ID: 1131478438

View in Genome Browser
Species Human (GRCh38)
Location 15:92761692-92761714
Sequence CAGTAGCAGCAGAAGCCTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 264}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131478437_1131478438 12 Left 1131478437 15:92761657-92761679 CCTAGTAGCTGAGGCATATTCTA 0: 1
1: 0
2: 1
3: 18
4: 141
Right 1131478438 15:92761692-92761714 CAGTAGCAGCAGAAGCCTAGTGG 0: 1
1: 0
2: 2
3: 22
4: 264
1131478435_1131478438 24 Left 1131478435 15:92761645-92761667 CCTACAATTAGACCTAGTAGCTG 0: 1
1: 0
2: 0
3: 7
4: 73
Right 1131478438 15:92761692-92761714 CAGTAGCAGCAGAAGCCTAGTGG 0: 1
1: 0
2: 2
3: 22
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131478438 Original CRISPR CAGTAGCAGCAGAAGCCTAG TGG Intronic
900161361 1:1225516-1225538 CAGCAGCCGCAGCAGCCCAGAGG + Intronic
901766256 1:11501968-11501990 CAGTAGGAGTAGGAGCCCAGCGG - Exonic
903137826 1:21320932-21320954 CTGCAGCAGCAGGATCCTAGAGG - Intronic
904077018 1:27850803-27850825 CAGTAGCATCACCAGCCTTGGGG + Exonic
904377364 1:30090281-30090303 CAGGAGCAGCAGCAGGCTCGAGG + Intergenic
905308948 1:37036534-37036556 CAGAAGCAGCAGAAAGGTAGAGG + Intergenic
905313770 1:37068150-37068172 CAGGAGGAGCATCAGCCTAGTGG - Intergenic
905343821 1:37297972-37297994 CAGTAACTGCAGGAGCCCAGGGG + Intergenic
905526416 1:38643410-38643432 TAGGAGCAGCAGAAGCCAAGAGG - Intergenic
905705896 1:40057454-40057476 CAGCAGCAGCAGAAGCCTCCAGG - Intronic
905756504 1:40514570-40514592 CAGTGTCAGCAGAAGCCTCAGGG + Exonic
908681496 1:66666845-66666867 CAGCAGCAACAGAACCCTGGTGG - Intronic
909170026 1:72282963-72282985 CAGCAGCAGCAGAAGCAGCGCGG + Intergenic
911084730 1:93966838-93966860 CATTAGCAGCAGAAGCTGATGGG - Intergenic
911310645 1:96288741-96288763 CAGCAGCAGCAGAGTGCTAGTGG + Intergenic
915679801 1:157570250-157570272 CAGTAGCAGCAGAGGCCCCATGG + Intergenic
917967519 1:180187810-180187832 CAGTAGCAGCAGAGGCATCGGGG + Intronic
918083322 1:181223989-181224011 CAGTAGAATCAGAAGCTTTGGGG + Intergenic
919812150 1:201415475-201415497 CAGCAGCAGCAGAATCAGAGTGG - Intronic
919856785 1:201711569-201711591 CAGCAGCGGCAGAAGGCTTGCGG + Intronic
920377293 1:205516032-205516054 CGTCAGCAGCAGAAGCCTTGGGG - Intronic
921701873 1:218278070-218278092 CAATAGCAGTAGAAGCATATCGG - Intergenic
923018209 1:230143097-230143119 CAGGAGTACCAGAAGCCTAGAGG - Intronic
923046483 1:230359829-230359851 CAGAAGCAACAGTAGCCTGGAGG + Intronic
923461958 1:234215521-234215543 CAGCACAAGCAAAAGCCTAGAGG - Intronic
923741640 1:236660029-236660051 CAATAGCATCAGAACCCAAGAGG + Intergenic
923771901 1:236944839-236944861 CATGAGTGGCAGAAGCCTAGTGG - Intergenic
