:97060690-97060712 TATCCTTTGCCCATTTTTATTGG + Intergenic
1058094349 9:100842677-100842699 TATCCCAGTCCTATTGTTTGGGG - Intergenic
1061913159 9:133735413-133735435 TCTTGCATTCTCATTGTTATTGG - Intronic
1203711830 Un_KI270742v1:105057-105079 CATGTCATTCCCATTGTTTTGGG - Intergenic
1203619763 Un_KI270749v1:113773-113795 TATTCCATTGCCAGTGATATGGG + Intergenic
1187891981 X:23945143-23945165 AATCCCTTCCCCACTGTTATGGG + Intergenic
1188526492 X:31093660-31093682 TCTCCCACTCCCATTGAGATGGG + Intergenic
1192487346 X:71540158-71540180 AATCCCATTTTCATTCTTATTGG - Intronic
1194087180 X:89542795-89542817 TCTCCAGTTCCCATTATTATTGG - Intergenic
1194740572 X:97568315-97568337 CATTACATTCCCAGTGTTATTGG - Intronic
1194908800 X:99612982-99613004 TATCTCCTTTCCATTTTTATAGG + Intergenic
1196183118 X:112716850-112716872 TATCCCAGCCCCATTGTTTATGG + Intergenic
1197327390 X:125110415-125110437 AATCTCATTCCCATGCTTATGGG + Intergenic
1197631048 X:128858432-128858454 TCTCCCATTCTCATTTATATGGG + Intergenic
1197896947 X:131326444-131326466 TATCTCCTTCCCATTTTTTTAGG - Intronic
1199265918 X:145825052-145825074 TCTCCCTTTCCCAGTGTTAATGG + Exonic
1199779504 X:151045268-151045290 GCTTCCATTCCCATTGATATAGG + Intergenic
1200439828 Y:3198668-3198690 TCTCCAGTTCCCATTATTATTGG - Intergenic
1200441599 Y:3218549-3218571 AATTCCATTTTCATTGTTATGGG + Intergenic
1201010173 Y:9544044-9544066 TTTCCCATTACAATTCTTATGGG - Intergenic
1202042514 Y:20699870-20699892 AATCCCATTACTGTTGTTATGGG - Intergenic