ID: 1131470907

View in Genome Browser
Species Human (GRCh38)
Location 15:92696048-92696070
Sequence CAGTGGGTTTTGAGGGAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 403
Summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 359}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131470907 Original CRISPR CAGTGGGTTTTGAGGGAAAA GGG Intronic
900760026 1:4464120-4464142 CAGTGGGGTTGGAGGGAAGGAGG - Intergenic
901130395 1:6959214-6959236 CAGTGTGTTCTGGGAGAAAAGGG + Intronic
901318283 1:8323683-8323705 CAATGGGTGCTGAAGGAAAAGGG + Intronic
902099364 1:13973278-13973300 CAGTGGATCTAGAGGGGAAAGGG - Intergenic
903975031 1:27143973-27143995 CAGAGGGTATTGAGGTGAAAGGG - Intronic
904623415 1:31789040-31789062 CAGTTGGTATGGAGGGAAACGGG - Intergenic
906539759 1:46576298-46576320 CAGTGGTTGTTGGGGGGAAATGG - Intronic
906765978 1:48434446-48434468 CAGTATGTTTTGAGAGTAAAGGG - Intronic
906806645 1:48785519-48785541 CAGTGGTTGCTAAGGGAAAATGG - Intronic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907273118 1:53302255-53302277 CAGTGCGTTTGGAAGGAAATGGG + Intronic
907494687 1:54836083-54836105 CAGAGGGGTTTGAGGGGAGAAGG - Intronic
908057420 1:60304644-60304666 CAGAGGGTGTTGAGGAAAATAGG - Intergenic
909046771 1:70720283-70720305 CAGTTGGTCTCAAGGGAAAAGGG - Intergenic
910527675 1:88199600-88199622 TAGTTGGTTTTGAGTGAAACTGG - Intergenic
912463770 1:109855216-109855238 CAGTGGGTATAGAGAGACAACGG + Intergenic
912998739 1:114558193-114558215 CAGTGAGTTTGGAAGGAAACTGG + Intergenic
913251178 1:116912878-116912900 AAGTGAGTTTCAAGGGAAAAAGG - Intronic
913264051 1:117027173-117027195 CAGCGGGTTTGGAGGCATAAGGG - Intronic
913343077 1:117779784-117779806 CAGTGGATTTTGAGGTACAGGGG + Intergenic
913566369 1:120076702-120076724 CACTTGGTTTTGAGGAGAAAAGG + Intergenic
913631762 1:120716847-120716869 CACTTGGTTTTGAGGAGAAAAGG - Intergenic
914287130 1:146237418-146237440 CACTTGGTTTTGAGGAGAAAAGG + Intergenic
914548162 1:148688160-148688182 CACTTGGTTTTGAGGAGAAAAGG + Intergenic
914618521 1:149383544-149383566 CACTTGGTTTTGAGGAGAAAAGG - Intergenic
916339187 1:163709932-163709954 CAATGGCTTCAGAGGGAAAAGGG - Intergenic
916592379 1:166204859-166204881 CAGTGGGAGTTGGGGGAAGAGGG - Intergenic
917621525 1:176801425-176801447 GGGTGGGGTTTGAGAGAAAAGGG + Intronic
917746301 1:178011247-178011269 CAGTGGGAAATGAGGGGAAAGGG + Intergenic
918081852 1:181213925-181213947 CAGTGGGGTTTGAGGCATCAAGG + Intergenic
918422385 1:184377160-184377182 GAGTGGATTTTGAGGGAACATGG + Intergenic
918775919 1:188630566-188630588 CAATGGGCTTAGAGGTAAAAGGG + Intergenic
920743801 1:208606622-208606644 CAGTGTGTGTTGAGGGGCAAGGG - Intergenic
921470543 1:215543162-215543184 CTCTGGGTTATGGGGGAAAAGGG - Intergenic
921764105 1:218950448-218950470 AAGGGGGTCTTAAGGGAAAAAGG - Intergenic
922243871 1:223776348-223776370 GAGTGGATTTTGAGGGCAAAGGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924947729 1:248857574-248857596 CCCTGGGGTTTGAGGGAACAGGG - Intronic
1063103255 10:2969990-2970012 CAGTGGCTCTTGAGGAAAACAGG + Intergenic
1063988045 10:11528725-11528747 TAGTGGGGTTTTAGGGGAAATGG - Intronic
1064017760 10:11786017-11786039 CAGAGGGTTTTCAGGCAAGAGGG - Intergenic
1064078180 10:12287022-12287044 TACTTGGTTTGGAGGGAAAAAGG - Intergenic
1064692652 10:17933725-17933747 AAGTGGGTTTTGAAAGAAAGAGG + Intergenic
1066316610 10:34253719-34253741 CAGTGGCTTTTCAGGGCAAGAGG + Intronic
1067083637 10:43227085-43227107 CAGTGGGTTAAGGGGGAAAAGGG + Intronic
1067529249 10:47058623-47058645 CAGTGCATTTGGAGGGAAACTGG - Intergenic