1063819755 10:9820317-9820339 CAGCAGCAGCAGGAGCTTGGTGG - Intergenic
1064035831 10:11912734-11912756 TTGTTGCAGCAGAAGCCCAGAGG - Intergenic
1067831088 10:49611400-49611422 CATTAGCTTCGGAAGCCTAGTGG + Exonic
1067838108 10:49654070-49654092 CAGATTCAGCAGAAACCTAGAGG + Intronic
1068053533 10:51982804-51982826 CAGCAGCAGCAGCAGTGTAGTGG + Intronic
1069484437 10:68812520-68812542 TGGTACCAGCAGAGGCCTAGTGG - Intergenic
1069610010 10:69766648-69766670 CAGTGGGAGCAGAAGCCATGGGG - Intergenic
1073823908 10:107297750-107297772 AAGCAACTGCAGAAGCCTAGAGG + Intergenic
1074754741 10:116615962-116615984 TAGTAGGAGAAGAAGCCCAGAGG + Intergenic
1075041858 10:119114422-119114444 CAGTGGCAGCAGAAGCCCGCAGG + Intronic
1075153519 10:119955825-119955847 CAGTTGCAGCAGAGGCCCAGTGG + Intergenic
1075717021 10:124561649-124561671 CAGTGTCAGCAGAGGCCAAGTGG + Intronic
1077228182 11:1447372-1447394 GAGTTGCAGCAGAGGCCAAGAGG - Intronic
1078529380 11:12125136-12125158 CTGTATCAGCAGCAGCCCAGTGG + Intronic
1079453155 11:20615015-20615037 CAGTAGGAGCAGAATCATTGCGG + Intronic
1080258416 11:30319716-30319738 CAGTAGCCGCATGTGCCTAGTGG - Intergenic
1081646959 11:44796760-44796782 CAGCCAGAGCAGAAGCCTAGAGG - Intronic
1083599832 11:63939651-63939673 CAGGAGCAGCAGGAACCTGGTGG - Intronic
1083696127 11:64443887-64443909 CTGTAGGAGCAGAAGTCCAGTGG + Intergenic
1083737879 11:64691990-64692012 CAGTGACAGCAGAGGGCTAGAGG + Intronic
1083795994 11:65017043-65017065 CAGCAGCAGCAAAAGCCTGATGG + Intronic
1084004557 11:66316141-66316163 CAGTGGCAGCTGTAGCCTTGTGG + Exonic
1085395345 11:76204421-76204443 CAGCACGAGCAGAAGCCTGGAGG - Intronic
1085719255 11:78898524-78898546 CAGTCTGAGCAGAGGCCTAGCGG - Intronic
1088834349 11:113565293-113565315 CAGTAGCAGGGGAACCCTAGGGG + Intergenic
1089572440 11:119419453-119419475 CAGGAGCAGCAGCAGCCACGAGG + Exonic
1089748601 11:120634475-120634497 CAGAAGCTGCAGAACCCTTGGGG - Intronic
1090919616 11:131196309-131196331 CAGTAGGAGCAGAAGCCCTTCGG - Intergenic
1090982571 11:131736348-131736370 CAGCAGTAGAAGAAGCCTGGAGG - Intronic
1091224361 11:133948805-133948827 CAGGAGGAACAGAGGCCTAGGGG + Intronic
1092761471 12:11814978-11815000 CAGTCCCAGCAAAAGCCTAAAGG + Intronic
1093961823 12:25282118-25282140 CAGTAGCCGCAAATGGCTAGTGG + Intergenic
1097688050 12:62709467-62709489 CTGTGCCAGCAGAAGCCCAGAGG - Intronic
1098046311 12:66404528-66404550 GAGCAGGAGCAGAAGCCCAGAGG - Intronic
1098316338 12:69197457-69197479 CACTTGCAGCAGAAGGCAAGGGG + Intergenic
1098387312 12:69933258-69933280 TCATAGCAGCAGAAGCCTAGAGG - Intronic
1098706645 12:73699673-73699695 CAGTAGGTTCAGAAGCCAAGTGG + Intergenic
