ID: 1131483628

View in Genome Browser
Species Human (GRCh38)
Location 15:92802586-92802608
Sequence CCTAAGAGGGAGGCAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1543
Summary {0: 1, 1: 0, 2: 5, 3: 103, 4: 1434}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131483628_1131483634 2 Left 1131483628 15:92802586-92802608 CCTTCCTCTGCCTCCCTCTTAGG 0: 1
1: 0
2: 5
3: 103
4: 1434
Right 1131483634 15:92802611-92802633 GATACATGTGATAACACTTAAGG 0: 1
1: 0
2: 5
3: 64
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131483628 Original CRISPR CCTAAGAGGGAGGCAGAGGA AGG (reversed) Intronic
900279143 1:1854658-1854680 CCTACTAGCGAGGCTGAGGAAGG + Intronic
900326003 1:2108992-2109014 CGTGAGACGGAGGCAGAGGCTGG - Intronic
900372409 1:2337814-2337836 TCTGAGAGGGAGGCAGGGGCTGG + Intronic
900471961 1:2859481-2859503 GGAAAGAGGGAGGAAGAGGAAGG + Intergenic
900526521 1:3131864-3131886 CCCAGGAGGGAGGAGGAGGAAGG - Intronic
900552672 1:3264532-3264554 GCCAGGAGGGAGGCAGGGGAGGG + Intronic
900552733 1:3264686-3264708 GCCAGGAGGGAGGCAGGGGAGGG + Intronic
901123382 1:6912699-6912721 GCTGAGAGGGAGGCAGAGGTGGG - Intronic
901251480 1:7783630-7783652 CATTAGAGGGAGGGAGAGGCGGG - Intergenic
901396091 1:8982863-8982885 CCAAAGTGGGAGGCCGAGGCGGG + Intergenic
901536007 1:9883394-9883416 TCTATGAAGGAGGCAGAGCAGGG + Intronic
901545363 1:9952647-9952669 CCTACTAGGGAGGCTGAGGCAGG - Intronic
901592481 1:10356989-10357011 CCTATTCGGGAGGCTGAGGAGGG - Intronic
901626958 1:10630043-10630065 CCAGAGAGGGAGGCAGGGTATGG - Exonic
901961318 1:12828583-12828605 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901961497 1:12829759-12829781 GCTAATAGGGAGGCTGAGGTAGG + Intronic
901967910 1:12883188-12883210 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901969445 1:12895647-12895669 TCCCAGAGGGAGGCGGAGGAAGG + Exonic
901975714 1:12942318-12942340 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901983308 1:13053453-13053475 CCTCAGAGGGAGGCGGCGGAAGG + Intronic
901985702 1:13073878-13073900 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
901996107 1:13152889-13152911 CCTCAGAGGGAGGCGGCGGAAGG + Intergenic
901998780 1:13175465-13175487 CCTCAGAGGGAGGCGGCGGAAGG - Intergenic
902005129 1:13225906-13225928 CCCCAGAGGGAGGCAGGGGAAGG + Intergenic
902009460 1:13259447-13259469 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
902015727 1:13306133-13306155 TCCCAGAGGGAGGCGGAGGAAGG - Intronic
902017266 1:13318592-13318614 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
902024354 1:13371700-13371722 CCCCAGAGGGAGGCAGGGGAAGG + Intergenic
902025458 1:13380167-13380189 GCTAATAGGGAGGCTGAGGCAGG - Intergenic
902026759 1:13389836-13389858 TCCCAGAGGGAGGCGGAGGAAGG - Exonic
902424316 1:16307387-16307409 GCTACTTGGGAGGCAGAGGAGGG + Intronic
902591670 1:17479368-17479390 GCTACGTGGGAGGCAGAGGCAGG + Intergenic
903009550 1:20320081-20320103 CATGAGCGGGAGGCAGAGCATGG - Intronic
903014246 1:20351538-20351560 CCTACTAGGGAGGCTGAGGCAGG + Intronic
903213935 1:21832947-21832969 GGTGAGATGGAGGCAGAGGAGGG + Intronic
903459712 1:23512084-23512106 GTTAATAGGGAGGCTGAGGAAGG + Intronic
903548643 1:24142654-24142676 GCCAAGTGAGAGGCAGAGGAAGG + Intronic
903871446 1:26437867-26437889 ACTCAGCGGGAGGCAGAGGTGGG + Intronic
904134467 1:28300610-28300632 GCTACGCGGGAGGCTGAGGAGGG + Intergenic
904299928 1:29547647-29547669 CCTAAGATGAAGGCCGAGGTTGG + Intergenic
904405348 1:30284838-30284860 CCTAAGATGAAGGCCGAGGCTGG - Intergenic
904475581 1:30762593-30762615 GCTCAGAGTGAGGCAGAGGCTGG - Intergenic
904689028 1:32280057-32280079 CCTAAGGAGGAGGCAGAGTGAGG - Exonic
904714268 1:32455234-32455256 CCTACTTGGGAGGCTGAGGAGGG + Intergenic
905096355 1:35474610-35474632 CCTGACAGGAAGTCAGAGGAGGG + Intronic
905253463 1:36664969-36664991 CCCAAGACTGAGGCAGAGGTGGG - Intergenic
905318899 1:37101667-37101689 CTTCACAGGGAGGCAGAGGCAGG - Intergenic
905396510 1:37669909-37669931 CCAAGGAAGGAGACAGAGGAAGG - Intergenic
905755110 1:40502578-40502600 GCTACGAGGGAGGCTGAGGTGGG + Intergenic
905960324 1:42037045-42037067 GCTAAGTGGGAGGCTGAGGCAGG + Intergenic
906005005 1:42461656-42461678 GCTACTAGGGAGGCTGAGGAAGG - Intronic
906030301 1:42714813-42714835 GCTACTTGGGAGGCAGAGGAAGG - Intergenic
906099362 1:43248427-43248449 GCTACGAGGGAGGCTGAGGCAGG - Intronic
906302760 1:44695541-44695563 ACTTAAAGGGAGGCAGAGGCAGG + Intronic
906434854 1:45786683-45786705 GCTATTAGGGAGGCTGAGGAAGG + Intergenic
906487635 1:46244028-46244050 CCTACTAGGGAGGCTGAGGTGGG - Intergenic
906519416 1:46458446-46458468 CCTCTGAGGCAGGCAGAGGCTGG - Intergenic
906530334 1:46520193-46520215 CCTCAGAGGGTTGCAGAGGGAGG + Intergenic
906720520 1:48001064-48001086 TCTCTCAGGGAGGCAGAGGAGGG + Intergenic
906933222 1:50189543-50189565 CCCACCAGGGTGGCAGAGGAGGG + Intronic
906943348 1:50275135-50275157 CCTACGAGGTTGGCAGAGGAGGG - Intergenic
907060923 1:51423924-51423946 TCTATGGGGGAGGAAGAGGAAGG + Intronic
907190011 1:52640565-52640587 CCTACCAGGGAGGCTGAGGCAGG + Intronic
907213881 1:52845787-52845809 GCTACTAGGGAGGCTGAGGAGGG - Intronic
907240143 1:53076779-53076801 CCAAAGAGGCAGGCAGAGATAGG + Intronic
907245160 1:53103695-53103717 CCTGTGAGGCAGGCAGAGCAGGG + Intronic
907345562 1:53776064-53776086 GCTACGAGGGAGGCTGAGGTGGG - Intronic
907392428 1:54166964-54166986 CCTTAGAGGGAAGCAGGAGAAGG + Intronic
907434743 1:54437762-54437784 CCTACTAGGGAGGCTGAGGCAGG - Intergenic
907821732 1:57976596-57976618 CTTAAGCGGGAAGGAGAGGAGGG + Intronic
908247732 1:62241333-62241355 GCTCGGGGGGAGGCAGAGGAAGG + Intronic
909535440 1:76730783-76730805 CTTAAGAGGCAATCAGAGGAAGG - Intergenic
909647881 1:77937575-77937597 CCTACTAGGGAGGCTGAGGCAGG + Intronic
909693528 1:78437592-78437614 CTCAAGGGGGAGGCAGTGGAAGG - Intronic
910733763 1:90428667-90428689 TTTGAGAGGGAGGCAGAGGGAGG + Intergenic
910910195 1:92225215-92225237 GCTACGTGGGAGGCTGAGGAGGG - Intronic
911043277 1:93608602-93608624 CCTAAGTGGGAAGCAGAGACGGG - Intronic
911300190 1:96163389-96163411 CCTCAGAGGGTTGCAGAAGAGGG + Intergenic
911419366 1:97620324-97620346 CTTAGGAGGGAGGCTGAGGCTGG - Intronic
911422222 1:97657438-97657460 CATAAGAGTGAGGCAGCTGATGG - Intronic
911588894 1:99723403-99723425 GCTACTAGGGAGGCAGAGGTGGG + Intronic
911611883 1:99967229-99967251 CTTAAGTGGGAGGCTGAGGCAGG + Intergenic
911673364 1:100632089-100632111 GCTACGAGGGAGGCTGAGGCAGG + Intergenic
911716429 1:101138814-101138836 CCTGAGAGGCAGGCAGGGCAAGG - Intergenic
912076575 1:105883300-105883322 CCTGAGAGTGATGCAGAGAATGG - Intergenic
912440669 1:109694915-109694937 CCTACTTGGGAGGCTGAGGAAGG - Intronic
912794136 1:112680812-112680834 CCTACGTGGGAGGCTGAGGCAGG - Intronic
912910416 1:113753672-113753694 CCTAGCAGGGAGGCCGAGGCAGG - Intronic
912927096 1:113922826-113922848 CTTGAGAGGGAGGCTGAGGTTGG - Intergenic
913191408 1:116416293-116416315 CCAAAGAGGAATGCTGAGGAAGG - Intergenic
914702054 1:150143474-150143496 CCTAATCGGGAGGCTGAGGGAGG + Intronic
914727262 1:150338247-150338269 CCTAAGAAGGAGCTAAAGGAAGG + Exonic
914952439 1:152128550-152128572 CATAAGATGGAGGCAGAGATTGG + Intergenic
915133591 1:153713698-153713720 CCTACTCGGGAGGCAGAGGCAGG - Intergenic
915241811 1:154528333-154528355 GCTACTAGGGAGGCTGAGGAAGG - Intronic
915528305 1:156489394-156489416 CAGAAGAGGGTGGCAGAGGGGGG + Intronic
915555741 1:156659834-156659856 CCAGAGAGGAAGGCAGAGGTTGG + Intergenic
915758647 1:158288501-158288523 GCTAAATGGGAGGCAGAGGCAGG - Intergenic
915988601 1:160490825-160490847 CCTATGTGGCAGGCAGGGGAGGG + Intronic
916421236 1:164639772-164639794 GCTAACAGGGAGGCTGAGGTGGG - Intronic
917009164 1:170451535-170451557 CATTAGTGGGAGGCTGAGGAAGG + Intergenic
917287189 1:173433588-173433610 GCTACTAGGGAGGCAGAGGTGGG + Intergenic
917353400 1:174101930-174101952 GCTACGAGGGAGGCTGAGGTGGG - Intergenic
917966216 1:180180320-180180342 GCTAATTGGGAGGCTGAGGAAGG - Intronic
918114700 1:181485796-181485818 CCTAAGAGAGGGGCACAGCAAGG - Intronic
918573475 1:186026744-186026766 CCTACTAGGGAGGCTGAGGTGGG - Intronic
918603952 1:186399315-186399337 CCTACTAGGGAGGCTGAGGTAGG - Intronic
918834482 1:189443933-189443955 GCTACTAGGGAGGCAGAGGCAGG - Intergenic
919303993 1:195806633-195806655 TAAAAGAGGGAGGCAGAGGGAGG + Intergenic
919397902 1:197073200-197073222 GCTACTAGGGAGGCTGAGGAAGG + Intergenic
919635495 1:199999396-199999418 CCTACTAGGGAGGCTGAGGCAGG + Intergenic
920394475 1:205634151-205634173 CCTACTTGGGAGGCTGAGGAAGG - Intergenic
920672177 1:208012542-208012564 GCTACGTGGGAGGCTGAGGAGGG + Intergenic
920716336 1:208343812-208343834 CCTGGGAAGGAGGCACAGGATGG - Intergenic
921030121 1:211329015-211329037 CCTCAGACGGAGGAAGAGGTGGG - Intronic
921152355 1:212412608-212412630 CCAAAGTGGGAGGCACTGGAAGG - Intronic
921263359 1:213403014-213403036 GCTACGAGGGAGGCTGAGGCAGG + Intergenic
921299725 1:213739130-213739152 GCTAAGGAGGAGGAAGAGGAAGG - Intergenic
921540183 1:216404868-216404890 CCTATGGGGGAGGCTGAGGTGGG - Intronic
921540203 1:216404984-216405006 CCTATGGGGGAGGCTGAGGTGGG - Intronic
921706023 1:218323710-218323732 CATGAGAGGGAGGCCGAGGTGGG - Intronic
921726876 1:218533934-218533956 CCCAAGATGGTGGCAGTGGAAGG + Intergenic
921848077 1:219905172-219905194 CTGCAGAGGGAGGCAGAGGCAGG + Intronic
921998344 1:221446682-221446704 CCATAGAGGGAGGGAGAGAAAGG - Intergenic
922332792 1:224592372-224592394 CCTAAGAGGTAGAAAAAGGAAGG + Intronic
923088300 1:230718835-230718857 ACTACCAGGGAGGCAGAGGTGGG - Intergenic
923102905 1:230831338-230831360 GCTAATAGGGAGGCTGAGGCAGG - Intergenic
923282211 1:232454691-232454713 AATAAGAGGAATGCAGAGGATGG - Intronic
923622206 1:235588273-235588295 CCTGAGAGGGAGGCCATGGAGGG - Intronic
923670764 1:236039323-236039345 GCTACTTGGGAGGCAGAGGAAGG - Intronic
924030048 1:239877333-239877355 GCTAATAGGGAGGCTGAGGCAGG + Intronic
924063071 1:240196621-240196643 GCTACTAGGGAGGCTGAGGAAGG - Intronic
924144930 1:241064069-241064091 GCTACGAGGGAGGCTGAGGCAGG + Intronic
924660311 1:246009977-246009999 GCTAATAGGGAGGCTGAGGCAGG + Intronic
924888709 1:248250158-248250180 ACTAAGAGGAAGGTAAAGGAAGG - Intergenic
1062771576 10:105262-105284 GGTAGGAGGGAGGCAGAGGCAGG - Intergenic
1062771603 10:105362-105384 GGTAGGAGGGAGGCAGAGGCAGG - Intergenic