1069629134 10:69887300-69887322 TAGTGGGTTGGGAGGGAAGATGG - Intronic
1069717218 10:70529080-70529102 GAGTGGATATTGAGGGACAATGG + Intronic
1070502486 10:77084519-77084541 CAGTGGCTTGTGGGGCAAAAAGG + Intronic
1071218050 10:83430567-83430589 AAGTGGGTATTAAGGGAAAGAGG + Intergenic
1071476418 10:86029174-86029196 GAGTGGGTTTTGGGGGGAAGTGG - Intronic
1072166030 10:92813952-92813974 CAGTGGGTGGTGGGGGTAAAAGG - Intergenic
1072783490 10:98265856-98265878 CAGTGTGGGTGGAGGGAAAAGGG - Intronic
1073044220 10:100626976-100626998 CAGAGGGTGTTGGGGGAAAAGGG + Intergenic
1073838927 10:107475894-107475916 TAGAGGGTTTGAAGGGAAAAAGG - Intergenic
1074306388 10:112282599-112282621 CAATAGGTTTTGAGGAAATAAGG + Intergenic
1075206600 10:120454657-120454679 AAGTGGTTTTGGAGGGCAAAAGG - Intergenic
1075975481 10:126690386-126690408 CACTGGCTTCTGAGAGAAAATGG - Intergenic
1076002950 10:126926826-126926848 CAGAGGGTTTGGAGGGAGCATGG + Intronic
1077362567 11:2147215-2147237 AAGTGGGTAGAGAGGGAAAAAGG - Intronic
1077597619 11:3547519-3547541 CAGTTTGTTTAGAGGCAAAATGG - Intergenic
1077670899 11:4156737-4156759 CAGTGAGGTTGGAGAGAAAAAGG - Intergenic
1080217500 11:29861996-29862018 CTGTGGGGTTTGAGGGAAACAGG + Intergenic
1080747950 11:35126095-35126117 CAGAGGGTTAAGACGGAAAAAGG + Intergenic
1081224480 11:40503123-40503145 CTGTGTGTTTAGAGGGAGAAAGG - Intronic
1082059118 11:47845652-47845674 CAGTCCGTTTTTAGGGAACAGGG - Intronic
1083173235 11:60934989-60935011 GACCGGGTCTTGAGGGAAAAGGG + Intronic
1084253718 11:67923425-67923447 CAGTTTGTTTGGAGGCAAAATGG - Intergenic
1084522768 11:69674759-69674781 CAGGGGCTCTGGAGGGAAAAGGG + Intronic
1084857311 11:71997478-71997500 CATTGGGTTTCTAGGGAATATGG + Exonic
1086206187 11:84260818-84260840 CAGTGGGGTTTGAGGCATTATGG - Intronic
1086217476 11:84401272-84401294 CAGGGGGTTTTGAGGGCATGTGG - Intronic
1088608731 11:111556693-111556715 AAGTGGGTTTTGAGGGTTTAGGG + Intronic
1088881484 11:113976649-113976671 CAGTAGCTTATCAGGGAAAAGGG + Intronic
1088952179 11:114582941-114582963 CAGTGGTGTTTTAGGGAATAAGG + Exonic
1089218813 11:116853585-116853607 TACTGGGTTTTGAGAGAAAATGG + Intronic
1089231845 11:116984110-116984132 CAGCGGTTTGTGGGGGAAAAGGG + Intronic
1089791363 11:120946970-120946992 AAGTTGGTATGGAGGGAAAATGG - Intronic
1090314672 11:125775109-125775131 CAGTGGATTAAGAGGAAAAAAGG - Intergenic
1090589366 11:128248868-128248890 TAGTAGGTTTTGAGAGAAGAGGG + Intergenic
1090743910 11:129691926-129691948 TAGTGGGTTTTGAGGGAACTGGG - Intergenic
1091081570 11:132673907-132673929 TAGTGGGTTAGGAGAGAAAAGGG - Intronic
1091084478 11:132707136-132707158 AAGGGGGTTTTGAGGAAGAAAGG + Intronic
1091683125 12:2540962-2540984 CTGAGGGTCATGAGGGAAAAGGG + Intronic
1092423791 12:8356812-8356834 CAGTTTGTTTGGAGGCAAAATGG - Intergenic
1096004793 12:48160706-48160728 AAATGTGTTGTGAGGGAAAATGG + Intronic
1096472900 12:51890089-51890111 CACTGGGTTTGGAGTGAAAAAGG + Intronic
1098508086 12:71278364-71278386 CAGTGTGTTTAGGGGGAAATGGG - Intronic
1098795562 12:74884405-74884427 CAGTATGTGTTGAGGGAAAGGGG - Intergenic
1099015481 12:77338922-77338944 GGGTGAGTTTGGAGGGAAAAAGG + Intergenic
1099669896 12:85676922-85676944 CAGTGGTTTTTGAGTGAATAAGG - Intergenic
1099802808 12:87478376-87478398 CAGTAGGTTGTCAGGCAAAATGG - Intergenic
1100268996 12:93005731-93005753 GAGTGGGATTTGATGGGAAAAGG + Intergenic
1104007791 12:124906284-124906306 CAATGGGATTTCAGGGAAAATGG + Intergenic
1104786408 12:131452449-131452471 CAGTGGGTCATGAGGAACAAGGG + Intergenic
1105213956 13:18273711-18273733 CAGTGAGTTTTGAGGGTGGAGGG - Intergenic
1106133976 13:26960899-26960921 CAGGTGGCTGTGAGGGAAAACGG - Intergenic