1100501980 12:95183166-95183188 CTTTATCAGCAGAAGCATAGTGG - Intronic
1101588084 12:106102402-106102424 CAGTAGCCACAGGAGGCTAGTGG - Intronic
1102019275 12:109670458-109670480 CGGTAGCAGGAGAAGCCTCCAGG + Intergenic
1102965029 12:117119130-117119152 CAGCAGCAGCAGCAGCTTGGAGG - Intergenic
1103940840 12:124500393-124500415 AGGCAGCAGCAGAAGCCAAGTGG + Intronic
1106819017 13:33442745-33442767 CATTAGAAGCAGAGGCATAGGGG + Intergenic
1107632736 13:42358694-42358716 CAGTACTAGCAGAAGCCATGTGG - Intergenic
1108049977 13:46424157-46424179 GGGTAGCAGCAGAAACCCAGCGG - Intronic
1108472754 13:50783908-50783930 CAGTCACAGCACAGGCCTAGAGG - Intronic
1109138167 13:58679752-58679774 CACTAGCATGAGAACCCTAGAGG - Intergenic
1109542496 13:63797445-63797467 GGGTAGCAGCAGAAACCTAGCGG - Intergenic
1110310010 13:74037954-74037976 CAGTAGCACAGGAAGCCTTGTGG + Intronic
1110346435 13:74453141-74453163 CAGGAGAAACAGAAGCCAAGGGG + Intergenic
1111902629 13:94218626-94218648 CAGCAGGTGCAGAAGCCTGGGGG - Intronic
1114896187 14:26993970-26993992 CAGTAGCATATGAAGCCTACAGG + Intergenic
1115028254 14:28766876-28766898 CAGCAGCAGCAGCAGCCCAAAGG - Intergenic
1115885003 14:37961433-37961455 CAGTAGGAGTAGCAGCCTAGTGG - Intronic
1116725265 14:48554767-48554789 CAGCAGCAGCAGCAGCAGAGTGG - Intergenic
1116861573 14:49999985-50000007 AAGCAGCAGCAGCAGCCAAGGGG + Intronic
1117681985 14:58213353-58213375 AAGTAGCTGCACAGGCCTAGTGG + Intronic
1118654623 14:67933414-67933436 CAGTAGCAGCTTAGGCCTTGGGG + Intronic
1118801502 14:69193844-69193866 CAATAGCAGCACCATCCTAGTGG - Intronic
1119526072 14:75323449-75323471 CAGTAGGTGCAGAAGCCCTGAGG - Intergenic
1120079919 14:80204138-80204160 CAGTGGCAGTAGAAGCCTCCAGG - Intronic
1121025806 14:90615576-90615598 CAGTGGCTCCAGCAGCCTAGAGG - Intronic
1124232456 15:27957006-27957028 CAGAAGAAGCAGGAGCCTGGTGG - Intronic
1125048310 15:35269059-35269081 GAATAGCAGCAGAAGACTTGGGG - Intronic
1130537867 15:84799825-84799847 CAGTACCTGCAGAAGCACAGCGG - Exonic
1131478438 15:92761692-92761714 CAGTAGCAGCAGAAGCCTAGTGG + Intronic
1132590994 16:726422-726444 CAGTGGCAGCAGCAGCCATGGGG - Exonic
1132771941 16:1568297-1568319 CTGTAGCTGCAGGAGCCTGGCGG - Exonic
1134492782 16:14708071-14708093 CAGATGCAGCAGAAGCCTCCAGG + Intergenic
1134498163 16:14747193-14747215 CAGATGCAGCAGAAGCCTCCAGG + Intronic
1134582409 16:15381900-15381922 CAGATGCAGCAGAAGCCTCCAGG - Intergenic
1137783339 16:51115972-51115994 CAGGAGCAGCAGCAGCATACTGG - Intergenic
1138382048 16:56609256-56609278 CAGCAGGAGCAGCAGCCTGGGGG - Exonic
1138383335 16:56618582-56618604 CAGCAGGAGCAGCAGCCTGGGGG - Intergenic