1062930325 10:1348534-1348556 CCTCAGATGGAGGCAGCCGAGGG - Intronic
1062983327 10:1744075-1744097 CCTGAACAGGAGGCAGAGGAAGG + Intergenic
1063086062 10:2818532-2818554 ACTGAGAGGGAGGGAGGGGATGG + Intergenic
1063174702 10:3540716-3540738 AATAAGACGGAGGAAGAGGAGGG + Intergenic
1063233277 10:4086958-4086980 CCTAAGAGGGAGCCATAGACTGG - Intergenic
1063411977 10:5843130-5843152 CCTACTTGGGAGGCTGAGGAAGG + Intergenic
1063466062 10:6245526-6245548 GCTACGGGGGAGGCTGAGGACGG - Intergenic
1063693119 10:8306057-8306079 CCTAAAAGGAAGGCTGAGGAAGG - Intergenic
1063818016 10:9799262-9799284 GCTGAGAAGGAGGAAGAGGAGGG + Intergenic
1064061003 10:12137150-12137172 CCTACTAGGGAGGCTGAGGCAGG - Intronic
1064316398 10:14261762-14261784 CCTGAGAGGGAGAGACAGGAGGG + Intronic
1064556634 10:16553013-16553035 GCTATTAGGGAGGCTGAGGAAGG + Intergenic
1064558013 10:16566771-16566793 GAGAAGAGGGAGGGAGAGGAGGG + Intergenic
1064761339 10:18624537-18624559 CCTACTAGGGAGGCTGAGGCAGG + Intronic
1065016852 10:21470123-21470145 CCTACTAGGGAGGCTGAGGCAGG - Intergenic
1065600131 10:27359458-27359480 CCTGAGAGGGAGGCCAAGGCGGG + Intergenic
1065784634 10:29201975-29201997 GCTAAGGGGGAGGCTCAGGATGG - Intergenic
1065796972 10:29316826-29316848 GCTACGTGGGAGGCTGAGGAGGG - Intronic
1065897252 10:30174891-30174913 GCTATGAGGGAGGCTGAGGCTGG - Intergenic
1066004057 10:31131161-31131183 GCTAATAAGGAGGCTGAGGAAGG + Intergenic
1066499300 10:35974483-35974505 TCTCACAGGGAGGAAGAGGAAGG - Intergenic
1066733103 10:38451066-38451088 CCCATGTGGGAGGCAGAGGCCGG + Intergenic
1066761184 10:38755101-38755123 CCTAAGCAGGTGGCAGAGGAAGG + Intergenic
1066960408 10:42217321-42217343 CCTAAGCAGGTGGCAGAGGAAGG - Intergenic
1067240439 10:44487426-44487448 CCTGAAAGTGAGGCAGAGAATGG - Intergenic
1067770118 10:49116586-49116608 CCTTAGAGGGAAGGAGATGAGGG - Intergenic
1067924201 10:50491240-50491262 GCTAATTGGGAGGCTGAGGAAGG + Intronic
1068329567 10:55545385-55545407 GCTACTAGGGAGGCTGAGGAAGG - Intronic
1068901857 10:62278530-62278552 CCTATGAAGCAGACAGAGGAAGG - Intergenic
1068993766 10:63179295-63179317 GCTACTAGGGAGGCTGAGGAAGG + Intronic
1069114890 10:64492632-64492654 GGTCAGAGGCAGGCAGAGGAAGG - Intergenic
1069231387 10:66013010-66013032 GCTACTAGGGAGGCTGAGGAAGG - Intronic
1069420555 10:68242810-68242832 CCTACTTGGGAGGCTGAGGAAGG - Intergenic
1069452514 10:68528528-68528550 CCTACTAGGGAGGCTGAGGCAGG - Intergenic
1069459863 10:68584595-68584617 GCTATGAGGGAGGCTGAGGCAGG + Intronic
1069460066 10:68586287-68586309 GCTATGAGGGAGGCTGAGGCAGG - Intronic
1069561824 10:69436051-69436073 CCTGGGAGGGAGGCTGAGGTGGG - Intergenic
1069605502 10:69736491-69736513 GCTACTAGGGAGGCAGAGGCAGG + Intergenic
1069906704 10:71736306-71736328 GCTAGGGTGGAGGCAGAGGAAGG + Intronic
1069920814 10:71814545-71814567 CCTACGTGGGAGGCTGAGGCCGG + Intronic
1070074618 10:73123010-73123032 GCTAATAGGGAGGCTGAGGCAGG - Intronic
1070254801 10:74804832-74804854 CCTCCCAGGGAGGCAGAGGTGGG + Intergenic
1070301774 10:75209513-75209535 GCTAATTGGGAGGCTGAGGAGGG - Intergenic
1070530338 10:77331446-77331468 CTGAAGAGGAAGGCAGTGGAGGG + Intronic
1070762336 10:79032086-79032108 CCTACCAGGGAGGCTGAGGTGGG - Intergenic
1070783620 10:79150903-79150925 ACCAGGAGGGAGGAAGAGGATGG - Intronic
1070965758 10:80529354-80529376 TCTCACAGGGAGGCAGAGCAAGG + Exonic
1071357908 10:84816992-84817014 CCTAAAAGAGAGGGAGAGAAAGG - Intergenic
1071538022 10:86452478-86452500 CCTAATTGGGAGGCTGAGGCAGG + Intronic
1072649156 10:97280295-97280317 GCTACAAGGGAGGCTGAGGAAGG + Intronic
1073334164 10:102692818-102692840 CCTACTAGGGAGGCTGAGGCAGG - Intronic
1073407853 10:103313451-103313473 GCTAATAGGGAGGCTGAGGCAGG + Intronic
1073414436 10:103369088-103369110 CCTACGCGGGAGGCTGAGGCAGG - Intronic
1074378755 10:112961123-112961145 GCTATGAGGGAGGCTGAGGCAGG - Intronic
1074670443 10:115784639-115784661 GCTAAGAGAGAGGCATGGGATGG - Intronic
1075200882 10:120402949-120402971 ACTACTAGGGAGGCAGAGGCAGG + Intergenic
1075383243 10:122035922-122035944 GCTACTAGGGAGGCTGAGGAGGG - Intronic
1075582619 10:123633793-123633815 CAGGAGAGGAAGGCAGAGGAGGG + Intergenic
1075778915 10:125004707-125004729 CCTCAGAGGGAGGGAGGGGATGG - Intronic
1076207276 10:128613232-128613254 GATAAGACAGAGGCAGAGGAGGG - Intergenic
1076213886 10:128676914-128676936 GCTAAGCGGGAGGCTGAGGCAGG + Intergenic
1076257068 10:129035933-129035955 CCTAGAAGAGTGGCAGAGGAGGG + Intergenic
1076359221 10:129875306-129875328 GCTACTAGGGAGGCTGAGGAAGG - Intronic
1076438248 10:130460912-130460934 CCTACTAGGGAGGCTGAGGCAGG + Intergenic
1076489902 10:130851774-130851796 CCTCTTTGGGAGGCAGAGGAGGG - Intergenic
1076569057 10:131420423-131420445 CCTCAGCAGGAGGAAGAGGAGGG - Intergenic
1076615417 10:131751460-131751482 CCCCAGTGGGAGGCTGAGGAAGG - Intergenic
1076749405 10:132535068-132535090 CCTCAGAGAGAAGCAGAGTAAGG + Intergenic
1077025324 11:437492-437514 CCAAGGAGGGAGTCAGAGGAAGG - Intronic
1077165065 11:1131138-1131160 CCCACGAGGCAGGCAGGGGAGGG + Intergenic
1077295325 11:1823743-1823765 CCTAAAAAGGTGGCAGAGGCTGG + Intergenic
1077306122 11:1869405-1869427 GCTGAGAGGGAGGGAGAGCAGGG + Intronic
1077320872 11:1941304-1941326 GCTACGAGGGAGGCTGAGGCAGG - Intergenic
1078175366 11:8965547-8965569 CCTACTAGGGAGGCTGAGGCAGG - Intergenic
1078472175 11:11598490-11598512 CCTAAGAGAGAAGCAGAGGAAGG - Intronic
1078590417 11:12636348-12636370 GCTACTAGGGAGGCTGAGGAGGG + Intergenic
1078748403 11:14137269-14137291 CCTAAGAGGGATTCTGAGGCTGG - Intronic
1078911750 11:15739185-15739207 CCAAACAGGAAGGCAGAGCAGGG + Intergenic
1079019703 11:16899383-16899405 GCTACTAGGGAGGCTGAGGAAGG + Intronic
1079532517 11:21472274-21472296 ACTGAGCTGGAGGCAGAGGAGGG - Intronic
1079666490 11:23112874-23112896 CCTAAGTGGGAGGTAGGGGTAGG + Intergenic
1079910482 11:26303540-26303562 ATTAAGAGGGAGACGGAGGAAGG + Intergenic
1080000089 11:27337555-27337577 ACTCTGAGGGAGGCAGAGGCGGG - Intronic
1080056827 11:27915430-27915452 GCTACGAGGGAGGCTGAGGCAGG - Intergenic
1080247505 11:30196220-30196242 CCTGAGAGGTAAGAAGAGGAGGG + Intergenic
1080414920 11:32060537-32060559 CTTAGGAGGGAGGCTGAGGCAGG + Intronic
1080453554 11:32398539-32398561 CTTCTTAGGGAGGCAGAGGATGG - Intronic
1081142345 11:39516893-39516915 GCTATGAGGGAGGCTGAGGCAGG + Intergenic
1081501986 11:43675998-43676020 GCTAATTGGGAGGCTGAGGAAGG + Intronic
1081594948 11:44452717-44452739 CCCCAGTGGGAGGCAGGGGAGGG - Intergenic
1082091683 11:48095690-48095712 GCTACGAGGGAGGCTGAGGCAGG - Intronic
1082229631 11:49746986-49747008 GCTATGCGGGAGGCTGAGGAAGG - Intergenic
1082260038 11:50071661-50071683 GCCAGGAGGGAGGCAGAGGCTGG + Intergenic
1082260440 11:50073420-50073442 GCCAGGAGGGAGGCAGAGGCTGG + Intergenic
1083199103 11:61109018-61109040 CCTAGGAGTGAGCCAGAGGCAGG + Intronic
1083234032 11:61340648-61340670 CATAAGAGGAAGGCAGGGGCCGG - Intronic
1083580070 11:63819012-63819034 CCTGAGAGGGAAGCACAGTAGGG + Intronic
1083674804 11:64319302-64319324 CCTCAGGAGGAGGAAGAGGAAGG - Intronic
1083930080 11:65837398-65837420 GCTATGTGGGAGGCAGAGGTAGG + Intronic
1084000273 11:66292156-66292178 CCCAAGAGAGGGGCTGAGGAGGG + Intronic
1084043000 11:66553441-66553463 GCTATTAGGGAGGCTGAGGAAGG + Intronic
1084046709 11:66573005-66573027 GCTACGAGGGAGGCTGAGGCAGG - Intergenic
1084125060 11:67093968-67093990 CCTACTAGGGAGGCTGAGGCAGG + Intergenic
1084613803 11:70221291-70221313 GCTACTAGGGAGGCAGAGGCAGG + Intergenic
1084659773 11:70539971-70539993 GCGAAGATGGAGGCAGAGGGGGG - Intronic
1084672577 11:70615967-70615989 CCTGAGAGGGCTGCTGAGGAAGG + Intronic
1084864689 11:72046108-72046130 CACAGGAGGGAGGAAGAGGAGGG - Intronic
1084865639 11:72054354-72054376 GCTACGAGGGAGGCTGAGGCAGG + Intronic
1084953065 11:72677288-72677310 CCAGTGAGGGAGACAGAGGAGGG - Intergenic
1085522673 11:77147550-77147572 CCTAAGAGGTGGGCAGGGCAGGG - Intronic
1086408553 11:86520613-86520635 AACAAGAGGGAGGCAGAGAAAGG - Intronic
1086470236 11:87100748-87100770 CCTACTAGGGAGGCTGAGGCAGG + Intronic
1086490202 11:87351914-87351936 CCAAAGAGGAAGAAAGAGGAAGG - Intergenic
1087211109 11:95447063-95447085 CATCAGAGGGAGGCCGAGGTGGG - Intergenic
1087327279 11:96739032-96739054 CTGAAGAGGGAGGCTGAAGAGGG - Intergenic
1087388470 11:97504439-97504461 CCTACCTGGGAGGCTGAGGAAGG + Intergenic
1087473210 11:98603347-98603369 CCCAGGAGGGAGGCTGAGGCAGG + Intergenic
1087504860 11:99006932-99006954 GCTACTAGGGAGGCTGAGGAAGG - Intergenic
1087575309 11:99982750-99982772 CCTACTCGGGAGGCAGAGGCAGG - Intronic
1087601945 11:100328242-100328264 CCTACTAGGGAGGCTGAGGTGGG + Intronic
1087775179 11:102250478-102250500 GCTAATAGGGAGGCAGAGGCAGG - Intergenic
1088014605 11:105043762-105043784 CCTAGGAGGGCTGCAGATGATGG + Intronic
1088018368 11:105087867-105087889 CCTATGAGGGGGTCAGGGGAAGG + Intronic
1088325567 11:108597307-108597329 CCTAATTGGGAGGCTGAGGAAGG - Intergenic
1088432466 11:109773915-109773937 CCTCAGAGGGAGAAGGAGGAAGG - Intergenic
1088474062 11:110216983-110217005 CCAAAGAGTGAGGAAGAGGGAGG - Intronic
1088644983 11:111910965-111910987 CCTAAGAGGGTGGAAGAACAGGG - Intronic
1088867748 11:113864946-113864968 CCTACTTGGGAGGCTGAGGAGGG - Intronic
1088875062 11:113928646-113928668 GCTACGAGGGAGGCTGAGGCAGG - Intronic
1088924337 11:114285122-114285144 CCAAGGAGGGAGGGAGAGGAAGG - Intronic
1089214838 11:116829265-116829287 ACTAAGGGGGAGGCAGCGGGGGG + Intergenic
1089351236 11:117822717-117822739 CCTAGGAGAGAGCCAGAGGTGGG + Exonic
1089858028 11:121564298-121564320 CCTAAGAGGTAGGCAGGGGCAGG - Intronic
1090618780 11:128542365-128542387 GAGAAGAGGGAGGAAGAGGAGGG + Intronic
1090885662 11:130874132-130874154 CCTACTAGGGAGGCTGAGGCAGG - Intergenic
1091366515 11:135025407-135025429 CATTGGAGGGAGGCAGATGATGG + Intergenic
1091423854 12:368618-368640 GCTACTAGGGAGGCTGAGGAAGG + Intronic
1091724392 12:2835329-2835351 CCTGGGAGGGATGCAGAGGAGGG - Intronic
1091828250 12:3531299-3531321 GGGAAGAGGGAGGAAGAGGAGGG + Intronic
1091923369 12:4323152-4323174 GCTAATAGGGAGGCTGAGGCAGG + Intronic
1092182286 12:6453901-6453923 GCTACGAGGGAGGCTGAGGCAGG + Intronic
1092249769 12:6887060-6887082 GCTACGAGGGAGGCTGAGGCAGG + Intronic
1092259862 12:6947006-6947028 CCTAAGCAGGAGGCAGAAGCAGG - Intronic
1092522662 12:9290167-9290189 GGCAAGAGGGAGGGAGAGGAGGG - Intergenic