1106306662 13:28517166-28517188 CAGTAGGTTTTTTGGGAAACAGG - Intergenic
1109059949 13:57603233-57603255 CAGTGGATTTAGAATGAAAAGGG - Intergenic
1109460860 13:62656055-62656077 TAGTGGGTTTTGAGTAAAATGGG + Intergenic
1109758151 13:66788967-66788989 CAGTGGATTTTTAGGGAACCAGG - Intronic
1109995336 13:70116306-70116328 CAGAGAGTTTTGAAGGAAAGGGG + Intergenic
1110290732 13:73803988-73804010 CAGTGGGTTTTAAGTGGAAATGG - Intronic
1112646657 13:101340433-101340455 CTGTGTTATTTGAGGGAAAATGG - Intronic
1113567105 13:111325692-111325714 CGGTGGGTGTGGAGGGAAAATGG + Intronic
1114217521 14:20667925-20667947 CAGTGGGTTTTGTGGGTATGGGG - Intergenic
1114966341 14:27965846-27965868 CTGTGGGTTTTTAGAGAATATGG + Intergenic
1115341657 14:32299226-32299248 CAGTAGGTTTTTGGGGAAACAGG + Intergenic
1116101657 14:40445867-40445889 CAGTGAGATTTGTGGGAAAGAGG - Intergenic
1117267698 14:54107217-54107239 CAGAGGTTTTTCAGGGAAAAGGG - Intergenic
1117300930 14:54426614-54426636 CAGTCAGTTTTAAGGTAAAATGG - Exonic
1117343485 14:54811019-54811041 GAGTCTGTTTTGGGGGAAAAGGG + Intergenic
1117484366 14:56179317-56179339 AAGTGGGTTTTCAGGAAAAATGG - Intronic
1118355075 14:65006816-65006838 CACTGAGATATGAGGGAAAATGG + Intronic
1118982601 14:70728859-70728881 CAGAGAGTCTTGAGGGAAGAGGG + Intronic
1120440773 14:84536128-84536150 CACAGGGTGCTGAGGGAAAAAGG - Intergenic
1120862479 14:89267196-89267218 CAGTGGGTTCTCAGGGTAGACGG + Intronic
1121894317 14:97631561-97631583 GGGTGGATTTTGAGGGTAAAAGG - Intergenic
1124119511 15:26876692-26876714 CAGTGAGTTTTCATGGAAGACGG + Intronic
1124160592 15:27265152-27265174 GAGTGGGTTTTTTGGTAAAATGG - Intronic
1126464615 15:48950609-48950631 CAGTGGGGATGGAGGGAAATGGG + Intronic
1126888206 15:53175237-53175259 CAGTGTGTTTTTAGGTAAAATGG + Intergenic
1127273786 15:57424425-57424447 GTGTGGGTTCTGTGGGAAAAAGG + Intronic
1128091567 15:64922409-64922431 CACTGGGATTTGAGGGAGCAGGG + Intronic
1128917175 15:71573553-71573575 AGGTGGCATTTGAGGGAAAAAGG - Intronic
1129792674 15:78351994-78352016 CTGGGGGTTTTGAGGGGAAATGG + Intergenic
1129898792 15:79129745-79129767 CAGTGGGTTTGGAGGGGCATAGG - Intergenic
1130549088 15:84878376-84878398 TGGTGGGATTTGAGGGACAACGG + Intergenic
1130760001 15:86809343-86809365 CAGGGGCTTTTGAGGGTAGAAGG - Intronic
1131090893 15:89624375-89624397 CAGGGGGAGTTGAGGGAACAGGG - Exonic
1131470907 15:92696048-92696070 CAGTGGGTTTTGAGGGAAAAGGG + Intronic
1132782702 16:1636850-1636872 CAGTGGCTCTTGAGGAAAGAGGG + Intronic
1133838674 16:9388900-9388922 CAGTGGATATTGGTGGAAAAAGG + Intergenic
1134507276 16:14818490-14818512 CAGTGGGAGTTTAGGGAAGATGG - Intronic
1134694977 16:16217248-16217270 CAGTGGGAGTTTAGGGAAGATGG - Intronic
1134976854 16:18577404-18577426 CAGTGGGAGTTTAGGGAAGATGG + Intergenic
1136415158 16:30098386-30098408 CAGTGGTACTTAAGGGAAAAGGG - Intergenic
1137234699 16:46606247-46606269 CAGTGTGTTTTGAAGCAGAAAGG + Intronic
1137976195 16:53034197-53034219 CATTGGGTTTTCTGGGAAGAGGG - Intergenic
1138678626 16:58669567-58669589 GAGTGGGTTGTGGGGGAAGAGGG + Intronic
1139781571 16:69355942-69355964 CAGTGTGTTTTTTGGTAAAATGG - Exonic
1140092892 16:71851915-71851937 CAGTGAGATTTGGGGGAAAGGGG + Exonic
1141852029 16:86652990-86653012 CAGAGGGTCTGGAGGGAAGAAGG - Intergenic
1141998274 16:87648573-87648595 AAGTGGGTTTTCCTGGAAAACGG + Intronic
1203119888 16_KI270728v1_random:1527721-1527743 CTGGGGGTTTTGAGGAACAAGGG - Intergenic
1143130879 17:4676250-4676272 CAGTTGGTTTTTGGGGAAAATGG - Intronic
1143282463 17:5765071-5765093 CACTTGGTTTTGAGAGAATATGG + Intergenic