1139435770 16:66935676-66935698 AAGAAGCAGCAGAAGCCCACAGG - Exonic
1141071138 16:80955324-80955346 CAGCAGCAGCAGCAGCGTAGTGG - Intergenic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1144282171 17:13737034-13737056 GTGAATCAGCAGAAGCCTAGGGG + Intergenic
1144650616 17:17004693-17004715 CATCAGCAGCAGCAGCCCAGGGG - Intergenic
1146729820 17:35183698-35183720 CAGTAGGAACAGAAGCCTGGGGG - Intronic
1147015365 17:37487932-37487954 CAGTAGCAACATGAGGCTAGTGG + Intergenic
1147262789 17:39218271-39218293 CAGCAGCAGCAGCAGCGTGGGGG + Intronic
1149200387 17:54178823-54178845 CAGTAGCAGAACCAGCCTAGGGG + Intergenic
1149988435 17:61366421-61366443 CAGCAGAATCAGAAGCTTAGTGG + Intronic
1150812346 17:68366624-68366646 CAGCAGCAGCAGGTGGCTAGAGG - Intronic
1151507477 17:74539174-74539196 CAATAGCACCAGAGGCCGAGCGG + Intergenic
1153992708 18:10414424-10414446 GAGTACCAGCAGAAGCCGCGTGG - Intergenic
1154019271 18:10648242-10648264 CAGCAGCAGCAGCAGCATAGTGG - Intergenic
1154184947 18:12174982-12175004 CAGCAGTAGCAGCAGCATAGTGG + Intergenic
1155573532 18:27220811-27220833 AAGTACCAGCAGACCCCTAGAGG + Intergenic
1155779388 18:29811786-29811808 CAGCAGCAGCAGTAGCACAGTGG - Intergenic
1156361440 18:36387786-36387808 CGGTAGCACTAGAAGCCCAGGGG - Intronic
1156852724 18:41746713-41746735 TATTAGCAGCAGAAGCCTGAAGG - Intergenic
1159773143 18:72572371-72572393 CTGTAGCAACAGATGACTAGTGG + Intronic
1163179563 19:15589343-15589365 CAGGTGTAGCAGAATCCTAGAGG - Intergenic
1164161431 19:22627828-22627850 CAGCAGCAGCAGCAGCTTGGAGG + Intergenic
1165332427 19:35148221-35148243 CAGTAGCAGCAGGTGCCTGTCGG + Intronic
1165433053 19:35783226-35783248 CAGCAGCAGAATAAGCCTGGAGG + Intronic
1165939640 19:39408573-39408595 CAGCAGCGGCAGCAGCCTGGGGG + Exonic
1166026493 19:40090583-40090605 AGGAAGCAGCAGGAGCCTAGGGG + Intronic
1167251004 19:48398430-48398452 CAGCAGCAGCAGCATCTTAGCGG - Exonic
1167265701 19:48482091-48482113 CAGAAGCAGCAGCAGCCTCAGGG + Intronic
1167382816 19:49148601-49148623 CCGTAGGAGCAGCAGTCTAGGGG + Intronic
925675909 2:6360749-6360771 CAGCAGAAGCAGATGCCTGGAGG + Intergenic
928436352 2:31257104-31257126 AAGGAGCAGCAGAAGGCCAGAGG + Intronic
929997308 2:46836696-46836718 CTGTAGCAGCGGAGGCCAAGTGG - Intronic
930422865 2:51176383-51176405 AAGCAGCAGGAGAAGCCTTGTGG + Intergenic
931230519 2:60370847-60370869 CAGTGGCATTTGAAGCCTAGAGG + Intergenic
932893055 2:75612527-75612549 CAGAAGCAGCAGAAACTAAGAGG - Intergenic
933336322 2:80964198-80964220 CAGCAGCAGCAGCAGCATGGTGG + Intergenic
935800195 2:106688149-106688171 GAGTAGCATCAGAAGTCTACTGG - Intergenic
937024073 2:118682873-118682895 CAGCAGCAGCAGCAGCACAGAGG - Intergenic