1092544623 12:9441730-9441752 GGCAAGAGGGAGGGAGAGGAGGG + Intergenic
1092808617 12:12251040-12251062 CCTACGAGGGAGGCTGAGGCAGG - Intronic
1092885629 12:12922372-12922394 AATTAGAGGGAGGCAGAGGAAGG + Intergenic
1093026809 12:14253035-14253057 CCTCACTGGGAGGCAGAGGTAGG + Intergenic
1093134172 12:15430257-15430279 TCTAAAAGGCAGGCAGAAGAAGG + Intronic
1093142349 12:15523907-15523929 CCTACTAGGGAGGCTGAGGTGGG - Intronic
1094187265 12:27658022-27658044 CCTACTTGGGAGGCTGAGGAGGG + Intronic
1094550597 12:31447157-31447179 GCTAATTGGGAGGCAGAGGCAGG + Intronic
1095431214 12:42137016-42137038 CCTAGCAGGGAGGCAAAGGTGGG - Intronic
1095594656 12:43945430-43945452 GCTACTAGGGAGGCTGAGGAAGG - Intronic
1095963945 12:47854231-47854253 CCTACTAGGGAGGCTGAGGCAGG - Intronic
1096059805 12:48687148-48687170 GCTACTAGGGAGGCTGAGGAGGG - Intergenic
1096246854 12:49995234-49995256 GCTATGAGGGAGGCTGAGGCAGG + Intronic
1096298442 12:50404441-50404463 GCTACTAGGGAGGCAGAGGCAGG + Intronic
1096489481 12:52006087-52006109 CCTAAGATGGGGTCAGAGAACGG + Intergenic
1096703614 12:53404057-53404079 CCTACTAGGGAGGCTGAGGCAGG + Intronic
1096782136 12:53997608-53997630 GCAGAGAGGGAGGCGGAGGAAGG - Intronic
1096847350 12:54414733-54414755 CCTACTAGGGAGGCTGAGGCAGG + Intronic
1097115634 12:56694826-56694848 GCTACTAGGGAGGCTGAGGAAGG - Intergenic
1097132802 12:56825544-56825566 GCTACTAGGGAGGCTGAGGAGGG - Intergenic
1097339086 12:58417181-58417203 TTTAAGAGGGAGGCAGAGCTGGG + Intergenic
1097410598 12:59247924-59247946 GCTACTAGGGAGGCTGAGGAAGG + Intergenic
1097626061 12:62002024-62002046 CAGAAGAGAGAGGCATAGGATGG - Intronic
1097809754 12:64005532-64005554 CCTACTTGGGAGGCAGAGGCAGG + Intronic
1097890249 12:64770813-64770835 GCTACGTGGGAGGCTGAGGAAGG - Intergenic
1098276998 12:68822850-68822872 CCTACTCGGGAGGCTGAGGAAGG - Intronic
1098790398 12:74815605-74815627 ACTAATAGGGAGACAGAGGCAGG + Intergenic
1098968689 12:76824729-76824751 GCTAGTAGGGAGGCAGAGGCAGG + Intronic
1099187314 12:79529692-79529714 CTAAAGAGGAAGGCAGAGGCTGG - Intergenic
1099198553 12:79648675-79648697 GCTACCAGGGAGGCAGAGGTGGG + Intronic
1099860132 12:88215943-88215965 GCTACTAGGGAGGCAGAGGCAGG + Intergenic
1100030034 12:90175593-90175615 GCTACTAGGGAGGCTGAGGACGG - Intergenic
1100181700 12:92093181-92093203 GCTAATAGGGAGGCTGAGGTGGG - Intronic
1100344105 12:93710455-93710477 GCTACTAGGGAGGCTGAGGAAGG - Intronic
1100595480 12:96068244-96068266 CCTACTCGGGAGGCTGAGGAGGG - Intergenic
1100809360 12:98323472-98323494 ACTACTAGGGAGACAGAGGAAGG - Intergenic
1101103850 12:101421233-101421255 GCTACTAGGGAGGCAGAGGCAGG + Intergenic
1101176438 12:102156296-102156318 GCTACGCGGGAGGCTGAGGAAGG - Intronic
1101384198 12:104241785-104241807 CCCAACAGGGAGGCTGAGGAAGG - Intronic
1101386927 12:104266412-104266434 CCTACTAGGGAGGCTGAGGTAGG + Intronic
1101830402 12:108252409-108252431 GCTAAGAGGCAGGCAGTGGCTGG + Intergenic
1101969895 12:109305616-109305638 CCTATTAGGGAGGCTGAGGCAGG + Intronic
1102079405 12:110085902-110085924 CCTGAGAGGGAGAAAGTGGAAGG + Intergenic
1102110363 12:110360801-110360823 GCTAAGTGGGAGGCTGAGGTGGG + Intergenic
1102160692 12:110766229-110766251 GCTACGAGGGAGGCTGAGGCAGG + Intergenic
1102325144 12:111974544-111974566 CCTACTAGGGAGGCTGAGGTGGG + Intronic
1102538271 12:113598591-113598613 CCTAGTAGGGAGGCTGAGGCAGG + Intergenic
1102667682 12:114589601-114589623 CCTACTGGGGAGGCAGAGGCAGG + Intergenic
1102776373 12:115523140-115523162 GCTAAGTGGGAGGCTGAGGTGGG + Intergenic
1103032427 12:117627810-117627832 CCTGAGAGTGATGCAGAGAATGG - Intronic
1103274921 12:119703535-119703557 GCTACGTGGGAGGCAGAGGCAGG - Intronic
1103463492 12:121123523-121123545 CCTGAGAGGGAGAAAGTGGAAGG - Intergenic
1103465622 12:121139844-121139866 CCTACTAGGGAGGCTGAGGCAGG - Intronic
1103497452 12:121374137-121374159 GCTACGAGGGAGGCTGAGGCAGG - Intronic
1103520684 12:121535795-121535817 CCTAAGAGGGCAGCAGTTGAGGG - Intronic
1103531324 12:121604125-121604147 CCTACTAGGGAGGCTGAGGCAGG + Intergenic
1103624196 12:122206098-122206120 CCTCAGATGATGGCAGAGGAGGG + Intronic
1103818237 12:123676166-123676188 GCTATGAGGGAGGCTGAGGTCGG + Intronic
1103832113 12:123788290-123788312 CTTAAGGGGAAGGCAGAGGAAGG - Intronic
1104004314 12:124881471-124881493 GCGGAGAGGGAGGCAGAGGAGGG - Intronic
1104039184 12:125118528-125118550 CCTAAGATGGAGCCACAGGTTGG - Intronic
1104126659 12:125853246-125853268 ACTAAGTGGGAGGCTGAGGTGGG + Intergenic
1104130901 12:125892912-125892934 GCTAATTGGGAGGCTGAGGAAGG + Intergenic
1104432809 12:128730372-128730394 CCTACTTGGGAGGCAGAGGCAGG + Intergenic
1104465514 12:128986659-128986681 GCTACTAGGGAGGCTGAGGAAGG + Intergenic
1104695506 12:130860483-130860505 GCTAAGAGAAAGGCACAGGACGG + Intergenic
1105527776 13:21191992-21192014 GCTATTAGGGAGGCAGAGGCAGG - Intergenic
1105646619 13:22325969-22325991 GCTCAGTGAGAGGCAGAGGAGGG + Intergenic
1106008600 13:25796059-25796081 GCTACTAGGGAGGCAGAGGCAGG - Intronic
1106216500 13:27706585-27706607 CATAAGAGGGAGGCAGAGCCAGG - Intergenic
1106267667 13:28124601-28124623 CCTACTCGGGAGGCTGAGGAAGG + Intergenic
1107021740 13:35759308-35759330 ACTCAGAGACAGGCAGAGGATGG - Intergenic
1107091369 13:36484752-36484774 GCTAAAAGGGAGGCTGAGGTGGG - Intergenic
1107248520 13:38327068-38327090 GCTAATAGGGAGGCTGAGGCAGG + Intergenic
1107444714 13:40459901-40459923 GCTTAGAGGGATGCAGAGGTGGG - Intergenic
1107689762 13:42941506-42941528 CCTACGTGGGAGGCTGAGGTGGG + Intronic
1108057228 13:46497030-46497052 GCTAATCGGGAGGCAGAGGTGGG + Intergenic
1108293393 13:48986351-48986373 CTTAAGAGGAAGACAGAGTAAGG + Intronic
1108305334 13:49126231-49126253 CCTAAGATGTAGACAGAAGAGGG - Intronic
1108605111 13:52029822-52029844 TCTGAGAGTGAGGAAGAGGAGGG + Exonic
1108649356 13:52460554-52460576 GCTACTAGGGAGGCTGAGGAAGG - Intronic
1108750946 13:53447792-53447814 CCGAAGAGGAAGGAAGAGTAAGG - Intergenic
1108862684 13:54881684-54881706 GCTAATAGGGAGGCTGAGGCAGG + Intergenic
1109096107 13:58118688-58118710 GCTATGTGGGAGGCTGAGGAAGG - Intergenic
1109280608 13:60350959-60350981 GCTACGCGGGAGGCTGAGGAAGG - Intergenic
1109289449 13:60455956-60455978 GCTACTAGGGAGGCTGAGGAAGG + Intronic
1109351473 13:61188006-61188028 CAGAAGAAGGAGGCAGAGGAAGG + Intergenic
1110170342 13:72492534-72492556 GCTACGAGGGAGGCTGAGGCAGG + Intergenic
1110226474 13:73124803-73124825 CCCAATAGGGAGGCTGAGGTGGG - Intergenic
1110858639 13:80323951-80323973 CCTAATTGGGAGGCTGAGGCAGG + Intergenic
1111035019 13:82661107-82661129 CCGAAAAGGGAGTCAGAGGAGGG + Intergenic
1111152804 13:84279904-84279926 CCTATGTGGGAGGCAGACTAGGG - Intergenic
1111367535 13:87268966-87268988 CTTACGCGGGAGGCCGAGGAGGG - Intergenic
1111864472 13:93751631-93751653 GCTACTTGGGAGGCAGAGGAGGG - Intronic
1111995522 13:95162585-95162607 CTTAAGAGGGAAGCTGAGCAGGG - Intronic
1112460378 13:99598777-99598799 CCTACTAGGGAGGCTGAGGCAGG - Intergenic
1112614084 13:100985590-100985612 ACTCAAAGGTAGGCAGAGGAGGG + Intergenic
1112646626 13:101340154-101340176 GCTAACTGGGAGGCAGAGGCAGG + Intronic
1112650664 13:101393568-101393590 CATAAGTGGGAGGCCGAGGCGGG + Intronic
1112711232 13:102131129-102131151 CATAAGGGAGAGGCAAAGGAGGG - Intronic
1113076022 13:106468687-106468709 TCTAAGATGGAGACACAGGATGG - Intergenic
1113419652 13:110160818-110160840 GCTACGAGGGAGGCTGAGGTGGG - Intronic
1113470676 13:110543238-110543260 CCTACGTGGGAGGCTGAGGCAGG - Intronic
1113618481 13:111697308-111697330 CTTTGGAGGGAGGGAGAGGAAGG - Intergenic
1113751531 13:112779791-112779813 CCTACTAGGGAGGCTGAGGCGGG + Intronic
1114179786 14:20356496-20356518 TATAAGAGGGAGTCAGAGGAAGG + Intronic
1114209903 14:20605626-20605648 GCTACGCGGGAGGCTGAGGAAGG + Intronic
1114469224 14:22947737-22947759 CCCAAGATGGAGGAAGAAGAGGG + Intronic
1114659202 14:24334136-24334158 CCTAAGAGGGAGAGAAAGGCAGG + Intronic
1115085524 14:29510798-29510820 CCTAATGGGGAGGCATTGGATGG - Intergenic
1115216337 14:31017385-31017407 CCTACTAGGGAGGCTGAGGCAGG + Intronic
1115241479 14:31254566-31254588 GCTAATTGGGAGGCTGAGGAGGG - Intergenic
1115475363 14:33808193-33808215 GCTACCAGGGAGGCTGAGGAAGG + Intergenic
1115500542 14:34045803-34045825 CCTACTAGGGAGGCTGAGGTAGG - Intronic
1115686801 14:35804815-35804837 GCTACTAGGGAGGTAGAGGAAGG + Intronic
1115776922 14:36725361-36725383 GCTACGAGGGAGGCTGAGGCAGG + Intronic
1116428038 14:44813689-44813711 CCTGAGAGGAAGAAAGAGGAGGG + Intergenic
1116637210 14:47412391-47412413 TCTACTAGGGAGGCTGAGGAGGG - Intronic
1116799393 14:49427421-49427443 AGTGAGAGGGAGGCAGAAGATGG + Intergenic
1117432102 14:55677808-55677830 GCTACTAGGGAGGCTGAGGAAGG - Intronic
1117677109 14:58166315-58166337 GCTACTAGGGAGGCAGAGGTGGG + Intronic
1117974189 14:61281287-61281309 CCTGTGACGGAGGCAGAGGAGGG - Exonic
1118147701 14:63157943-63157965 CCTACGTGGGAGGCTGAGGCAGG + Intergenic
1118713195 14:68539415-68539437 ACTGAGAGGCAGGCGGAGGAGGG - Intronic
1118716177 14:68561578-68561600 CCTGGGAGGAGGGCAGAGGAAGG + Intronic
1118767698 14:68921134-68921156 ATCAAGAGGGAGGAAGAGGAAGG + Intronic
1118892788 14:69923812-69923834 CGTAGGAGGGAGGCAGAATAGGG + Intronic
1118918819 14:70131322-70131344 TAGAAGAGGGAGGCAGAGTATGG + Intronic
1118952607 14:70448340-70448362 GCTAATAGGGAGGCTGAGGCAGG - Intergenic
1119019310 14:71093758-71093780 GCTGAGAAGGAGGAAGAGGAGGG - Intronic
1119054708 14:71407510-71407532 CCTGGGAGGGAGGGAAAGGAGGG - Intronic
1119207197 14:72803224-72803246 CCTGAGAGAGAGGCAGTGGCAGG - Intronic
1119235829 14:73018317-73018339 CCTACTTGGGAGGCGGAGGAAGG + Intronic
1119268610 14:73280938-73280960 CCCAACAGGGAGGCTGAGGCAGG - Intronic
1119323209 14:73743635-73743657 CCTCACAGTGAGGAAGAGGAAGG + Intronic
1119779292 14:77267427-77267449 GCTATGAGGGAGGCTGAGGTGGG + Intronic
1119794656 14:77385069-77385091 GCTACTAGGGAGGCAGAGGCAGG + Intronic
1120008862 14:79390412-79390434 AGAAAGAGGTAGGCAGAGGATGG - Intronic
1120170024 14:81238748-81238770 CCTAAGGGGCAATCAGAGGAGGG + Intergenic
1121233070 14:92372486-92372508 TCTGAGAGGCAGGCAGAGAATGG + Intronic
1121255624 14:92528238-92528260 CCTAGGAGGGAGGCGGTGGGAGG - Intronic
1121406827 14:93724228-93724250 TCTAAGAGGGGGGTGGAGGAAGG - Intronic
1121420639 14:93810985-93811007 TCAGAGAAGGAGGCAGAGGATGG + Intergenic