1143968982 17:10778823-10778845 CAGTGGGTGTTGGGGGACAGTGG - Intergenic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1146019165 17:29261073-29261095 CTGTGTATTTTGTGGGAAAAGGG + Exonic
1151037449 17:70817882-70817904 TAGTGAGGTTTGAGGGATAAAGG + Intergenic
1151281873 17:73082089-73082111 CAGTAGGTTTTGGGGGGAACAGG - Intronic
1152175045 17:78782003-78782025 CAGGGGGTTTTGAGGGATGAGGG - Intronic
1154346838 18:13549636-13549658 CAGTGGGTTCTGCTGGAAGAGGG + Intronic
1154390755 18:13934305-13934327 AAGGGTGTTTTGAGAGAAAAGGG - Intergenic
1155469099 18:26171934-26171956 CTGTGGGTCTTGAGGATAAAGGG - Intronic
1155598826 18:27519253-27519275 CAGTGGGGTTTTAAGGAAAAAGG - Intergenic
1155788088 18:29927281-29927303 TTGTGGGTTTGGAGAGAAAAAGG + Intergenic
1156226889 18:35118303-35118325 CAGTGGATTGGGAGGGAAACCGG + Intronic
1156297338 18:35804551-35804573 CAGAGGGTTGTGGGGGGAAAGGG + Intergenic
1157082021 18:44535704-44535726 AGGTGGGTTTTGAGGGAAAGAGG + Intergenic
1157086402 18:44584657-44584679 CAGTGACTTTTGAGTGAAAGTGG + Intergenic
1157353514 18:46912793-46912815 GAGTGGGATTTAATGGAAAAGGG + Intronic
1157555265 18:48609330-48609352 AGGTGGGCCTTGAGGGAAAAGGG + Intronic
1159060099 18:63505715-63505737 GGGTGGGTTTAGAGTGAAAAGGG - Intergenic
1161237290 19:3204380-3204402 CAGTGGGTAAGGAGGGACAAGGG - Intronic
1162232898 19:9282404-9282426 CAGTAAGTGTTGAGGGAAATAGG - Intergenic
1162563716 19:11433412-11433434 CAGTGGTTCTTGTTGGAAAAGGG - Intronic
1163374935 19:16924249-16924271 AAGTGGGTTTGGGGGGAAGATGG + Intronic
1164360027 19:27496004-27496026 CGGAGGGCTTTGAGTGAAAAAGG + Intergenic
1166007346 19:39916584-39916606 CAGTGGGCTTTCTGGGGAAAGGG - Intronic
1166367645 19:42285407-42285429 CAGCGGGTTTTCAGGGGTAAGGG + Intronic
1166813229 19:45526572-45526594 ATTTGGGTTTTGGGGGAAAAGGG + Exonic
925021601 2:574002-574024 CGGTGGGTTTTCAGGGAGGAGGG - Intergenic
925502093 2:4516293-4516315 CAATCTGTTTTGATGGAAAAGGG + Intergenic
927258492 2:21061835-21061857 CAGTGAGATGTGAGGGAAGAGGG + Intergenic
927445281 2:23155078-23155100 CAGTGTGTTTTGGGGAAAAAAGG + Intergenic
927500470 2:23579577-23579599 AAGTGGGACTGGAGGGAAAAGGG - Intronic
927722717 2:25396691-25396713 CAATAGGTTTTGGGGGAACATGG - Intronic
927842377 2:26453904-26453926 CAGAGGGTTTTGGGAGGAAATGG + Intronic
929212859 2:39377469-39377491 ATGTGGGTTTTGAGGGAAGTAGG + Intronic
929759309 2:44793286-44793308 TAATGGGTGCTGAGGGAAAACGG + Intergenic
932342563 2:70975552-70975574 CAGGTGATTTTGAGGGAGAAGGG - Intronic
932706778 2:74032159-74032181 CAGTGGGTTTTGAGGGATTGGGG + Intronic
934300367 2:91773038-91773060 CAGTGAGTTTTGAGGGTGGAGGG + Intergenic
934961427 2:98679005-98679027 CACTGGGTTTTTAGGGATCAGGG - Intronic
937081565 2:119143921-119143943 CACCAGGTTTTGAGAGAAAAAGG - Intergenic
938663848 2:133513501-133513523 GAGTGGATCTGGAGGGAAAATGG + Intronic
939007023 2:136801026-136801048 CAGTGGGTAAAGAGGGACAAAGG - Intronic
939083806 2:137693293-137693315 GAGTGGGTCTAGAGGGAAAAAGG - Intergenic
940624971 2:156162968-156162990 GGGTTGGTTTTGAGAGAAAATGG - Intergenic
940971568 2:159902330-159902352 CAGTGGTGTTTGAGAGAAAATGG + Intronic
942293052 2:174490678-174490700 CAGCGGGACTTGAGGGAAATCGG - Intergenic
943167500 2:184349045-184349067 CTGAGGGTTTTGACGAAAAAAGG - Intergenic
943532212 2:189096842-189096864 CAGTGGCTGCTGAGTGAAAAAGG + Intronic
943954270 2:194166523-194166545 CAGTGGATTATGAAGGAACATGG - Intergenic
944463967 2:199982081-199982103 CAGTAGGTTTGGGGGGAACAGGG - Intronic
944761908 2:202824497-202824519 CAGGGAGTTTTGAGGGAAAGGGG + Intronic
945040101 2:205736742-205736764 CAGTGAGTTGTCAGGGAATAGGG + Intronic