937084551 2:119162022-119162044 CAGGAGGAGCAGAAGCCAGGTGG - Intergenic
939948841 2:148444279-148444301 CAGTGGAAGCAGAAGCCAAAAGG - Intronic
942371970 2:175294952-175294974 CAGTAGAAGCAGAAGCACACAGG - Intergenic
942767577 2:179475078-179475100 AAGTAGCCGCATAAGGCTAGTGG - Intronic
943093747 2:183404535-183404557 CAGCAGCAGCAGCAGCCATGTGG + Intergenic
945301437 2:208219459-208219481 CAATAGCCTCAGAAGCCTACAGG - Intergenic
948006852 2:234616804-234616826 CAGTAGCAGCAGAAGCGAGGAGG + Intergenic
1168819186 20:761809-761831 CAGGAACAGCAGAGACCTAGAGG + Exonic
1171014450 20:21527409-21527431 AAGATGCAGCAGAAGACTAGAGG + Intergenic
1172568136 20:35947173-35947195 CAATAGCTGCATAAGGCTAGTGG + Intronic
1172899438 20:38323715-38323737 CAGTAGCATCAAAAGCCTCCTGG - Intronic
1173497441 20:43529758-43529780 GAGGAGCAGCAAAAGCATAGAGG + Intronic
1173596485 20:44261910-44261932 TAGTATGAGCAGAAGCCTGGAGG + Intronic
1175794793 20:61764884-61764906 CGGCAGCAGCAGAAGCCTCCAGG - Intronic
1176798622 21:13397967-13397989 CAGAAGCAGCAGCTGCATAGTGG - Intergenic
1177732307 21:25043435-25043457 CACTAACAGCAGAAGCCCAGGGG + Intergenic
1179035044 21:37752465-37752487 CAACAGCAGCAAAAGCCGAGAGG + Intronic
1179508939 21:41859531-41859553 CAGCTGCGGCAGGAGCCTAGTGG - Intronic
1179540438 21:42079990-42080012 CAGGAGTTGCAGAAGCCTCGTGG - Intronic
1179797620 21:43794548-43794570 CAGTAGCAGCAGAGGACACGCGG - Intronic
1181046344 22:20216116-20216138 CAGGATGGGCAGAAGCCTAGAGG - Intergenic
1181165570 22:20981216-20981238 CAGTGGCAGCAGAGGCCTTGAGG - Exonic
1182108514 22:27706181-27706203 CAGAAGCAGCAAAATCCTAGAGG + Intergenic
1183701058 22:39451289-39451311 CAGTAGCAGTAAAGGCCTTGAGG + Intergenic
1184041993 22:41949762-41949784 CAGGAGCAGCAGGAACCCAGGGG + Intergenic
1184650304 22:45916555-45916577 CAGTGCCAGGAGAAGCCCAGTGG - Intergenic
953832456 3:46312215-46312237 CAGTATTAGCAGAAACTTAGTGG - Intergenic
954417448 3:50400275-50400297 CAGCAGCAGCAGAGGCCCACAGG - Intronic
957353383 3:79053642-79053664 CAGAAGGAGCAGAAGCGTACTGG - Intronic
957835868 3:85588696-85588718 CAGTAGCAACAGTATGCTAGGGG + Intronic
958533576 3:95366281-95366303 CAGTATCAGCAGACCTCTAGAGG + Intergenic
959389200 3:105752870-105752892 CAGCAGCAGCAGCAGCCTCAGGG - Intronic
959985002 3:112562183-112562205 TAGTAGCAGCAGTAGCCTTTAGG - Exonic
960688145 3:120314231-120314253 CAGCAGCAGCAGCAGCATGGTGG - Intergenic
960718472 3:120601744-120601766 CAGTGGCAACACAAGCCTGGGGG - Intronic
963055705 3:141184839-141184861 GAGTAGCAGCAGACGCCCAAGGG + Intergenic
966620348 3:181956354-181956376 CACTACCAGCAGAAGCCTGAGGG - Intergenic
969855583 4:9996563-9996585 GAGCAGCAGCAGAAGCGTATAGG - Intronic