1121603030 14:95220286-95220308 GCTACGAGGGAGGCTGAGGCAGG - Intronic
1121700661 14:95951608-95951630 CCAAAGAGAGAAGGAGAGGAGGG - Intergenic
1121851058 14:97221342-97221364 GCTACTAGGGAGGCTGAGGAAGG + Intergenic
1121871065 14:97407950-97407972 AATCAGAGGGAGGCAGAGGTGGG - Intergenic
1121940398 14:98064755-98064777 CCCAAGAGGGAGCCCGAGGTGGG - Intergenic
1122920588 14:104878329-104878351 CCATCGAGGCAGGCAGAGGAGGG - Intronic
1122932418 14:104940410-104940432 CCTGAGAGGGATGGAGAGAAGGG - Exonic
1123045369 14:105510354-105510376 CCTACTAGGGAGGCTGAGGCAGG + Intergenic
1123106705 14:105845172-105845194 CCTCAGAGAGAGGGAGCGGAGGG + Intergenic
1124140943 15:27076686-27076708 CTTAGGAGGGAGGCAGAGAGAGG + Intronic
1124420323 15:29515380-29515402 CTTAACAGAGAGTCAGAGGAAGG - Intronic
1124609425 15:31198161-31198183 TCTACGAGGGAGGAGGAGGAGGG - Intergenic
1124857589 15:33405843-33405865 CCTAAGAATGAAGCAGAGGACGG - Intronic
1124996802 15:34731620-34731642 CATAAACTGGAGGCAGAGGAAGG + Intergenic
1125080203 15:35663920-35663942 CCTAAAAGAGGTGCAGAGGAGGG + Intergenic
1125303880 15:38288211-38288233 CAGAAGAGGAAGGTAGAGGAAGG + Intronic
1125345261 15:38712835-38712857 GCTACTAGGGAGGCAGAGGTAGG - Intergenic
1125556188 15:40587056-40587078 CCTACTAGGGAGGCTGAGGCAGG + Intergenic
1125560856 15:40632137-40632159 GCTATGTGGGAGGCTGAGGAGGG + Intronic
1125569669 15:40706588-40706610 CCTACTCGGGAGGCAGAGGCAGG + Intronic
1125695467 15:41633463-41633485 GCTACTAGGGAGGCAGAGGTGGG - Intronic
1125696120 15:41638800-41638822 GCTAATAGGGAGGCTGAGGTAGG - Intronic
1126051892 15:44693809-44693831 CCTAATTGGGAGGCTGAGGCAGG - Intronic
1126155455 15:45561694-45561716 GCTAATAGGGAGGCTGAGGCAGG + Intergenic
1126833861 15:52638587-52638609 GCTACTTGGGAGGCAGAGGAAGG + Intronic
1126892676 15:53222979-53223001 CCTAATTGGGAGGCAGAGGCGGG + Intergenic
1127367568 15:58305995-58306017 CCTACGCGGGAGGCTGAGGCAGG - Intronic
1127421166 15:58807760-58807782 TCTAAGAGACAGGCAGAGGCTGG - Intronic
1127429232 15:58885670-58885692 GCTAATCGGGAGGCTGAGGAAGG + Intronic
1127992031 15:64126689-64126711 GCTAAGCGGGAGGCTGAGGCAGG - Intronic
1128066596 15:64768683-64768705 CCTACTAGGGAGGCTGAGGTGGG + Intronic
1128323315 15:66707086-66707108 CCCAAGGGGGAGGCAGAGTTGGG - Intronic
1128326366 15:66726486-66726508 ACTGAGAGGGAAGCCGAGGAGGG + Intronic
1128361950 15:66968499-66968521 GCTACGAGGGAGGCTGAGGCAGG - Intergenic
1128678675 15:69630290-69630312 TCTGAGAGGGAGGCACAGCAGGG + Intergenic
1128735303 15:70050318-70050340 CATCAGAGAGGGGCAGAGGAGGG - Intronic
1128828806 15:70747353-70747375 CCTAAAAGGGAGGCTGAGGCGGG - Intronic
1128944643 15:71812155-71812177 GCTAAGCTGGAGCCAGAGGATGG + Exonic
1129118935 15:73383186-73383208 TATAAGAGGGAGACAGAGGGAGG + Intergenic
1129149496 15:73678990-73679012 GCTACTAGGGAGGCTGAGGAAGG + Intergenic
1129260514 15:74364816-74364838 CCTAGGAGAGAGGGGGAGGAAGG + Intronic
1129437150 15:75550673-75550695 ACTATTAGGGAGGCAGAGGCAGG + Intronic
1129454796 15:75670873-75670895 CAAGAGAGGGAAGCAGAGGAGGG - Intergenic
1129487866 15:75893903-75893925 AGGAAGAGGGAGGGAGAGGAGGG - Intronic
1129488765 15:75903630-75903652 GCTACGAGGGAGGCTGAGGCGGG + Intergenic
1129661787 15:77556728-77556750 AATAAAAGGGAGGCAGGGGAGGG + Intergenic
1129668414 15:77592650-77592672 GCAGGGAGGGAGGCAGAGGATGG + Intergenic
1129682659 15:77666552-77666574 CTGAAGCTGGAGGCAGAGGAGGG + Intronic
1129694745 15:77734303-77734325 CCGGAGAGGGAGGGAGAGCATGG + Intronic
1130064093 15:80590628-80590650 GCTATGAGGGAGGCTGAGGCTGG + Intronic
1130196952 15:81788542-81788564 CCTACGCGGGAGGCTGAGGCAGG + Intergenic
1130402977 15:83574349-83574371 CCTGAGATGGAAGAAGAGGATGG - Intronic
1130690991 15:86081153-86081175 CCTACTTGGGAGGCAGAGGCAGG - Intergenic
1131210909 15:90495747-90495769 CCTAATTGGGAGGCTGAGGTGGG - Intronic
1131483297 15:92800243-92800265 CCTACTTGGGAGGCTGAGGAGGG - Intronic
1131483628 15:92802586-92802608 CCTAAGAGGGAGGCAGAGGAAGG - Intronic
1131953543 15:97706705-97706727 GCTACTAGGGAGGCTGAGGAAGG + Intergenic
1131972924 15:97910623-97910645 GCTACTAGGGAGGCTGAGGAAGG - Intergenic
1132739367 16:1403799-1403821 CCCAGGAGGGAGGTAGGGGAGGG + Intronic
1132884639 16:2177252-2177274 CCTCAGAGGGCGGCACAGGCTGG - Exonic
1133084297 16:3349788-3349810 GCTACTAGGGAGGCAGAGGCAGG + Intergenic
1133250927 16:4480454-4480476 GCTACTAGGGAGGCTGAGGAAGG - Intronic
1133360977 16:5173570-5173592 GCCAAGATGGAGGCAGAGGTTGG - Intergenic
1134274749 16:12766144-12766166 CCCCAAAGGGAGGCAGAGGCGGG + Intronic
1134364333 16:13562711-13562733 CTTACGATGGAGGCAGAAGAAGG + Intergenic
1134372309 16:13636879-13636901 ACTAGGAGAGAAGCAGAGGAGGG + Intergenic
1134490290 16:14691083-14691105 GCTACTAGGGAGGCTGAGGAAGG + Intronic
1134495671 16:14730200-14730222 GCTACTAGGGAGGCTGAGGAAGG + Intronic
1134501219 16:14770513-14770535 GCTACTAGGGAGGCTGAGGAAGG + Intronic
1134579361 16:15358519-15358541 GCTACTAGGGAGGCTGAGGAAGG - Intergenic
1134723221 16:16399032-16399054 GCTACTAGGGAGGCTGAGGAAGG + Intergenic
1134775618 16:16850896-16850918 GCTACTTGGGAGGCAGAGGAAGG - Intergenic
1134911724 16:18033104-18033126 CCTAAGAGGAAGGAGAAGGAAGG - Intergenic
1134944207 16:18312838-18312860 GCTACTAGGGAGGCTGAGGAAGG - Intergenic
1135006568 16:18828884-18828906 GCTACTAGGGAGGCTGAGGAGGG + Intronic
1135144698 16:19950935-19950957 GCTATGTGGGAGGCTGAGGAAGG + Intergenic
1135471167 16:22732481-22732503 CAACAGAGGGAGGCAGATGAGGG - Intergenic
1135525521 16:23210924-23210946 GCTATAAGGGAGGCTGAGGAGGG + Intronic
1135566608 16:23516117-23516139 CCTATTAGGGAGGCTGAGGCGGG - Intronic
1135566769 16:23517166-23517188 CCTACTAGGGAGGCTGAGGCAGG - Intronic
1135777220 16:25267328-25267350 CCTACTAGGGAGGCTGAGGTGGG + Intergenic
1136017821 16:27416246-27416268 GCTACTAGGGAGGCAGAGGCAGG - Intronic
1136165630 16:28451184-28451206 GCTACTAGGGAGGCTGAGGAAGG - Intergenic
1136197342 16:28663825-28663847 GCTACTAGGGAGGCTGAGGAAGG + Intergenic
1136213681 16:28777972-28777994 GCTACTAGGGAGGCTGAGGAAGG + Intergenic
1136258414 16:29057896-29057918 GCTACTAGGGAGGCTGAGGAAGG + Intergenic
1136320081 16:29478420-29478442 GCTACTAGGGAGGCTGAGGAAGG - Intergenic
1136342080 16:29650685-29650707 CCTACTAGGGAGGCTGAGGCAGG + Intergenic
1136412976 16:30087640-30087662 ACTAAGAGTCAGGCAGGGGAGGG - Intronic
1136434652 16:30217761-30217783 GCTACTAGGGAGGCTGAGGAAGG - Intergenic
1136556032 16:31008398-31008420 GGTAAGGGGGAGGCAGGGGAGGG - Intronic
1136721530 16:32322612-32322634 CCTAAGCAGGTGGCAGAAGAAGG - Intergenic
1136839910 16:33528900-33528922 CCTAAGCAGGTGGCAGAAGAAGG - Intergenic
1136848842 16:33597936-33597958 GCTACGAGGGAGGCTGAGGTGGG - Intergenic
1137029831 16:35511957-35511979 CCTACTTGGGAGGCAGAGGTGGG + Intergenic
1137444561 16:48523849-48523871 CTTAAGAGGTGGGGAGAGGATGG + Intergenic
1137815524 16:51394342-51394364 GCTACTAGGGAGGCTGAGGAAGG + Intergenic
1137989063 16:53133353-53133375 CTTAATAGGGAGGCTGAGGCAGG + Intronic
1138006547 16:53342844-53342866 CCTCAGATGGCGGGAGAGGAAGG + Intergenic
1138089641 16:54163643-54163665 CCTACTTGGGAGGCTGAGGAAGG + Intergenic
1138168538 16:54826730-54826752 CCTCAGAGGGAGGTTGTGGATGG - Intergenic
1138197130 16:55059920-55059942 CATACGAGGGAGGCAGAAGGAGG + Intergenic
1138244112 16:55453675-55453697 CCTACATGGGAGGCTGAGGAGGG + Intronic
1138420770 16:56897758-56897780 GGACAGAGGGAGGCAGAGGAAGG - Intronic
1138488736 16:57363779-57363801 GCAGGGAGGGAGGCAGAGGATGG - Exonic
1138564919 16:57826073-57826095 CAGAGGAGGGAGGCAGAGGACGG - Intronic
1138657337 16:58499058-58499080 CCAGAGAGGGAAGCAGAGGAGGG - Intronic
1138828664 16:60352622-60352644 CCTACTCGGGAGGCTGAGGAAGG - Intergenic
1139336772 16:66237674-66237696 GCTACTAGGGAGGCAGAGGCAGG - Intergenic
1139469815 16:67172101-67172123 CCAGAGAAGGAGGCAGAGGAGGG + Intronic
1139674422 16:68513292-68513314 GCTACGAGGGAGGCTGAGGCTGG + Intergenic
1139716952 16:68821361-68821383 GCTACTAGGGAGGCAGAGGTGGG + Intronic
1139734503 16:68975667-68975689 GCTATGTGGGAGGCTGAGGAGGG - Intronic
1139897801 16:70301815-70301837 GCTACGAGGGAGGCTGAGGCAGG - Intronic
1140084815 16:71785768-71785790 GCTACTAGGGAGGCTGAGGAAGG + Intronic
1140293409 16:73685335-73685357 TGTAAGAGGGAGGCAGAAGAGGG + Intergenic
1140473980 16:75229478-75229500 CCCAGGAGGGAGGCAGGGGAGGG - Exonic
1141003417 16:80329844-80329866 CAAAAAAGGAAGGCAGAGGATGG - Intergenic
1141499728 16:84435713-84435735 GCTACCAGGGAGGCAGAGGCTGG + Intronic
1141547894 16:84784480-84784502 GCTACTAGGGAGGCTGAGGAGGG - Intergenic
1141580273 16:84993207-84993229 CCTACTAGGGAGGCTGAGGGGGG + Intronic
1141718556 16:85741637-85741659 CCTTGGAGGGAGGCAGAAGCAGG - Intronic
1141894109 16:86947496-86947518 CATAAGTGGCAGGCAGAGGACGG - Intergenic
1142308141 16:89297043-89297065 CCTCCCAGGGAGGTAGAGGAAGG - Intronic
1142418791 16:89957733-89957755 CCTGAGAGAGAGCCAGAGGCTGG - Intronic
1203004902 16_KI270728v1_random:195158-195180 CCTAAGCAGGTGGCAGAAGAAGG + Intergenic
1203110549 16_KI270728v1_random:1446586-1446608 GCTACGAGGGAGGCTGAGGTGGG - Intergenic
1203136452 16_KI270728v1_random:1731277-1731299 CCTAAGCAGGTGGCAGAAGAAGG + Intergenic
1203150078 16_KI270728v1_random:1829185-1829207 CCTAAGCAGGTGGCAGAAGAAGG - Intergenic
1142527856 17:557253-557275 CGTGAGAAGGAGGCAGAGGCTGG - Intronic
1142695681 17:1631725-1631747 CTTCAGAGGGAGGGAGAGGGAGG - Intergenic
1142746734 17:1963151-1963173 CCTAGGAGGAAGGCAGAGCTGGG + Intronic
1142799972 17:2338531-2338553 CCACAGAGGCAGGCAGGGGAAGG - Intronic
1142875308 17:2848906-2848928 CTTAGGAGGAAGACAGAGGAGGG - Intronic
1143132014 17:4684810-4684832 GCTAGGAGGGAGGCTGAGGCAGG - Intronic
1143393396 17:6573710-6573732 GCTACGTGGGAGGCAGAGGCAGG + Intergenic
1143456568 17:7071700-7071722 GCTGAGATGGAGGCAGAGAAAGG + Intergenic
1143465127 17:7131390-7131412 CCAGAGAGGGAGGCAGGGGCTGG + Intergenic
1143520841 17:7443343-7443365 CCTAGGAGGGAGTCAGAGAGGGG + Exonic
1143669919 17:8389551-8389573 GCTAATAGGGAGGCTGAGGCAGG - Intergenic
1143913776 17:10274095-10274117 GCAGAGAGGGAGGCTGAGGAAGG - Intergenic
1144022527 17:11250049-11250071 CCTAAGAGAGAGGGAGAAAAAGG + Intronic
1145017770 17:19410326-19410348 CCTAAGAGGGTGTCCCAGGAGGG + Intergenic
1145266454 17:21381849-21381871 CCTAAGCGGTAGGCAGGAGATGG + Intronic