945505710 2:210637856-210637878 CAGTGGGGGATGGGGGAAAAGGG - Intronic
945846237 2:214948479-214948501 CAGGTGGTTTTGAGGGGAAATGG + Intronic
946044998 2:216813542-216813564 CAGTGTCTTTTGGGGGAATACGG + Intergenic
946604810 2:221391995-221392017 CAGTGGTTTTGGAGCGCAAAGGG - Intergenic
947345083 2:229182298-229182320 CTGTGTGTTTTGAAGGAAAGAGG + Intronic
947590127 2:231380686-231380708 AGGTGGGTTTTGAAGGAAGATGG - Intergenic
948231940 2:236355200-236355222 CAGTGGGTTTTGATGGACTCTGG + Intronic
948732874 2:239978200-239978222 CAGTGTGTTTATAGGCAAAAGGG - Intronic
1170010096 20:11713349-11713371 CTGAAGGTTTTGAGAGAAAAGGG + Intergenic
1170084182 20:12510677-12510699 CAGTGGGACTTGGTGGAAAATGG + Intergenic
1170196290 20:13692874-13692896 CAGGGGGTTGTGAGGTACAAAGG - Intergenic
1170316289 20:15044470-15044492 GAGTGGGTCTGGAGGGCAAATGG - Intronic
1170827862 20:19811521-19811543 CAGTGGGTGTGGAGGGGACAAGG + Intergenic
1170890529 20:20371490-20371512 CAGTCTGTTTGGGGGGAAAATGG + Intergenic
1170967363 20:21085952-21085974 CTGTGGGTCTTGAGGGTTAAAGG - Intergenic
1172029415 20:31971190-31971212 CAGTGTGTATTGTGGGGAAAAGG + Intronic
1172838884 20:37890162-37890184 AAGTGGGGTTTGAGGGGAAAGGG + Intergenic
1173183147 20:40819726-40819748 CAGAGGCTTTTGAGGCAAAGTGG - Intergenic
1174105611 20:48160519-48160541 AAGGGGGTTTAGAGGGAACATGG - Intergenic
1174190740 20:48738671-48738693 CTGTGGGTTTGGGGGGAGAAGGG + Intronic
1174480763 20:50829659-50829681 CCTTGGGTTCTGAAGGAAAAAGG + Intronic
1175406592 20:58736523-58736545 CAGTGCTTTTTGGGGGAAACAGG - Intergenic
1178579836 21:33829132-33829154 CAGTGGTTTCTGAGGAAAATGGG + Intronic
1178776346 21:35554613-35554635 AAGAGGGATTTGTGGGAAAATGG - Intronic
1180968387 22:19802263-19802285 CAGTGAGTTTCGGGGGAGAAGGG + Intronic
1183581905 22:38731347-38731369 CTGTGGGCTTAAAGGGAAAAAGG - Exonic
1183985503 22:41567973-41567995 AATTGGGTGTTGAGGGAAGAGGG - Intronic
949741485 3:7239350-7239372 CCGTGGGCTTTGAGGAAAGACGG + Intronic
950752826 3:15144366-15144388 CAGTTTGTTTGGAGGCAAAATGG + Intergenic
952066413 3:29576798-29576820 CACTGGGCTTTAAGGGAACATGG - Intronic
952089690 3:29869594-29869616 CAGTTTGTATTGAGGGTAAATGG - Intronic
952636393 3:35537854-35537876 TACTGGGTTTTGAGAGGAAATGG + Intergenic
953190679 3:40684406-40684428 CAGGAGGTTTGGAGGGCAAAGGG - Intergenic
954464391 3:50646063-50646085 CAGGGGCTTTTGAGGGGAAATGG + Intronic
955017586 3:55087340-55087362 CAGTAGGTTTTGTGGGAAGATGG - Intergenic
955716181 3:61832720-61832742 CAGTAGGTTTTTGGGGAACAGGG + Intronic
959580486 3:107977970-107977992 CAGTGGCCTCTGAGGGGAAAGGG - Intergenic
960232108 3:115240576-115240598 CAGTTGACTTTAAGGGAAAATGG + Intergenic
960461748 3:117943977-117943999 CAGTGGGGTTGGAGGATAAAAGG + Intergenic
961285369 3:125798083-125798105 CAGTTTGTTTGGAGGCAAAATGG + Intergenic
962361748 3:134748888-134748910 CAGTGGGTTCTGTGGGCAGATGG + Intronic
962991057 3:140577895-140577917 CAGTGGGCTTTGGGGGAAAGGGG - Intergenic
963804367 3:149708462-149708484 CAGTGGGGGTTGAGGGGAGATGG - Intronic
963985859 3:151593858-151593880 TAGGGGATTTTGAGAGAAAAGGG + Intergenic
964105724 3:153037336-153037358 CAGTGGGCTTTGACAGATAAGGG + Intergenic
964140223 3:153390039-153390061 TAGTGGGTGTAGGGGGAAAAGGG - Intergenic
964184192 3:153923171-153923193 CAGTGGGTTTTCAGGGTTGATGG + Intergenic
965107823 3:164380519-164380541 CAGTGGGTTTTGTGAAAAAGGGG + Intergenic
966221813 3:177558805-177558827 CAATAGGTTTTTAGGGAACAGGG + Intergenic
966262426 3:177994917-177994939 CAGTAGGTTTTGAAGTGAAAGGG - Intergenic