970098247 4:12489355-12489377 CAGTAACAGCATAAGCATGGAGG - Intergenic
970269804 4:14333656-14333678 CAGTAGCACCAGGAGACTAATGG + Intergenic
971154638 4:24068332-24068354 CAGTATCTGCAGAAGCCCAGAGG + Intergenic
971197446 4:24482992-24483014 CAGCAGCAGCAGCAGCCTCCAGG - Intergenic
971273332 4:25171966-25171988 AAGAATCAGCTGAAGCCTAGAGG - Intronic
975234689 4:71978719-71978741 CATTAGTAGCAGTAGCCAAGAGG - Intergenic
979163076 4:117488761-117488783 ATGAAGAAGCAGAAGCCTAGAGG + Intergenic
980210356 4:129779502-129779524 CAATAGCAGTAGAAACGTAGAGG + Intergenic
980792028 4:137632454-137632476 CAGCAGCAGCAGCAGCATGGGGG - Intergenic
981179821 4:141727530-141727552 GAATAGCAGCAGAATCCTTGTGG + Intronic
981511962 4:145567021-145567043 CAGCAGCAGCAGCAGCATGGCGG - Intergenic
982564256 4:156969311-156969333 CAGTAGCTGCAGAGGTCTGGGGG - Intronic
983372270 4:166875972-166875994 CAGAAGCAACAGGAGCCCAGTGG + Intronic
984652469 4:182285426-182285448 CAGTATCAGCAGACACATAGTGG - Intronic
984667628 4:182446149-182446171 CAGTAGCAGTAGCAGCCCATGGG - Intronic
984910624 4:184671256-184671278 AGGTAGGAGCAGCAGCCTAGGGG + Intronic
988105963 5:26748344-26748366 CATTTCCAGAAGAAGCCTAGGGG + Intergenic
989285249 5:39691863-39691885 CTGTAGCATCAGAAGCCTAGTGG - Intergenic
990319460 5:54615354-54615376 CAGTAGGGGCACAAGCCCAGAGG - Intergenic
990914900 5:60893142-60893164 AAGCAGCAGCAGCAGCCTAATGG + Intronic
991677834 5:69106223-69106245 CAGTAGCAGCTGCAGCTTGGAGG + Intronic
992542458 5:77778431-77778453 CAGTAGCAGCAGAGGTCTTTTGG - Intronic
993871288 5:93257253-93257275 CAGAAGCAGCAGAAGGCTTGGGG - Intergenic
995026228 5:107426365-107426387 CAGTAGCAGCAGCAGCATCTGGG + Intronic
996684326 5:126263885-126263907 CAGCAGCAGCAGAAATCTTGAGG + Intergenic
998182503 5:139955345-139955367 CAGCAGCGGCAGAGGCCCAGAGG + Intronic
999143120 5:149375944-149375966 CAGTAGCTGCATGAGGCTAGTGG + Intronic
1000859817 5:166443898-166443920 CAGTAGCAGCAGAAGGCAAGAGG - Intergenic
1000971875 5:167723664-167723686 CAGCAGCAGCAGAGGTCTTGAGG - Intronic
1001029522 5:168251760-168251782 CAGTAGCAGCAAAAGAATGGTGG + Intronic
1001711975 5:173786373-173786395 CAGTGGCAGCAGAAGGCCAAGGG - Intergenic
1002966631 6:1972746-1972768 CAGTCGCCGCAGATGCCTGGAGG + Intronic
1003624158 6:7727298-7727320 CAGCAGCAGCAGCTGCCTCGCGG + Exonic
1003962173 6:11219053-11219075 CAGGAACAGCAGAACCCAAGTGG - Intronic
1004414097 6:15408755-15408777 CAGTAGCTGCACATGACTAGTGG + Intronic
1004835776 6:19529881-19529903 CAGTTGCAGCAGAAGCCCCCTGG - Intergenic
1005146870 6:22701581-22701603 CAGTAGTATGAGGAGCCTAGAGG + Intergenic