1146027988 17:29339656-29339678 GCTACGCGGGAGGCAGAGGCAGG + Intergenic
1146078195 17:29753240-29753262 CCTACTCGGGAGGCTGAGGAGGG - Intronic
1146218210 17:30995863-30995885 ACTACTAGGGAGGCAGAGGTGGG - Intronic
1146264242 17:31441134-31441156 CCTACTAGGGAGGCTGAGGCAGG - Intronic
1146591189 17:34129302-34129324 CCTCAGAGTGAGGCAGAGTGGGG - Intronic
1146722533 17:35133240-35133262 ACCTAAAGGGAGGCAGAGGAAGG + Exonic
1146756253 17:35434200-35434222 GCTACTAGGGAGGCAGAGGCAGG + Intergenic
1146911797 17:36653163-36653185 CCTCAGTGGGAGGAAGAAGAGGG - Intergenic
1147001727 17:37368158-37368180 GCTATGAGGGAGGCTGAGGAAGG + Intronic
1147052244 17:37803999-37804021 CCTACTAGGGAGGCTGAGGCAGG - Intergenic
1147160522 17:38567066-38567088 CCAAGGAGGGAGGCTGAGGTGGG - Intronic
1147195418 17:38763240-38763262 GCTACTAGGGAGGCTGAGGAAGG + Intronic
1147211453 17:38874723-38874745 CCCAAGGGTGGGGCAGAGGAGGG - Intronic
1147233453 17:39037442-39037464 GCTACTAGGGAGGCAGAGGTGGG + Intergenic
1147288144 17:39419517-39419539 CCTACTTGGGAGGCTGAGGAAGG - Intronic
1147319831 17:39639492-39639514 TATCAGAGGGAGGCAGAGGCTGG + Intronic
1147332164 17:39705557-39705579 ACAAAGAGGGAGGAACAGGAGGG - Intronic
1147501198 17:40965262-40965284 GCTACTAGAGAGGCAGAGGAGGG + Intronic
1147647456 17:42042408-42042430 GCTAATAGGGAGGCTGAGGCAGG + Intronic
1147766576 17:42840494-42840516 CCTAATCGGGAGGCTGAGGCAGG + Intronic
1147794585 17:43033438-43033460 CCTAGGAGGGAGGAGGGGGAAGG + Intergenic
1147963834 17:44182518-44182540 CCTACAAGGGAGGCTGAGGCAGG + Intergenic
1148012386 17:44493639-44493661 GCTACTAGGGAGGCAGAGGTGGG + Intronic
1148443393 17:47723654-47723676 CCTACTAGGGAGGCTGAGGCAGG - Intergenic
1148696714 17:49564465-49564487 GCTACTAGGGAGGCTGAGGAGGG + Intergenic
1148905974 17:50912281-50912303 CCTAGGAGGTAGGAAGGGGAGGG + Intergenic
1149428205 17:56575984-56576006 CCTACTAGGGAGGCTGAGGCAGG + Intergenic
1149657974 17:58320189-58320211 CCAGAGAGGGAGGCGGAGAAGGG + Intronic
1149699504 17:58643758-58643780 GCTAATAGGGAGGCTGAGGCAGG + Intronic
1149704730 17:58684726-58684748 ATTAATAGGGAGGCAGAGGTGGG + Intronic
1149706576 17:58700294-58700316 CCTAAGAGGGTGGCAGGAAAAGG + Intronic
1149736943 17:59003995-59004017 GCTACTAGGGAGGCTGAGGAGGG + Intronic
1150090216 17:62317250-62317272 CCTACTAGGGAGGCTGAGGCAGG + Intergenic
1150163063 17:62915548-62915570 GCTACTAGGGAGGCTGAGGAAGG + Intergenic
1150411070 17:64940955-64940977 CCCAGGAGGGAGTCTGAGGATGG + Intergenic
1150518823 17:65844900-65844922 GCTACTAGGGAGGCTGAGGAGGG + Intronic
1150668745 17:67170713-67170735 GCTACAAGGGAGGCTGAGGAAGG + Intronic
1150748320 17:67835096-67835118 CCTAATTGGGAGGCTGAGGTGGG + Intronic
1150909578 17:69374068-69374090 CCTACTCGGGAGGCAGAGGCAGG + Intergenic
1151216154 17:72577757-72577779 GCTTGGAGGGAGGAAGAGGAGGG - Intergenic
1151285824 17:73110322-73110344 GCTACTAGGGAGGCTGAGGAAGG + Intergenic
1151296472 17:73190000-73190022 GCTACTAGGGAGGCAGAGGTGGG + Intergenic
1151323997 17:73367879-73367901 CCTAAGAGTGAGGCAGGAGTGGG - Intronic
1151331347 17:73411059-73411081 CCCTGGGGGGAGGCAGAGGAAGG - Intronic
1151468643 17:74304008-74304030 CCTACGTGGGAGGCTGAGGTGGG + Intronic
1151699279 17:75734246-75734268 CCTACTAGGGAGGCTGAGGCAGG - Intronic
1151717835 17:75840462-75840484 CCCAGGAGCGAGGCAGAGGGAGG - Intronic
1151795685 17:76343721-76343743 CCTACTAGGGAGGCTGAGGCAGG + Intronic
1151816902 17:76475691-76475713 GCTACGAGGGAGGCTGAGGCAGG - Intronic
1152366047 17:79857063-79857085 GGGAAGACGGAGGCAGAGGATGG + Intergenic
1153295587 18:3543280-3543302 TCTAAGGGGGAGGCTGAGGCAGG - Intronic
1153787738 18:8549606-8549628 CCTAATAGATAGGGAGAGGATGG + Intergenic
1153878351 18:9396944-9396966 GCTACGAGGGAGGCTGAGGCAGG + Intronic
1153975892 18:10268243-10268265 CCAAAGATGGAGTGAGAGGAGGG - Intergenic
1154352640 18:13599016-13599038 CCTAAGAGTGGGGGTGAGGAAGG + Intronic
1154384853 18:13884025-13884047 ACTAACAGGGAGAAAGAGGAGGG + Exonic
1154932206 18:21011565-21011587 GCTACTAGGGAGGCAGAGGTGGG - Intronic
1155039345 18:22052068-22052090 CCTACGCGGGAGGCTGAGGCAGG - Intergenic
1155044933 18:22095291-22095313 CCTAACTGGGAGGCTGAGGCAGG - Intronic
1155331670 18:24725102-24725124 GCTACTAGGGAGGCAGAGGCAGG + Intergenic
1155445811 18:25912118-25912140 CCTACAAGGGAGGCTGAGGCAGG - Intergenic
1156310486 18:35918003-35918025 GCTACTGGGGAGGCAGAGGAAGG - Intergenic
1156775371 18:40781121-40781143 CCTACTAGGGAGGCCGAGGCAGG - Intergenic
1157418302 18:47524426-47524448 TCAAAGATGGAGGCAGAGGCTGG - Intergenic
1157485155 18:48081568-48081590 ACTTAGAGGGAGGCTGAGGCAGG - Intronic
1157488074 18:48103417-48103439 ACAAAGACGGAGGCATAGGAGGG + Intronic
1157632638 18:49114038-49114060 CCTAGGAGGAAGGGAGAGCAGGG - Intronic
1157962754 18:52174941-52174963 GCTATGAGGGAGGCTGAGGCAGG + Intergenic
1158166225 18:54544011-54544033 GCTAAGGAGGAGGAAGAGGAGGG + Intergenic
1158227468 18:55215857-55215879 GCTAATCGGGAGGCTGAGGAAGG - Intergenic
1158460225 18:57639962-57639984 GCTACGAGGGAGGCTGAGGCAGG - Intergenic
1158495250 18:57949474-57949496 GCTACTAGGGAGGCTGAGGAAGG + Intergenic
1158753892 18:60299455-60299477 CTTAAGAGGAAGGCAGAAAAGGG + Intergenic
1159420653 18:68215420-68215442 ACTACTAGGGAGGCTGAGGAAGG - Intergenic
1159601633 18:70433625-70433647 GCTACTAGGGAGGCAGAGGCAGG - Intergenic
1159673888 18:71256913-71256935 CCTACTAGGGAGGCTGAGGCAGG + Intergenic
1159834625 18:73324116-73324138 ACTGAGAAGGAGGAAGAGGAAGG - Intergenic
1159946180 18:74446372-74446394 CCACAGTGGGAGGCAGAGGCCGG - Intronic
1159971771 18:74664381-74664403 GCTACTAGGGAGGCTGAGGAAGG + Intronic
1160311103 18:77790962-77790984 GCTACTAGGGAGGCTGAGGAGGG + Intergenic
1160340256 18:78083422-78083444 GCTACTAGGGAGGCAGAGGCAGG - Intergenic
1160797247 19:951443-951465 CCTAATCGGGAGGCTGAGGTGGG + Intronic
1161051507 19:2166206-2166228 CCTACCAGGGAGGCCGAGGCAGG - Intronic
1161100899 19:2421398-2421420 CCTACTAGGGAGGCTGAGGCAGG - Intronic
1161241268 19:3225099-3225121 CGGCAGAGGCAGGCAGAGGAGGG - Intronic
1161413180 19:4128567-4128589 GCTACGAGGGAGGCTGAGGCAGG + Intergenic
1161434712 19:4256060-4256082 CCTACTAGGGAGGCTGAGGCGGG + Intronic
1161459209 19:4386582-4386604 GCTCTGAGGGAGGCAGAGGCAGG - Intronic
1161686581 19:5705710-5705732 CCTAAGATGGGGGCTGAGGAGGG + Intronic
1161856683 19:6769734-6769756 GCTACTAGGGAGGCTGAGGAAGG + Intergenic
1161950457 19:7464897-7464919 CCCAAGAGGAAGGCTGGGGAGGG + Intronic
1161969981 19:7572967-7572989 CCTACTTGGGAGGCAGAGGTGGG - Intergenic
1162050933 19:8032515-8032537 CCTACTAGGGAGGCTGAGGCAGG - Intronic
1162102791 19:8350293-8350315 GCTACTAGGGAGGCTGAGGAAGG - Intronic
1162318109 19:9953496-9953518 GCTATGAGGGAGGCTGAGGCAGG + Intergenic
1162338391 19:10075925-10075947 CCTACTAGGGAGGCTGAGGCAGG + Intergenic
1162509642 19:11110352-11110374 GCTAAGTGGGAGGCTGAGGCAGG + Intronic
1162575059 19:11494576-11494598 GCTACTAGGGAGGCTGAGGAAGG + Intronic
1162600034 19:11661861-11661883 CCCCAGAGGGAGGCTGAGGCGGG - Intergenic
1162863760 19:13528080-13528102 GCTACGAGGGAGGCTGAGGCAGG - Intronic
1162873172 19:13600973-13600995 CTCAAGAGGGAGGCTGAGGCAGG - Intronic
1162878689 19:13640559-13640581 GCTACTAGGGAGGCTGAGGAGGG - Intergenic
1163190217 19:15672229-15672251 CCTTAGAGGGCGACGGAGGAAGG - Intergenic
1163202958 19:15781205-15781227 CCTTAGAGGGCGACAGAGGAAGG + Intergenic
1163223122 19:15935683-15935705 CCTTAGAGGGGGACAGAGGAGGG + Intergenic
1163244795 19:16086866-16086888 CCATCGAGGGAGGCAAAGGAGGG - Intronic
1163330121 19:16631081-16631103 CCAAAGAGAAAGGGAGAGGAAGG + Intronic
1163336472 19:16675658-16675680 GCTACTAGGGAGGCAGAGGTAGG - Intronic
1163555488 19:17989997-17990019 CTTCAGAGGGAGGCAGATGATGG + Intronic
1163816806 19:19471142-19471164 GCTACGTGGGAGGCTGAGGAGGG + Intronic
1163858080 19:19721849-19721871 CCTACTAGGGAGGTAGAGGCAGG + Intronic
1163859014 19:19730798-19730820 GCTACTAGGGAGGCTGAGGAAGG + Intronic
1163945711 19:20531565-20531587 GCTACTAGGGAGGCAGAGGCAGG - Intergenic
1164501003 19:28820321-28820343 CCTCACAGGGAGGCTGAGGCTGG + Intergenic
1164807158 19:31125903-31125925 GCAAAGACGGAGGCAGAGGTTGG - Intergenic
1164978558 19:32594552-32594574 GCTACGAGGGAGGCTGAGGTGGG - Intergenic
1165013184 19:32863469-32863491 GCTACGTGGGAGGCTGAGGAGGG - Intronic
1165042636 19:33080167-33080189 CCTACTAGGGAGGCTGAGGCAGG + Intergenic
1165323934 19:35103163-35103185 GCTACGCGGGAGGCTGAGGAAGG - Intergenic
1165616198 19:37203366-37203388 GCTAGGAGGGAGGCTGAGGCAGG + Intronic
1165796268 19:38521582-38521604 CCTGAGTGGGAGGCTGAGGCAGG + Intronic
1165891208 19:39113411-39113433 CCTGAGACGGAGCCACAGGAGGG - Intergenic
1165989447 19:39800747-39800769 GCTACGAGGGAGGCTGAGGCAGG - Intergenic
1166086443 19:40478655-40478677 ACTACTCGGGAGGCAGAGGAAGG - Intronic
1166170823 19:41026727-41026749 CCTAAGACAGAGGAAGAAGAAGG + Intergenic
1166190591 19:41174078-41174100 CCTACTTGGGAGGCTGAGGAGGG - Intergenic
1166287609 19:41841552-41841574 GCTACTAGGGAGGCTGAGGAGGG + Intronic
1166328745 19:42066799-42066821 AGGAAGAGGGAGACAGAGGATGG + Intronic
1166666229 19:44682136-44682158 GCTACCAGGGAGGCTGAGGAGGG + Intronic
1166815578 19:45543119-45543141 GCTACGAGGGAGGCTGAGGTGGG - Intronic
1166928536 19:46286485-46286507 CCTACGTGGGAGGCTGAGGTGGG + Intergenic
1167001932 19:46750635-46750657 CTTAGGAGGGAGGCTGAGGCAGG - Intronic
1167060294 19:47140538-47140560 ACTTTGAGGGAGGCAGAGGCAGG + Intronic
1167203230 19:48081967-48081989 CCTACTAGGGAGGCTGAGGCAGG + Intronic
1167244533 19:48365368-48365390 CAGAAGTGGGAGGCATAGGATGG - Intronic
1167247622 19:48383242-48383264 CAGCAGCGGGAGGCAGAGGAAGG - Exonic
1167249719 19:48393524-48393546 CCCAGGAGGAAGGCAGAGGCTGG + Intergenic
1167328401 19:48838653-48838675 GCTACTAGGGAGGCTGAGGAAGG + Intronic
1167416970 19:49379323-49379345 CCTACCTGGGAGGCTGAGGAGGG - Intergenic
1167497117 19:49826227-49826249 GCTACGAGGGAGGCTGAGGCAGG + Intronic
1167768986 19:51502009-51502031 ACTGAGAGGGAGGCAGTGGGCGG - Intergenic
1167800328 19:51736463-51736485 TATAAGAGTGAGGCAGAGGGAGG + Intergenic
1167968730 19:53171864-53171886 GCTAGGTGGGAGGCAGAGGCTGG - Intronic
1168148323 19:54431516-54431538 TCTAGGAGGGAGGGAGAGGCAGG - Intronic
1168185939 19:54699297-54699319 CCTCAGAGGGAGGGAGAGAGAGG + Intronic