967145965 3:186606361-186606383 CAGATGTTTTTCAGGGAAAATGG - Intergenic
968020481 3:195383084-195383106 CAGTGGGTTTTGTGGAATATTGG - Intronic
968074111 3:195806914-195806936 CAGTGGATTTTGGGGGAATTTGG - Intronic
969352583 4:6606315-6606337 CAGTGGCTCCTGAGGGAAAGTGG + Intronic
969741732 4:9033264-9033286 CAGTTTGTTTGGAGGCAAAATGG + Intergenic
969801098 4:9566161-9566183 CAGTTTGTTTGGAGGCAAAATGG + Intergenic
971917059 4:32884830-32884852 CAGTGGGTGTTAAGAGATAAAGG - Intergenic
972051711 4:34743260-34743282 CAGAGGCTTAGGAGGGAAAATGG - Intergenic
972718647 4:41674351-41674373 CTTTGTCTTTTGAGGGAAAAGGG - Intronic
972841335 4:42933264-42933286 CAGTGCTTTATGGGGGAAAAGGG + Intronic
973719557 4:53709378-53709400 CAGTGTATTTTGAGATAAAATGG + Intronic
973902764 4:55494690-55494712 CAGTAGGTTTTTGGGGAACAGGG - Intronic
974149261 4:57984803-57984825 CAGTGGGTTTAGAGGGAGTAGGG + Intergenic
975005937 4:69285960-69285982 CAGTGGGATTTCAGGGCAATAGG + Intronic
976086915 4:81416199-81416221 CAATAGGTTTTGGGGGAAACAGG - Intergenic
976783230 4:88785731-88785753 CTGGGGGTTTTGAGAGATAAGGG + Intronic
976938200 4:90665897-90665919 CAGTGGGAGGTGTGGGAAAAGGG + Intronic
979787913 4:124739842-124739864 CGGTGGGATCTGTGGGAAAATGG + Intergenic
980483927 4:133428280-133428302 AATTAGGTTTTGAGGAAAAAAGG + Intergenic
982135545 4:152271185-152271207 CAGTGGCTTCTGAGGCAAAGGGG - Intergenic
983845126 4:172508430-172508452 CAGTAGGTTTTTTGGGAAACAGG + Intronic
983964455 4:173792461-173792483 CTGTGGGCTTTGAGGGCAGAGGG + Intergenic
985968949 5:3360347-3360369 CAGTGGGTATTTAGGGAGGAAGG - Intergenic
986038473 5:3963249-3963271 CTTTGGATTTTGAGGGAGAAGGG + Intergenic
986975363 5:13387787-13387809 CAGAGGGATAGGAGGGAAAATGG + Intergenic
987201368 5:15581139-15581161 CAGTAGGCTTCGAGGTAAAATGG - Intronic
987842629 5:23240216-23240238 CACTGGGTTTAGAGGGACATGGG + Intergenic
988617315 5:32787460-32787482 AAGTTGTTCTTGAGGGAAAAGGG - Exonic
988866860 5:35344512-35344534 CATTGGGTTATGATGAAAAATGG - Intergenic
989069846 5:37498722-37498744 ATGTGGGGTGTGAGGGAAAAGGG - Intronic
989124876 5:38042758-38042780 CAGTGTGTTTGTAGGGAAAACGG - Intergenic
991267615 5:64740502-64740524 CAGTGGGTTATGAAGTAGAAAGG + Intronic
991405645 5:66298728-66298750 CAAAGGTTTTTGAGGGAATAAGG + Intergenic
992869628 5:80993494-80993516 CAGAGGGCTTTGAGACAAAAAGG - Intronic
993172399 5:84435742-84435764 CAGTGATTTTTCAGGGAACAAGG + Intergenic
993512715 5:88791872-88791894 TTGTGGCTTCTGAGGGAAAAGGG - Intronic
996086856 5:119313930-119313952 GTGTGGGTTTTGAGGTTAAAGGG + Intronic
996833812 5:127769051-127769073 CAGTGGTTTTTGAGTGACAGTGG + Intergenic
998861551 5:146448412-146448434 CAGTGGTTTTTGAGGAAAAGAGG + Intronic
998924876 5:147111938-147111960 CAGTGGGCTTCGACAGAAAAAGG + Intergenic
999915202 5:156251361-156251383 TAGTTGCTTTAGAGGGAAAAGGG - Intronic
1002724668 5:181286572-181286594 CAGTAGGTTTAGAGGGAGAGTGG - Intergenic
1003075920 6:2983508-2983530 AAGTGGATTTTGAGAGAGAAGGG + Intergenic
1003534464 6:6964137-6964159 CAGTAGGTTTTGCAGGAAAAGGG - Intergenic
1004504827 6:16239062-16239084 CAGTTGGTTTAGAAGGAATAGGG + Intronic
1004723512 6:18289682-18289704 CAATGGGTGTTGAGGTAGAATGG - Intergenic
1006480982 6:34293971-34293993 AAGTGGGGTTAGTGGGAAAAGGG - Intronic
1006571666 6:35010487-35010509 CAGTGGGTTATAAGTGAAAGTGG - Intronic
1008026325 6:46640218-46640240 CTGTAGATTTTGAGGGAGAAGGG - Intronic
1008132325 6:47733103-47733125 CAGGGGGTGTAGAGGGAAAAAGG - Intergenic
1008788258 6:55197076-55197098 CAGTTGGTTTTAGGGTAAAAGGG - Intronic
1010341028 6:74752740-74752762 CACTGGGTGTTAAGGGAAGAAGG - Intergenic