1005455688 6:26017687-26017709 CAGGAGCAGCAGAAGCGGCGGGG + Exonic
1006446916 6:34084765-34084787 CAGTAGGAACAAAAGCCTGGAGG - Intronic
1007132731 6:39491687-39491709 CAGTGTTAGCAGAAGCCTTGAGG + Intronic
1008041732 6:46808740-46808762 CCCAAGCAGCAGAAGCCTAATGG - Intronic
1008627813 6:53335200-53335222 GAGGAGCAGCACAAGACTAGAGG - Intronic
1008649511 6:53548334-53548356 TAGCAGCAGCAGCAGCCCAGAGG - Intronic
1011541202 6:88432125-88432147 CAGTAGGAGCAGAGGCAGAGAGG - Intergenic
1011750053 6:90446566-90446588 AAGAAGCAGCAGAAGCCAGGTGG + Intergenic
1012668917 6:102015650-102015672 CAGTAGCAGCAGCAGCACGGTGG - Intronic
1018124443 6:160668490-160668512 CAGGCGAGGCAGAAGCCTAGTGG + Intergenic
1019484193 7:1281144-1281166 CAGCAGCAGCAGCAGCCAGGAGG + Intergenic
1019632098 7:2054964-2054986 CAGTAGCAGGAGGAGCCGAGCGG + Intronic
1020607761 7:10359981-10360003 CAGAAGCAGCAGTAGCATGGCGG + Intergenic
1020760429 7:12262043-12262065 CAGAAGCAGCAGAAGAAAAGTGG + Intergenic
1021131140 7:16913976-16913998 CAGTAGCAGCAGCAGCAGTGTGG - Intergenic
1022142993 7:27509361-27509383 GTGTAGCAGCAGAAGCCATGAGG + Intergenic
1023334460 7:39153806-39153828 CAGTACCATGAGAAGCCTTGCGG + Intronic
1024186449 7:46952865-46952887 CAGTGGCAGGTGAGGCCTAGTGG - Intergenic
1024306947 7:47937391-47937413 CAGGAGCAGCAGAAGTCTCGTGG + Intronic
1024594178 7:50918212-50918234 CTGTAGCAGCAGAAGCTAACTGG + Intergenic
1026173993 7:67979726-67979748 CAGCAGCAGGAGAAGCATGGAGG - Intergenic
1026251617 7:68676099-68676121 CAGAAGCAGATGAAGCCAAGAGG - Intergenic
1026408359 7:70092462-70092484 CACTGGCAGCAAAATCCTAGTGG + Intronic
1028885176 7:95924285-95924307 CAGTAGCACCATATGTCTAGTGG - Intronic
1030435996 7:109521420-109521442 CAGGAGCAGGAGAAGACTTGAGG - Intergenic
1031054285 7:116976522-116976544 CAGAAGCAAAAGAAGCCAAGTGG + Intronic
1031629705 7:124032396-124032418 CAGCAGCAGCAGCAGCGGAGGGG - Exonic
1034331530 7:150287352-150287374 CAGCAGCAGCAGCATCCTGGCGG - Intronic
1034409323 7:150931301-150931323 CAGTTGTGGCAGAAGCTTAGTGG - Intergenic
1034422615 7:150997339-150997361 CAGTAGCAGGAGCAGCCTCCTGG + Intronic
1034426346 7:151016201-151016223 CAGCAGCAGCAGGAGCCGTGGGG - Exonic
1034666513 7:152822509-152822531 CAGCAGCAGCAGCATCCTGGCGG + Intronic
1035146641 7:156824290-156824312 CAGTCTCAGCAGAAGCTTACGGG + Intronic
1037763959 8:21760329-21760351 CTGAAGCAGCAGAAAGCTAGTGG + Intronic
1040372118 8:46787636-46787658 CAGTGGCAGCAGAGTGCTAGTGG + Intergenic
1041298772 8:56389377-56389399 CAGTAGCCACAGATGACTAGAGG + Intergenic
1042651399 8:71045888-71045910 CAGTAGCTGCAGAAGGAAAGAGG + Intergenic
1043916312 8:85926632-85926654 TAGTAGCAGAAGAACTCTAGAGG + Intergenic