1168274720 19:55271320-55271342 CCTACCTGGGAGGCTGAGGAGGG - Intronic
1168283551 19:55319555-55319577 GCTACGTGGGAGGCAGAGGCAGG - Intronic
1168674394 19:58266401-58266423 GCTACGAGGGAGGCTGAGGCAGG + Intronic
925042024 2:739862-739884 CGTCAGAGGGAGGCAGAGATCGG + Intergenic
925196389 2:1929317-1929339 AGGATGAGGGAGGCAGAGGAGGG - Intronic
925217578 2:2110640-2110662 CCAGACAGGGTGGCAGAGGAAGG - Intronic
925317142 2:2935275-2935297 GCTGAGGAGGAGGCAGAGGAGGG + Intergenic
926124726 2:10265154-10265176 TCTAAGACGGGGGCAGAGGGAGG - Intergenic
926272518 2:11377378-11377400 GCTACGAGGGAGGCTGAGGCAGG + Intergenic
926342479 2:11915268-11915290 GCTACGAGGGAGGCTGAGGTGGG - Intergenic
926581026 2:14633106-14633128 CCTAACAAAGAGGCAGGGGAAGG - Intronic
926656976 2:15418627-15418649 CCTGAGAGGGTCCCAGAGGAGGG + Intronic
926828708 2:16936202-16936224 CCTATGTGGTAGGCAGAGCAGGG - Intergenic
926890083 2:17631996-17632018 GCTACGTGGGAGGCTGAGGAAGG - Intronic
927510563 2:23641491-23641513 CCTCTGAGGGAGGCAGGGGAAGG - Intronic
927653872 2:24929044-24929066 GCTAATAGGGAGGCTGAGGCAGG + Intergenic
927661658 2:24998554-24998576 GCTACGTGGGAGGCAGAGGTGGG - Intergenic
927676473 2:25110183-25110205 CCCCGGAGGGTGGCAGAGGAAGG - Intronic
927774592 2:25892529-25892551 GCTACTAGGGAGGCTGAGGAAGG + Intergenic
927788900 2:25994403-25994425 GCTAATAGGGAGGCTGAGGCAGG - Intergenic
927987194 2:27420330-27420352 TGTAAGAGGAAGGCAGAGGGAGG - Intergenic
928045218 2:27924494-27924516 GCTACTAGGGAGGCTGAGGAAGG - Intronic
928070818 2:28214024-28214046 CCAATGAGGGAGCCAGATGAAGG - Intronic
928497859 2:31852682-31852704 CCTATTAGGGAGGCAGAGTTGGG - Intergenic
928549148 2:32354940-32354962 GCTACTAGGGAGGCAGAGGCAGG - Intergenic
928843038 2:35633796-35633818 GCTACTTGGGAGGCAGAGGAAGG + Intergenic
929621946 2:43364110-43364132 GCTACCAGGGAGGCTGAGGAGGG + Intronic
929988559 2:46763891-46763913 CCTAAGAAGGATGCAGAGCCAGG + Intergenic
930120442 2:47756445-47756467 CCTAATCGGGAGGCTGAGGTGGG - Intronic
930167320 2:48215689-48215711 ACGAAGATGGAGGCAGAGAATGG + Intergenic
930508478 2:52314611-52314633 GCTAATAGGGAGGCTGAGGCAGG - Intergenic
930597878 2:53410321-53410343 GCTACGAGGGAGGCTGAGGCAGG + Intergenic
930734761 2:54765570-54765592 CCTACTAGGGAGGCTGAGGCAGG - Intronic
930819741 2:55633528-55633550 GCTACTAGGGAGGCTGAGGAAGG + Intergenic
930919825 2:56739304-56739326 CATAAGGGGAGGGCAGAGGAAGG - Intergenic
931137270 2:59417129-59417151 CCTACTTGGGAGGCAGAGGAAGG - Intergenic
931320411 2:61170376-61170398 GCTAAGGAGGAGGAAGAGGAGGG - Intergenic
931529399 2:63197148-63197170 GCTGAGAAGGAGGAAGAGGAGGG - Intronic
931627453 2:64269832-64269854 CCTGAGGAGGAGGAAGAGGAGGG - Intergenic
931778162 2:65557407-65557429 CCTACTAGGGAGGCTGAGGAGGG - Intergenic
932093314 2:68825661-68825683 GCTACTAGGGAGGCTGAGGAAGG + Intronic
932215258 2:69962129-69962151 CTGGAGAGGGAGGCAGAGGAGGG + Exonic
932282054 2:70502028-70502050 CAGAAGAGGAAGGCAAAGGAAGG - Intronic
932449507 2:71800580-71800602 ACTCAGAGGGAGGCAGCTGATGG - Intergenic
932832637 2:75005919-75005941 CTTAAGAGGGAGGAAGAGGACGG + Intergenic
932851812 2:75194942-75194964 CCTAAGAAGGGAGTAGAGGAAGG - Intronic
932897125 2:75651043-75651065 CCTAAGAGAAAGGGAGAGGGAGG + Intronic
933480198 2:82846818-82846840 GCTAATAGGGAGGCTGAGGCAGG + Intergenic
933563890 2:83925294-83925316 CATAATGGGCAGGCAGAGGAGGG + Intergenic
934324489 2:91999784-91999806 CCTAAGCAGGTGGCAGAGGAAGG + Intergenic
934462864 2:94230477-94230499 CCTAAGCCGGTGGCAGAGGAAGG + Intergenic
934475157 2:94588621-94588643 CCCAAGGGAGAGGCTGAGGATGG - Intronic
934880507 2:97972753-97972775 TGGAAGAGGGAGGCAGAAGAGGG + Intronic
935564806 2:104594460-104594482 GCTACTTGGGAGGCAGAGGAGGG + Intergenic
935727710 2:106038090-106038112 TATAACAGGGAGGCAGAGGGAGG + Intergenic
935924859 2:108056324-108056346 GCTATGTGGGAGGCTGAGGAGGG - Intergenic
935969990 2:108521584-108521606 GCTACGTGGGAGGCTGAGGAAGG + Intergenic
936148861 2:109999471-109999493 CCTAAGCAGGTGGCAGAGGAAGG - Intergenic
936195819 2:110371897-110371919 CCTAAGCAGGTGGCAGAGGAAGG + Intergenic
936388368 2:112050880-112050902 TCTAAGAAGGAGGAGGAGGAAGG - Intergenic
936589906 2:113793747-113793769 GCTAATAGGGAGGCTGAGGCAGG - Intergenic
937130414 2:119507788-119507810 CCTACTTGGGAGGCAGAGGCAGG - Intronic
937466207 2:122135207-122135229 CTTAGGATGGTGGCAGAGGATGG + Intergenic
937553210 2:123120798-123120820 CCTACTAGGGAGGCTGAGGCAGG + Intergenic
937651222 2:124321329-124321351 CCTACTAGGGAGGCTGAGGTAGG + Intronic
937836677 2:126478105-126478127 GCTCAGAGGAAGGCAGAGGTGGG - Intergenic
937900549 2:127016139-127016161 CCGAGGTGGGAGGCAGAGGGAGG + Intergenic
937944410 2:127319262-127319284 CCTGAGAGAGAGGCTGAGGCTGG + Intronic
937994372 2:127681526-127681548 CCTTAGCTGGAGGCAGAGGCCGG + Intronic
938037856 2:128051261-128051283 GCTACGAGGGAGGCTGAGGCAGG - Intergenic
938542225 2:132293267-132293289 GCTAATTGGGAGGCTGAGGAAGG + Intergenic
938585752 2:132688872-132688894 CCTACTTGGGAGGCAGAGGTGGG + Intronic
938646010 2:133330783-133330805 CCTACTTGGGAGGCTGAGGAAGG + Intronic
938656612 2:133441157-133441179 CATATGAGGGTGACAGAGGAAGG - Intronic
939176936 2:138759839-138759861 GCTAAGCGGGAGGCTGAGGCAGG - Intronic
939185558 2:138856337-138856359 CCTACATGGGAGGCAGAGGCAGG + Intergenic
939372122 2:141314677-141314699 CCTAATCGGGAGGCTGAGGCAGG + Intronic
939492363 2:142892022-142892044 CCTAATTGGGGGGCTGAGGAGGG - Intronic
939932456 2:148252659-148252681 GCTATGTGGGAGGCAGAGGTAGG - Intronic
940227997 2:151420487-151420509 CCAAAGCGGGAGGCTGAGGTGGG + Intronic
940541026 2:155018308-155018330 GCTACCAGGGAGGCTGAGGAAGG - Intergenic
941033208 2:160536528-160536550 GCTGAGAGGGAGGTAGAAGAGGG + Intergenic
941425463 2:165339107-165339129 GCTAACAGGGAGGCTGAGGCAGG + Intronic
941897710 2:170646157-170646179 GCTACTAGGGAGGCTGAGGAAGG + Intronic
941915433 2:170809959-170809981 GCTACGAGAGAGGCTGAGGAAGG + Intergenic
941930184 2:170930617-170930639 ACTAAGAGTATGGCAGAGGAGGG - Intronic
942113456 2:172704765-172704787 CCAAAGTGGGAGACAGATGAGGG - Intergenic
942415784 2:175758083-175758105 GCTACTAGGGAGGCTGAGGAAGG - Intergenic
942565068 2:177257888-177257910 CCATAGAAGGAGGTAGAGGATGG - Intronic
943077230 2:183210192-183210214 GATAAGAGGGAGGGAAAGGAAGG - Intergenic
943307969 2:186290640-186290662 GCTACTAGGGAGGCAGAGGCAGG - Intergenic
943396212 2:187338641-187338663 CATGGGAGGGAGGCAGAGGTGGG - Intergenic
943721601 2:191208674-191208696 CCTACTAGGGAGGCTGAGGTAGG + Intergenic
945302941 2:208231099-208231121 GCTACTAGGGAGGCTGAGGAGGG + Intergenic
945420714 2:209632814-209632836 AGTAAGAGTGAGGAAGAGGATGG - Intronic
945553339 2:211248754-211248776 GCTAACAGGGAGGCTGAGGCAGG + Intergenic
946262595 2:218507267-218507289 GCTACTTGGGAGGCAGAGGAGGG - Intronic
946349690 2:219141841-219141863 TTTAAGAGGCAGGCAGAAGACGG + Intronic
946371831 2:219285820-219285842 CCCCAGAGGGAGGCCTAGGAGGG + Exonic
946731120 2:222710416-222710438 GCTACAAGGGAGGCTGAGGAAGG + Intergenic
946989823 2:225315850-225315872 CCTAAAAGGTTGGCAGTGGAGGG + Intergenic
947481156 2:230501128-230501150 GCTACTTGGGAGGCAGAGGAAGG + Intronic
947566288 2:231195999-231196021 GCTATGAGGGAGGCTGAGGTGGG + Intergenic
947652816 2:231801712-231801734 ACAAAGAGGGAGCCAGAGGTGGG - Intronic
947838757 2:233193987-233194009 CCTAAGTGGGGGGCTGAAGAGGG - Intronic
948017692 2:234703261-234703283 CCTGAGAGTGAGGGAGAGAAAGG + Intergenic
948213302 2:236210798-236210820 CCTGTGAAGGAGGCAGTGGAGGG + Intronic
948570459 2:238914225-238914247 CTTAAGAGGGAGACAGAGTGTGG - Intergenic
948578990 2:238971459-238971481 CCTACAAGGGAGGCAGAGGCTGG - Intergenic
948684339 2:239660497-239660519 CTGATGAGGGAGGCAGAGGGAGG - Intergenic
948795987 2:240402311-240402333 CCTGAGCTGGGGGCAGAGGAAGG - Intergenic
948964405 2:241365920-241365942 CCTATGAGGGAGGAAGTGAAAGG - Intronic
1168793314 20:594869-594891 GCTACGAGGGAGGCTGAGGCAGG - Intergenic
1168850301 20:972174-972196 GCTACTAGGGAGGCTGAGGAGGG - Intronic
1168856485 20:1012839-1012861 CTAACGAGGGAGGCAGAGGGAGG + Intergenic
1168978709 20:1987144-1987166 GCAAAGAGGTGGGCAGAGGATGG + Intronic
1169570800 20:6903123-6903145 CATAAGAAAGAGGCAGAGAAAGG - Intergenic
1169597431 20:7216396-7216418 GCTATGAGGGAGGCTGAGGCAGG + Intergenic
1170292455 20:14785724-14785746 CCTGAGAAGGAGGCAGACCAGGG + Intronic
1170742971 20:19073852-19073874 CCTAAAAGGGAGGCAGGGATGGG + Intergenic
1170785288 20:19462369-19462391 CCTACTAGGGAGGCTGAGGCAGG - Intronic
1171871106 20:30526111-30526133 GCTAATTGGGAGGCTGAGGAAGG + Intergenic
1171949531 20:31408338-31408360 CCTACTAGGGAGGCTGAGGCAGG + Intronic
1172145833 20:32757347-32757369 ACTACGCGGGAGGCTGAGGAAGG + Intergenic
1172146101 20:32759593-32759615 CCTAATCGGGAGGCTGAGGCAGG + Intergenic
1172216592 20:33239921-33239943 CCCAAGAGGGGGTGAGAGGATGG + Intronic
1172267054 20:33625373-33625395 GCTACTAGGGAGGCTGAGGAGGG + Intronic
1172549850 20:35790310-35790332 CCTACAGGGGAGGCTGAGGAAGG - Intronic
1172622061 20:36324313-36324335 GCTACTAGGGAGGCAGAGGCAGG + Intronic
1172710785 20:36921645-36921667 CCTACTTGGGAGGCTGAGGAAGG - Intronic
1172784793 20:37460694-37460716 AGTAAGAAGGAGGAAGAGGAAGG + Intergenic
1172836861 20:37878697-37878719 CCCAAGAGTGAGGCAGAGGACGG + Intergenic
1173299455 20:41788742-41788764 CCTAGGTGGGAGGCTGAGGTGGG + Intergenic
1173329076 20:42059234-42059256 CCTGTGAGGAAGGCAGAGCAGGG - Intergenic
1173532867 20:43784077-43784099 GCTAAGTGGGAGGCTGAGGCAGG - Intergenic
1173791799 20:45832893-45832915 CCTCTGAGGGAGGCAGAGGCAGG + Intronic
1173796039 20:45860682-45860704 TGGAAGAGGGAGGCAGAAGAGGG - Intronic
1173980808 20:47222422-47222444 GCTACTAGGGAGGCTGAGGAAGG + Intronic
1174363392 20:50042153-50042175 GCTACGAGGGAGGCTGAGGCCGG + Intergenic
1174384216 20:50177149-50177171 GCTACTTGGGAGGCAGAGGAGGG + Intergenic
1174436008 20:50507539-50507561 GCTAATTGGGAGGCTGAGGAAGG - Intergenic
1174465950 20:50717559-50717581 GCTAACTGGGAGGCTGAGGAAGG - Intergenic
1174562677 20:51442791-51442813 CCTGAGAGGGAGGCTGGGCATGG + Intronic
1175158316 20:56989191-56989213 CCTACTAGGGAGGCTGAGGCTGG + Intergenic
1175235028 20:57503833-57503855 CCCAGGAGGGAGGCTGAGGTGGG + Intronic
1175282264 20:57811805-57811827 CCGAGGCTGGAGGCAGAGGAAGG + Intergenic