1011394483 6:86891822-86891844 CTGTGGGTTTTGGGGGATAGGGG - Intergenic
1011559704 6:88601985-88602007 AAGTGAGTGTTGAGGGGAAAAGG + Intergenic
1012442034 6:99269996-99270018 GAATGGGTTTGCAGGGAAAATGG - Intergenic
1012659477 6:101869665-101869687 CACTGGCTTTTGAGGAAAAAAGG + Intronic
1012845328 6:104381179-104381201 CCCTGGGTCTTGAGGGTAAAGGG - Intergenic
1013277134 6:108596218-108596240 CAGTGGTTTTTGAGGAATAATGG + Intronic
1013306931 6:108856740-108856762 CAATGGGTTATGAGGGAAGGTGG + Intronic
1013393627 6:109712779-109712801 CAGTTGTTTTGGAGGAAAAAAGG + Intronic
1013894687 6:115071944-115071966 CAGTGTCCTTTGAGGGACAAAGG - Intergenic
1013924632 6:115455660-115455682 GAGTTGGGTTTGAGGGGAAAAGG + Intergenic
1015119774 6:129688228-129688250 GATTGGGTTTTAGGGGAAAAAGG - Intronic
1015203787 6:130612470-130612492 CAGTGTGTTGTGAGGATAAAGGG + Intergenic
1015564166 6:134549538-134549560 CAATGGGATTTGAGAGCAAAGGG + Intergenic
1019443372 7:1058652-1058674 GAGTGGCATTTGTGGGAAAAAGG - Exonic
1020852292 7:13369882-13369904 CAGTAGTTATTGAAGGAAAAAGG + Intergenic
1021614862 7:22492014-22492036 CTATGGCTTTTGAGGGCAAATGG - Intronic
1022295851 7:29052127-29052149 CAGTGGACTTTGGGGGAAGATGG + Intronic
1023367159 7:39475425-39475447 GAGGGGCTTTTGAGGGAAGATGG + Intronic
1024426246 7:49229580-49229602 CTGAAGGTTTTCAGGGAAAATGG + Intergenic
1024764326 7:52639212-52639234 CATTGGGTTTTCATGGGAAAGGG + Intergenic
1026138403 7:67683805-67683827 CTATGGGTTTTAATGGAAAATGG - Intergenic
1026608631 7:71837500-71837522 CACTGAGTTTTTAGGGCAAAGGG + Intronic
1028357920 7:89931838-89931860 CAGTGGTATTGGAAGGAAAATGG - Intergenic
1028379513 7:90182997-90183019 CTATGGCTTTTGAGGGCAAATGG + Intronic
1028687758 7:93611557-93611579 GGGCTGGTTTTGAGGGAAAAGGG - Intronic
1028971927 7:96868690-96868712 CAGTGGGTTGTATGGGAGAAAGG + Intergenic
1029574664 7:101395558-101395580 CAGCGGGGCTGGAGGGAAAATGG + Intronic
1031375894 7:121025613-121025635 CAGGAGGTTAAGAGGGAAAAGGG - Intronic
1032158647 7:129492363-129492385 CAGAGGGAGTTGAGGGAGAAGGG - Intergenic
1032556927 7:132846030-132846052 CACTGGGTTCTGAGAGAACAGGG - Intronic
1033442838 7:141395830-141395852 CAGTGGTTTGTGTGGGAGAAAGG - Intronic
1034358657 7:150474617-150474639 CATTGTGTTTTCAGAGAAAAAGG + Exonic
1034721052 7:153293198-153293220 CATTGGGCATTGAGAGAAAAAGG - Intergenic
1035080315 7:156210258-156210280 AAGTGGGGGCTGAGGGAAAATGG + Intergenic
1035766531 8:2110599-2110621 CACTGGGCATTAAGGGAAAAAGG - Intronic
1036246924 8:7125861-7125883 CAGTTTGTTTGGAGGCAAAATGG + Intergenic
1036253879 8:7188549-7188571 CAGTTTGTTTGGAGGCAAAATGG - Intergenic
1036363614 8:8098930-8098952 CAGTTTGTTTGGAGGCAAAATGG + Intergenic
1036887341 8:12568139-12568161 CAGTTTGTTTGGAGGCAAAATGG - Intergenic
1036894935 8:12626240-12626262 CAGTTTGTTTGGAGGCAAAATGG - Intergenic
1037659783 8:20916616-20916638 CAGTGGGTATGGGGGGAAACTGG + Intergenic
1038427589 8:27474278-27474300 CAGAGTGTTTTAGGGGAAAAGGG + Intronic
1038688444 8:29739777-29739799 CAGTGGGGGTTGAAGGAAGAGGG + Intergenic
1038691192 8:29765035-29765057 CAGTGGGTGTGAAGGGGAAAGGG - Intergenic
1038811674 8:30852668-30852690 CCGTAGGTTTTTAGGGAAACAGG - Intronic
1038914637 8:32007038-32007060 CAGTGGGATGTGAGGAAAAATGG - Intronic
1039137421 8:34341147-34341169 CATTATGTTTTGAGGAAAAAAGG + Intergenic
1040795968 8:51290338-51290360 CAGTGATTTTTCAGGGAACAAGG - Intergenic
1042528028 8:69785212-69785234 AAGTGGTTTTGGAGGCAAAAAGG + Intronic
1044600763 8:94001830-94001852 TAGTGGTTTTTCAGGGATAAGGG + Intergenic
1044600800 8:94002478-94002500 TAGTGGTTTTTCAGGGATAAGGG - Intergenic