1044549174 8:93493241-93493263 CACTAGCTGTTGAAGCCTAGGGG - Intergenic
1045401997 8:101828394-101828416 CAGTAAGTGCAAAAGCCTAGAGG - Intronic
1046603263 8:116342141-116342163 CAGCAGCACCAGAAGACTTGCGG - Intergenic
1047309937 8:123683487-123683509 CGGCAGCAGGAGAAGCCTTGGGG - Intronic
1047998201 8:130357093-130357115 AAGGAGCAGCAGAAGCCTCTGGG - Intronic
1049148528 8:141019636-141019658 CAGGAGCAGGAGCAGCCTGGTGG - Intergenic
1050296724 9:4212699-4212721 CAGCAGATACAGAAGCCTAGAGG + Intronic
1052245167 9:26325444-26325466 CAGAAGCAACAAAAGGCTAGAGG - Intergenic
1052535080 9:29736101-29736123 CAATAGCCACAGAAGTCTAGTGG + Intergenic
1052730350 9:32278016-32278038 AAGAAGCAGCAGCACCCTAGTGG - Intergenic
1055736178 9:79333957-79333979 AAGCAGCAGCAAAAGCCTTGTGG + Intergenic
1057548999 9:96038494-96038516 CAGAAGCAGAAGGAGCCCAGCGG + Intergenic
1058058651 9:100473593-100473615 GTGTAGCAGCAGAAGGCGAGCGG - Exonic
1058186671 9:101863584-101863606 CAGCACAAGCAGAAGCATAGAGG - Intergenic
1060279264 9:122205034-122205056 CAGCAGCAGCAAAAGCCTTCTGG + Intronic
1060403823 9:123363035-123363057 CAGTAGCAGCGGAAGCCGGTGGG - Exonic
1060775536 9:126371194-126371216 GAGCAGCATCAGCAGCCTAGAGG - Intronic
1061396379 9:130346079-130346101 CGGTAGCAGCAGAAGGCGGGTGG + Intronic
1062145044 9:134984461-134984483 CAGCAGCAGCAGGAGCCCTGTGG - Intergenic
1062562870 9:137149554-137149576 CAGCTGCAGCAGTAGCTTAGGGG + Intronic
1186495094 X:10006752-10006774 AAGCAGCAGCAGGAGCCTGGGGG + Intergenic
1186649593 X:11544263-11544285 CATTAACAGCAGATGCCTAGTGG + Intronic
1188811555 X:34657872-34657894 CAGAAGCGGCAGCAGGCTAGCGG - Intergenic
1189047160 X:37605596-37605618 ATGAAGCAGTAGAAGCCTAGGGG - Intronic
1189566117 X:42242890-42242912 CAGAACAAGCAGAAGCCTGGTGG - Intergenic
1190107008 X:47568239-47568261 CAGCAGCATGAGAAGCTTAGAGG - Intronic
1192307805 X:69981973-69981995 CAGCAGCATCTGAAGCATAGTGG + Intronic
1193915046 X:87353746-87353768 CAGAGGCAGCAGGAGCCAAGTGG - Intergenic
1194427710 X:93760414-93760436 CAGTAGCAACAGAGGCAGAGCGG + Intergenic
1195092052 X:101470022-101470044 CAGCAGCAGCAGAACACTTGCGG - Intronic
1195541412 X:106067609-106067631 CAGTGGCAGCAGAAGTGTGGTGG + Intergenic
1196696063 X:118613320-118613342 CAGTGGCAGCAGAAGTATAAAGG + Intronic
1197141558 X:123122464-123122486 CAGCAGCAGCAGCAGCTTGGTGG - Intergenic
1197413023 X:126141844-126141866 AAGTATCAGTAGAAGCCAAGTGG - Intergenic
1197800139 X:130339735-130339757 CTGCAGGCGCAGAAGCCTAGAGG - Intergenic
1199249692 X:145646340-145646362 CACTACCACCAGAAGCCAAGAGG - Intergenic
1201519472 Y:14857636-14857658 CAGTTGGAGGAGAGGCCTAGTGG + Intergenic