1175282475 20:57813313-57813335 CCTCAGAGGGGCGCAGAGGCTGG - Intergenic
1175522593 20:59611692-59611714 CCGGAGAGGGAGGCAGGGGTAGG - Intronic
1175851671 20:62097253-62097275 CCCATGAGGGACGCAGAGGTGGG - Intergenic
1175950901 20:62582469-62582491 CCTCGGAGGGACGGAGAGGAAGG + Intergenic
1176027441 20:62993320-62993342 CCTGGGAGGCAGGCAGAGGCTGG + Intergenic
1176191166 20:63810632-63810654 GCTACTAGGGAGGCAGAGGCAGG + Intronic
1176241278 20:64076996-64077018 CCTAAGGGGTAGGCAGGGGCTGG - Intronic
1176413065 21:6459184-6459206 CCCTAGAGGGGGGCAGAGGAGGG + Intergenic
1176417834 21:6488896-6488918 CCTACTTGGGAGGCTGAGGAAGG - Intergenic
1176593919 21:8673529-8673551 CCTAAGCAGGTGGCAGAGGAAGG + Intergenic
1176914267 21:14605951-14605973 GCTACTAGGGAGGCTGAGGAAGG - Intronic
1177156255 21:17504290-17504312 CCTACCTGGGAGGCTGAGGAGGG + Intergenic
1177461453 21:21416201-21416223 CCAAAGAGGGAGAGAGATGAGGG + Intronic
1177492314 21:21843523-21843545 GCTAGGAGGGAGGCTGAGGCAGG - Intergenic
1177517236 21:22170656-22170678 TCTAAGTGGAAGGCGGAGGATGG - Intergenic
1177922286 21:27167156-27167178 GCTACTAGGGAGGCTGAGGAAGG + Intergenic
1178017333 21:28364530-28364552 CCTACTAGGGAGGCTGAGGCAGG - Intergenic
1178727050 21:35062357-35062379 TCTAAGTGAGAGGCAGAGAAAGG + Intronic
1178840841 21:36136380-36136402 CCTAAGAGGGAGTGAAATGAAGG + Intronic
1178900672 21:36595880-36595902 GCTAGGAGGGAGGCAGTGCAGGG - Intergenic
1179403766 21:41108686-41108708 GCTGGGAGGGGGGCAGAGGAGGG + Intergenic
1179484889 21:41703941-41703963 CCTACGAGGGAGGGAGTGGGGGG + Intergenic
1179611531 21:42555095-42555117 GCTAATAGGGAGGCTGAGGCAGG - Intronic
1179688560 21:43067506-43067528 CCCTAGAGGGGGGCAGAGGAGGG + Intronic
1179693328 21:43097227-43097249 CCTACTTGGGAGGCTGAGGAAGG - Intronic
1179987119 21:44928068-44928090 ACGCAGAGGAAGGCAGAGGAGGG - Intronic
1180034153 21:45234590-45234612 CAGAAGGGGGAGGCAGAGGTTGG + Intergenic
1180086186 21:45508977-45508999 CCTCTGAGGGAGACAGAGCAAGG + Intronic
1180276773 22:10650656-10650678 CCTAAGCAGGTGGCAGAGGAAGG + Intergenic
1180551254 22:16543717-16543739 CCTAAGCAGGTGGCAGAAGAAGG + Intergenic
1180583993 22:16869564-16869586 CCTAAGCAGGTGGCAGAAGAAGG + Intergenic
1180953698 22:19731874-19731896 CCCAACAGGGAGGTAGAGGAGGG + Intergenic
1181352752 22:22270211-22270233 CCTAAGCAGGTGGCAGAAGAAGG - Intergenic
1181533834 22:23531679-23531701 CCCCAGGAGGAGGCAGAGGAAGG - Intergenic
1181645305 22:24227935-24227957 GCTACTAGGGAGGCTGAGGAGGG + Intronic
1181725657 22:24809167-24809189 CCAAAGAGGTAAGCAAAGGAAGG - Intronic
1181732844 22:24859949-24859971 CCTAACAACCAGGCAGAGGAGGG - Intronic
1181787451 22:25237447-25237469 AAGAAGAGGGAAGCAGAGGAAGG - Intergenic
1181921816 22:26326760-26326782 CCTGGGAGGAAGGCAGAGGTGGG + Intronic
1181994066 22:26860970-26860992 CCTACTCGGGAGGCAGAGGCAGG - Intergenic
1182028358 22:27137983-27138005 CCGATGAGAGAGACAGAGGAGGG + Intergenic
1182089126 22:27582083-27582105 CCTAAGAGGGAATGACAGGAGGG - Intergenic
1182265536 22:29112074-29112096 GCTGAGAGAGAGGCAGAGAAGGG - Intronic
1182345863 22:29664308-29664330 CCTGAGAGGGAGGAAGGGGTGGG - Intronic
1182431538 22:30301836-30301858 CCTAGAAAGGAGGCAGAGGAAGG + Intronic
1182510149 22:30813912-30813934 GCTAATAGGGAGGCTGAGGCAGG - Intronic
1182619291 22:31609985-31610007 CCTTAGAGGGAGGCGGTGGCAGG + Intronic
1182854530 22:33505438-33505460 CCTAGAAGGGAGGCAGAGACTGG + Intronic
1182883222 22:33751877-33751899 CCTACTAGGGAGGCTGAGGTAGG - Intronic
1183108916 22:35634234-35634256 CCTAATAGGGAAGAAGGGGAGGG - Intronic
1183230716 22:36580299-36580321 CCAAGGAGGGAGGCAGAAGGCGG - Intronic
1183380995 22:37490475-37490497 CCCAAGAGGGAGGCATAGGCAGG + Exonic
1183432865 22:37776057-37776079 GCTAGAAGGGAGGCAGAGGATGG - Exonic
1183449809 22:37887038-37887060 GCTATGCGGGAGGCTGAGGAGGG - Intronic
1183652449 22:39165639-39165661 GCTACGAGGGAGGCTGAGGCAGG - Intergenic
1183915395 22:41114291-41114313 GCTACTAGGGAGGCTGAGGAAGG - Intronic
1184223502 22:43115572-43115594 GCTACTAGGGAGGCTGAGGAAGG - Intronic
1184523951 22:45010366-45010388 TATCAGAGGGAGGCGGAGGAGGG - Intergenic
1184558864 22:45249756-45249778 TCTACTAGGGAGGCTGAGGAAGG - Intergenic
1184654551 22:45934551-45934573 CCTATGGGGCAGGAAGAGGAGGG - Intronic
1184919706 22:47597157-47597179 CTTAAGGAGGAGACAGAGGAGGG - Intergenic
1185156040 22:49194100-49194122 CCTGAGAAGGAGGCATAGGAAGG + Intergenic
1185378025 22:50491370-50491392 GCTACTAGGGAGGCTGAGGAAGG - Intergenic
949136034 3:566586-566608 GCTACGAGGGAGGCTGAGGCAGG + Intergenic
949604540 3:5638783-5638805 TCTCAGAGGCAGGCAGAGAAAGG + Intergenic
949914140 3:8944422-8944444 GCTAATTGGGAGGCAGAGGCAGG + Intronic
950104015 3:10377031-10377053 CCAAAGAGAGAGGCAGAGATGGG + Intronic
950198426 3:11026079-11026101 CCTAAGAGCAAGCTAGAGGAGGG - Intronic
950298717 3:11855352-11855374 CCTACGGGGGAGGCTGAGGCAGG - Intergenic
950421956 3:12904587-12904609 CCCAAGAGGGGGGTGGAGGAGGG - Intronic
950571787 3:13804915-13804937 CCTGAGGAGGAGGAAGAGGAGGG - Intergenic
950902834 3:16513089-16513111 CCTAGGAAGGACGCAGAGGTGGG - Intronic
950910980 3:16591539-16591561 CTTCAGAGGGAGGCTGAGGTAGG - Intronic
951092832 3:18595456-18595478 GCTAATGGGGAGGCTGAGGAGGG - Intergenic
951207159 3:19936754-19936776 GCTACTAGGGAGGCTGAGGAAGG + Intronic
951702029 3:25506502-25506524 GCTAATCGGGAGGCTGAGGAAGG + Intronic
951780677 3:26359972-26359994 CCAAATAGGGAGGCTGAGGCAGG - Intergenic
951783898 3:26396830-26396852 GCTACGAGGGAGGCTGAGGCAGG + Intergenic
952050972 3:29384202-29384224 ACTAATAGGGAGGCTGAGGTGGG + Intronic
952069987 3:29623003-29623025 GCTACTAGGGAGGCTGAGGAAGG + Intronic
952450935 3:33432210-33432232 GCTACTAGGGAGGCAGAGGTAGG + Intronic
952944329 3:38467329-38467351 CCCAGGAGGGAGGCTGAGGCAGG + Intronic
953226674 3:41027857-41027879 GCTAAGGGGCAGGCAGATGAGGG + Intergenic
953887070 3:46720168-46720190 TTTAAGGGGAAGGCAGAGGAGGG - Intronic
954001349 3:47559806-47559828 GCTAAGCGGGAGGCTGAGGCAGG - Intergenic
954033343 3:47836239-47836261 GCTATGAGGGAGGCTGAGGCAGG - Intronic
954180380 3:48876982-48877004 CCTACTAGGGAGGCTGAGGCAGG + Intronic
954612459 3:51953019-51953041 CCTATGCGGGAGGCTGAGGCAGG + Intergenic
954633092 3:52057379-52057401 GTTGAGAGGGAGGCAGGGGAAGG - Intergenic
954802771 3:53196674-53196696 GCTTTGAGGGAGGCCGAGGAAGG - Intergenic
954807592 3:53229463-53229485 CCAAAGGGGCAGGCAGAGGGTGG + Intronic
954823161 3:53348604-53348626 CCTAATTGGGAGGCTGAGGCAGG - Intergenic
954993618 3:54862168-54862190 CCTCAGAGGGTTGCAGAAGAAGG + Intronic
955231381 3:57102012-57102034 CATGAGAGGGAGGCTGAGGCAGG + Intronic
955257877 3:57352975-57352997 GCTACGAGGGAGGCTGAGGCAGG + Intronic
955714578 3:61815296-61815318 GCTACGTGGGAGGCTGAGGAGGG + Intronic
955810858 3:62787181-62787203 CCTACGTGGGAGGCTGAGGCAGG + Intronic
955897633 3:63717558-63717580 TGGAAGAGGGAGGCAGAAGAGGG - Intergenic
956231828 3:67025975-67025997 GCTAATAGGGAGGCTGAGGTGGG - Intergenic
956786088 3:72643587-72643609 CCTGAGAGGGAAGATGAGGAGGG + Intergenic
956827530 3:73012409-73012431 GCTAAGCGGGAGGCTGAGGCAGG - Intronic
957187838 3:76966032-76966054 GCTATGAGGGAGGCTGAGGCAGG - Intronic
957875739 3:86144028-86144050 CCGAAGAGAGAGGCAGAGAAGGG - Intergenic
958140361 3:89554906-89554928 CCTACTAGGGAGGCTGAGGCAGG - Intergenic
958659466 3:97047386-97047408 CCTACTAGGGAGGCTGAGGCAGG + Intronic
958933912 3:100237554-100237576 CCTACTAGGGAGGCTAAGGAAGG + Intergenic
959011657 3:101084912-101084934 CCTATGTGGGAGGCTGAGGCAGG + Intergenic
959046464 3:101479694-101479716 GCTAATAGGGAGGCTGAGGTGGG + Intronic
959817947 3:110698087-110698109 GCTAAGAGGGAGGCGGGGGGAGG - Intergenic
959910747 3:111761071-111761093 GCTACTAGGGAGGCTGAGGAAGG + Intronic
960216088 3:115039224-115039246 CCTAAGAAGGGGGAAGAGGAAGG + Intronic
960458565 3:117903966-117903988 GCTAAGAGTGAGGGAGGGGATGG - Intergenic
960508759 3:118524017-118524039 GCTATGAGGGAGGCTGAGGCAGG - Intergenic
960521902 3:118664700-118664722 GCTACTTGGGAGGCAGAGGAGGG - Intergenic
960994790 3:123333592-123333614 CCCAGGAGGAAGGCAGGGGAGGG + Intronic
961484387 3:127206971-127206993 CCCAAGAGGCAGAGAGAGGAGGG - Intergenic
961669211 3:128516869-128516891 CATAAGAGGGAGGCAGAAGTGGG + Intergenic
961848892 3:129794873-129794895 CCTAAGGTGGAGGTAGAGAAGGG - Intronic
962736823 3:138332925-138332947 CCTCAGAGCAAGGCACAGGAGGG - Intergenic
962782343 3:138731362-138731384 GCTATGAGGGAGGCTGAGGTGGG - Intronic
962920041 3:139942463-139942485 CCTAAAACGGAGTCAGAAGAGGG - Intronic
963021554 3:140876820-140876842 CATAAGAGGCTGGCAGAGGCAGG + Intergenic
963062825 3:141238914-141238936 GCTGAGAAGGAGGAAGAGGAGGG + Intronic
963247406 3:143075541-143075563 GCTACGAGGGAGGCTGAGGCAGG + Intergenic
963402771 3:144822222-144822244 GCTAATAGGGAGGCTGAGGAAGG + Intergenic
963440689 3:145335676-145335698 CCTACTTGGGAGGCTGAGGAAGG - Intergenic
963721472 3:148866866-148866888 GCTAATAGGGAGGCTGAGGCAGG - Intronic
963796476 3:149635603-149635625 CGGAAGAGGGAGGAGGAGGAAGG + Intronic
963801417 3:149679699-149679721 CCTGAGAGGGAGCCAAAGGTTGG + Intronic
964311355 3:155396623-155396645 ACTGAGAAGGAGGAAGAGGAGGG + Intronic
964426904 3:156563129-156563151 CTTGAGACAGAGGCAGAGGAAGG - Intergenic
964444783 3:156747640-156747662 CCTAAGAGAAAGCCACAGGAGGG - Intergenic
965646510 3:170887638-170887660 ACCCAGAGGGAGGCATAGGAGGG - Intergenic
965998190 3:174912658-174912680 CCTAAGAATGAAGCACAGGATGG + Intronic
966006914 3:175025919-175025941 CCTACTAGGGAGGCTGAGGTGGG - Intronic
966147320 3:176826619-176826641 TGTAAGAGAGAGGCAGAGGAGGG - Intergenic
966644309 3:182226230-182226252 TGAAAGAGGGAGGCAGAAGAGGG - Intergenic
966799853 3:183752907-183752929 GCTAACAGGGAGGCTGAGGCAGG - Intronic
966836461 3:184053112-184053134 ACTGACAGTGAGGCAGAGGAGGG - Exonic
966972462 3:185057592-185057614 GCTAAAAGGGAGGCAGAGGTGGG + Intergenic
967526968 3:190506229-190506251 CCTACTAGGGAGGCTGAAGAAGG + Intergenic
967861511 3:194155579-194155601 CCTACGTGGGAGGCTGAGGCAGG - Intergenic
968131237 3:196194044-196194066 GCTGAGTGGGAGGCAGCGGAGGG + Intergenic
968205740 3:196798453-196798475 CCTACTAGGGAGGCTGAGGCAGG - Intronic
968417255 4:450823-450845 ACTACTAGGGAGGCTGAGGAAGG + Intronic
968919771 4:3516507-3516529 CTGAAGCAGGAGGCAGAGGATGG + Intronic