1044602050 8:94015092-94015114 CAGAGGGTGTGGATGGAAAAAGG - Intergenic
1045437468 8:102178658-102178680 CAGTGGGTTGTGAGAGTCAAAGG - Intergenic
1045525542 8:102938534-102938556 TGGTGGGCTTTGAGAGAAAAGGG - Intronic
1047096984 8:121636440-121636462 CAGTGGGACTGGAGAGAAAAAGG - Intronic
1048867835 8:138773703-138773725 CTGTGGGTGCTGAGGGAAGACGG + Intronic
1049702443 8:144021300-144021322 CAGAGGGTCATGAGGGAAGAGGG - Intronic
1049702854 8:144022982-144023004 AAGAGGGTTTTCAGGGAAGAGGG - Intronic
1049702858 8:144022998-144023020 AAGAGGGTCTTGAGGGAAGAGGG - Intronic
1049703073 8:144023778-144023800 TAGAGGGTTCTGAGGGAAGAGGG - Intronic
1049703307 8:144024588-144024610 GAGAGGGTTCTGAGGGAAGAGGG - Intronic
1050623715 9:7481486-7481508 CAGTGGCTTCTGACAGAAAATGG + Intergenic
1051605887 9:18917534-18917556 CTGTGTGCTTTGAGGGAGAAGGG - Intergenic
1053021381 9:34696854-34696876 GGGTGGGTCCTGAGGGAAAAAGG - Intergenic
1056362248 9:85870290-85870312 CAGTGCCTCCTGAGGGAAAAAGG - Intergenic
1057796295 9:98160519-98160541 TAGTGAGTTTTGAGAGAAATGGG + Intronic
1058743045 9:107963581-107963603 CAGTGGTTTGTGTGGGAATAAGG - Intergenic
1059031823 9:110706309-110706331 TAAAAGGTTTTGAGGGAAAAAGG - Intronic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059074616 9:111179481-111179503 CCTTGGATTTTGAGGGAATAGGG - Intergenic
1059091764 9:111366982-111367004 CAGGGAGTTTTGAGGGGCAAAGG - Intronic
1060270263 9:122135169-122135191 CAGGGGGTTTTGAGGCAAGGTGG - Intergenic
1060916266 9:127392894-127392916 CAGGGGGTTTTGAGGATTAAAGG - Intronic
1185843174 X:3412334-3412356 AAGTGGGCTTGAAGGGAAAAAGG - Intergenic
1186102781 X:6174284-6174306 CAGTGAGTTTGCAGAGAAAAAGG + Intronic
1186503216 X:10068648-10068670 CCGTGTGTCTTGAGGGAAACAGG + Intronic
1187787198 X:22905142-22905164 AAGTTGGCTTTGAGGAAAAAAGG + Intergenic
1189537119 X:41946880-41946902 CTGAGGGTTGTGAGGGAGAAAGG + Intergenic
1189874810 X:45424795-45424817 CAGTGGATTTTGGGGGGAAAGGG + Intergenic
1190366045 X:49695760-49695782 GTGTGGCTTTTGAGGGAGAAGGG - Intronic
1190752145 X:53372016-53372038 CAGTAGGTCTGGAGGGATAAGGG - Intergenic
1190944214 X:55075205-55075227 CCGTGGCTTCCGAGGGAAAAGGG + Intronic
1190945472 X:55089194-55089216 CTGTGGCTTCTGAGGGAAAAGGG + Intronic
1190962312 X:55264692-55264714 CCGTGGCTTCTGAGAGAAAAGGG - Exonic
1192261357 X:69507328-69507350 CAGAGGGTTGGGAAGGAAAAGGG + Intronic
1192441761 X:71179786-71179808 GAATGGGGCTTGAGGGAAAAGGG - Intergenic
1192689142 X:73342539-73342561 GAGTGGGTTGTTTGGGAAAAAGG - Intergenic
1193225784 X:78982169-78982191 CAGTGGCTGTTCAGGGAAACAGG + Intergenic
1194325826 X:92515080-92515102 GAGTCGGTTTTGAAGGATAAGGG - Intronic
1194419788 X:93659667-93659689 CAGTAGGTTTTGATGGGAGAGGG + Intergenic
1194820678 X:98502881-98502903 CTGTGGGGTGTGAGTGAAAAGGG - Intergenic
1195222797 X:102762533-102762555 CAGTGAGCTATGAGGGGAAATGG - Intergenic
1195958537 X:110360810-110360832 CAGTGGGAATGGAAGGAAAATGG + Intronic
1196309651 X:114148609-114148631 CAGTGGGCTGTGAGGGATGAAGG + Intergenic
1197161215 X:123324517-123324539 CAGTGGGAGTTGAGGGGACATGG - Intronic
1197353610 X:125406498-125406520 TAGTGGATTTTGAAGGAACATGG - Intergenic
1197376198 X:125684617-125684639 CAATAGGTTTTTAGGGAAACAGG - Intergenic
1197675286 X:129323329-129323351 CAGTGGGTTCTGAGCCAATATGG - Intergenic
1197844123 X:130783016-130783038 TAGTGGGTATTGAGGGGAACAGG + Intronic
1199264872 X:145818178-145818200 CAGTGGGGATTGAGGGTAGAGGG - Exonic
1200634549 Y:5634246-5634268 GAGTCGGTTTTGAAGGATAAGGG - Intronic
1201232021 Y:11874245-11874267 AAGTGGGTTTGAAGGGAAAAAGG + Intergenic