968986385 4:3877095-3877117 CAAAAGAGCAAGGCAGAGGAAGG + Intergenic
969225668 4:5796876-5796898 CCTAAGAGGATGGCAGCAGAGGG + Intronic
969319806 4:6404850-6404872 GCTAAGAGGCAGGCAAGGGAGGG + Intronic
969326737 4:6448573-6448595 CCTGAGACGGAGGGAGAGAAGGG - Intronic
969407770 4:7005585-7005607 CCTACTCGGGAGGCTGAGGAAGG + Intronic
969592722 4:8131037-8131059 TCTAAGAGAGAGGCAGAGTGGGG - Intronic
969933294 4:10654987-10655009 CCTACTAGGGAGGCTGAGGCAGG + Intronic
970133207 4:12893804-12893826 GCTACCAGGGAGGCAGAGGGAGG - Intergenic
970146549 4:13042205-13042227 CCTAAGAGAGAGGAAGAAGGGGG - Intergenic
970898772 4:21134212-21134234 ACTAAGAAGGAGGAAGAGGAGGG - Intronic
971119362 4:23687098-23687120 CCTACTAGGCAGGCAGAGAATGG + Intergenic
971207718 4:24585957-24585979 GCTAGGAGGGAGGCTGAGGCAGG - Intergenic
971729694 4:30361445-30361467 CTTAAAAAGGTGGCAGAGGAAGG - Intergenic
972489259 4:39571466-39571488 CCTACTAGGGAGGCTGAGGTGGG + Intronic
972602110 4:40581952-40581974 GCTAAGATGGGTGCAGAGGAGGG - Intronic
972620648 4:40745254-40745276 GCTACTAGGGAGGCTGAGGAAGG - Intergenic
972624422 4:40782454-40782476 GCTACGAGGGAGGCTGAGGCTGG + Intronic
973220817 4:47723882-47723904 CCTACTAGGGAGGCTGAGGCAGG + Intronic
973283653 4:48390184-48390206 ACTAAGAGGGAGGCTGAGGCAGG - Intronic
973318913 4:48790112-48790134 GCTACTAGGGAGGCTGAGGAAGG - Intergenic
973328168 4:48885095-48885117 ACTGAGAGGGAGGCTGAGGCAGG - Exonic
974253035 4:59413612-59413634 GCTATGTGGGAGGCTGAGGAAGG - Intergenic
974259732 4:59510505-59510527 CCTACTAGGGAGGCTGAGGCAGG - Intergenic
974329283 4:60455783-60455805 CCTCAGAGGGAGGCAGGCCAGGG - Intergenic
974511502 4:62848129-62848151 CCTCACAGGGAGGGAGAGGGTGG + Intergenic
975177211 4:71301576-71301598 GCTATGAGGGAGGCAGAATAAGG - Intronic
975512654 4:75210886-75210908 CCTGAGAGGGAGCCAGGGCATGG - Intergenic
975603910 4:76133415-76133437 GCTACGAGGGAGGCTGAGGCAGG - Intronic
975866985 4:78734019-78734041 CCTAGGTGGGAGGCAGTGGTGGG - Intergenic
976036129 4:80823270-80823292 GCAAAGAGGGAGGCAGGTGAAGG - Intronic
976057326 4:81083360-81083382 GCTACGAGGGAGGCTGAGGTGGG + Intergenic
976422723 4:84864999-84865021 GCTACTAGGGAGGCTGAGGAGGG - Intronic
977931876 4:102758652-102758674 GCTACGAGGGAGGCTGAGGTGGG - Intronic
978103677 4:104875041-104875063 GCTACGAGGGAGGCTGAGGCAGG + Intergenic
978360631 4:107927903-107927925 CAAAAGAGGGGGGCAGGGGAAGG - Intergenic
978448758 4:108806015-108806037 GCTATTCGGGAGGCAGAGGAAGG + Intergenic
978575648 4:110187582-110187604 ACTAATAGGGAGGCTGAGGCAGG + Intronic
978913236 4:114091388-114091410 CCTACTAGGGAGGCTGAGGTGGG - Intergenic
979649007 4:123107740-123107762 CATGGGAGGGAGGCTGAGGAGGG - Intronic
979923288 4:126527384-126527406 GCTACTAGGGAGGCTGAGGAAGG + Intergenic
980286147 4:130781341-130781363 GCTAATAGGGAGGCTGAGGCAGG - Intergenic
980326115 4:131348944-131348966 GCTACGAGGGAGGCTGAGGCAGG - Intergenic
980911351 4:138997590-138997612 CCTAACAGGGAGCAAGGGGAGGG - Intergenic
980946683 4:139327775-139327797 GCTACTAGGGAGGCAGAGGCAGG - Intronic
981035467 4:140164152-140164174 GCTACGTGGGAGGCTGAGGAGGG + Intergenic
981478281 4:145210019-145210041 CCTACGTGGGAGGCTGAGGCAGG + Intergenic
982067780 4:151669835-151669857 CCCAAAAGGTAGGCAGAGAAAGG - Intergenic
982225951 4:153166658-153166680 CCTACTAGGGAGGCAGATGCAGG - Intronic
982260010 4:153486855-153486877 CCTAAGTGGGAGGAAGGGAATGG + Intronic
982705225 4:158701655-158701677 ATTAAGAGGGACTCAGAGGAGGG - Intronic
982737477 4:159021055-159021077 CCTAAGAGAACGGCAGAGGCCGG - Intronic
982747573 4:159120964-159120986 GCTAGTAGGGAGGCAGAGGATGG - Intronic
983045349 4:162980256-162980278 CCTCAGAGGTAGGCAGGGGTAGG + Intergenic
984137992 4:175965723-175965745 GCTACTAGGGAGGCTGAGGAAGG - Intronic
984636012 4:182110434-182110456 CCTACTCGGGAGGCTGAGGAGGG - Intergenic
984811878 4:183802484-183802506 CCTACTAGGGAGGCTGAGGCAGG - Intergenic
984992894 4:185398067-185398089 CCTACTAGGGAGGCTGAGGCAGG - Intronic
985231623 4:187824485-187824507 GCAAAAAGGGAGACAGAGGATGG + Intergenic
985424789 4:189819619-189819641 GCTACGTGGGAGGCTGAGGAAGG - Intergenic
985606552 5:861212-861234 CTGAATTGGGAGGCAGAGGAGGG - Intronic
985905940 5:2836700-2836722 GCTACTCGGGAGGCAGAGGAGGG - Intergenic
986117915 5:4798544-4798566 GCTACTAGGGAGGCTGAGGAGGG - Intergenic
986176921 5:5360313-5360335 GCTAAGAGGAGGGGAGAGGAAGG + Intergenic
986285250 5:6354283-6354305 TCAGAGAGGGAGGCAGAGGCTGG + Intergenic
986285317 5:6354572-6354594 CGGAAGAAGGAGGCAGAGGCTGG + Intergenic
986661360 5:10062956-10062978 ACTCAGAGGCAGACAGAGGAGGG - Intergenic
986664638 5:10090098-10090120 CAGAAGAGGGAGGCAGAAGAGGG + Intergenic
987362855 5:17122351-17122373 CCTAAGAGGGAGTGAGAGAAGGG - Intronic
987793039 5:22592916-22592938 GCTACTAGGGAGGCAGAGGTAGG + Intronic
988067790 5:26244171-26244193 ACTAATAGGGAGGCTGAGGCAGG - Intergenic
988386192 5:30568378-30568400 CTGAAGAGGGAGGCAGAGTTCGG - Intergenic
988540026 5:32100309-32100331 GTTAATTGGGAGGCAGAGGAAGG - Intronic
988776923 5:34485423-34485445 GCTACGTGGGAGGCTGAGGAAGG - Intergenic
989023054 5:37032661-37032683 GCTACGTGGGAGGCAGAGGCAGG + Intronic
989551541 5:42741279-42741301 TTTAAGAGTGAGGCAGAAGAGGG - Intergenic
989625923 5:43429466-43429488 GCTACTAGGGAGGCTGAGGAAGG - Intergenic
990183956 5:53192627-53192649 CATAAGAGAGAGGCAGAGGGGGG + Intergenic
990523297 5:56600626-56600648 CATAACAGGGAGGCACTGGAAGG + Intronic
990567660 5:57045851-57045873 GCTACTAGGGAGGCTGAGGAAGG - Intergenic
990739681 5:58899711-58899733 CCTACTAGGGAGGCTGAGGCAGG - Intergenic
990790373 5:59471131-59471153 GCTACTAGGGAGGCAGAGGCAGG + Intronic
991331874 5:65501288-65501310 GCTACTAGGGAGGCAGAGGTAGG - Intergenic
991609733 5:68437466-68437488 GCTAGGAGGAAAGCAGAGGAAGG - Intergenic
992041720 5:72841230-72841252 CCTACTAGGGAGGCTGAGGCAGG - Intronic
992079379 5:73219661-73219683 CCTGAAAGGCATGCAGAGGAGGG - Intergenic
992198368 5:74361567-74361589 GTAAACAGGGAGGCAGAGGAGGG + Intergenic
992225765 5:74618619-74618641 GCTAATAGGGAGGCTGAGGTGGG + Intergenic
993713280 5:91249304-91249326 GCTACGAGGGAGGCTGAGGTGGG - Intergenic
993736257 5:91479859-91479881 CCTAACTGGGAGAAAGAGGATGG - Intergenic
994132868 5:96250496-96250518 CCTAACAGGGAGGCAGACTCAGG - Intergenic
994401659 5:99288035-99288057 GCTACTAGGGAGGCTGAGGAAGG + Intergenic
994779518 5:104071390-104071412 GCTACTAGGGAGGCTGAGGAAGG + Intergenic
995137674 5:108697508-108697530 TTTAAGAGAGAGGCAGGGGAAGG - Intergenic
995280585 5:110331192-110331214 CCAAAGCGGGGGGCAGAGGATGG + Intronic
995310011 5:110699778-110699800 CCTCAGAGGGTGGTGGAGGAGGG - Intronic
995499287 5:112786199-112786221 ACTATGTGGGAGGCTGAGGAAGG - Intronic
995870839 5:116741519-116741541 CCTATGTGGGAGGCTGAGGCAGG + Intergenic
995900180 5:117056443-117056465 CCCAAGAGGGAAGTAGAGGGGGG + Intergenic
996368134 5:122724704-122724726 GCTACGAGGGAGGCTGAGGCAGG + Intergenic
996455249 5:123674357-123674379 GCTACCAGGGAGGCAGAGGTTGG - Intergenic
996607890 5:125345257-125345279 TCTAAGAGTGAGGCAGAGTGGGG + Intergenic
996846228 5:127902158-127902180 GCTACGAGGGAGGCTGAGGCAGG + Intergenic
996985886 5:129564029-129564051 GCTAAGGGGGAGGCTGAGGCAGG - Intronic
997145406 5:131427989-131428011 CCTACTTGGGAGGCTGAGGAGGG + Intronic
997294493 5:132761207-132761229 CCTAAGTGAGCTGCAGAGGAAGG - Exonic
997343062 5:133161692-133161714 CATGAGAAGGAGGCAGAGGGAGG + Intergenic
997735361 5:136209035-136209057 ACTAGGAGGGAGAAAGAGGAAGG - Intergenic
998064726 5:139148712-139148734 TGTAAGAGTGAGGCAAAGGACGG - Intronic
998072437 5:139208636-139208658 CTTTAGAGGGAGGCCGAGGTGGG - Intronic
999144525 5:149383550-149383572 CCTACCAGGGAGGGAGGGGAGGG - Intronic
999266247 5:150268869-150268891 CTCAAGAGGGAGGCAGAGAAGGG - Intronic
999266372 5:150269457-150269479 CTCAAGAGGGAGACTGAGGAGGG - Intronic
999275776 5:150329119-150329141 CCAAAGAGGCAGTCAGGGGAAGG - Intronic
999854131 5:155575014-155575036 CCTACGTGGGAGGCTGAGGCAGG + Intergenic
1000309119 5:160024606-160024628 GCTATGAGGGAGGCTGAGGCAGG - Intronic
1000320570 5:160131297-160131319 GCTAGGAGGGAGGCTGAGGCAGG - Intergenic
1000332142 5:160214273-160214295 GCTAATAGGGAGGCTGAGGCTGG - Intronic
1000336852 5:160247784-160247806 GCTAAGCGGGAGGCTGAGGCAGG + Intergenic
1000446039 5:161322345-161322367 GCTACAAGGGAGGCAGAGGCAGG - Intronic
1000505997 5:162118905-162118927 ACTCAGAGGAAGACAGAGGAAGG + Intronic
1000592346 5:163173606-163173628 CTTATGAGGGAGGCACAAGAAGG - Intergenic
1000714380 5:164622589-164622611 GCTAAGTGGGAGGCTGAGGCAGG + Intergenic
1000721005 5:164707199-164707221 GCTACTAGGGAGGCAGAGGTGGG + Intergenic
1000813772 5:165894289-165894311 CCTAAGAGGGAGAAAGAACATGG - Intergenic
1000998985 5:167987437-167987459 CCTACTTGGGAGGCAGAGGCAGG - Intronic
1001089773 5:168728804-168728826 GCTACTAGGGAGGCAGAGGTGGG + Intronic
1001091427 5:168744175-168744197 GCTAAGGGGGAGGCTGAGGCAGG + Intronic
1001115830 5:168938740-168938762 CCTACTAGGGAGGCTGAGGCGGG - Intronic
1001147619 5:169198580-169198602 AGTAAGAGGGAGCCAGAGAAAGG + Intronic
1001568239 5:172714143-172714165 CCTCCGGGGGAGGCAGGGGAGGG - Intergenic
1001772083 5:174304204-174304226 CCAAAGATGGAGGCGGAGGTTGG - Intergenic
1002027117 5:176403159-176403181 CCTACTTGGGAGGCAGAGGCAGG - Intronic
1002063039 5:176637723-176637745 CAGCAGAGGGAGGGAGAGGAGGG + Intronic
1002178130 5:177414070-177414092 CCTAAGAAGGAGCTAGTGGAAGG - Intronic
1002329116 5:178429327-178429349 CTCTAGAGGAAGGCAGAGGAGGG - Intronic
1002358157 5:178647864-178647886 CCTACTAGGGAGGCTGAGGCAGG - Intergenic
1002376610 5:178793527-178793549 CCTAAGATGGAGCCACAGGTTGG + Intergenic
1002542696 5:179916732-179916754 CCCAAGAGGAGGGCAGAGGCAGG + Intronic
1002661069 5:180791534-180791556 CCTAAGAGGGAAACACAGGCAGG + Exonic
1002682076 5:180973805-180973827 GCTAATGGGGAGGCTGAGGAGGG + Intergenic
1002713630 5:181210742-181210764 GCTACGAGGGAGGCTGAGGCAGG - Intergenic
1003148537 6:3529272-3529294 ACTTGGAGGGAAGCAGAGGAGGG - Intergenic
1003246092 6:4383467-4383489 GCTACTAGGGAGGCTGAGGAAGG + Intergenic
1003293772 6:4805738-4805760 ACAAAGAGGTAGACAGAGGAAGG - Intronic
1003331115 6:5129537-5129559 TCTAAGAGGAAGGCAGAGGGAGG - Intronic
1003382332 6:5636617-5636639 CTTCAGAGGGAGGCAGAGAAGGG + Intronic
1003472232 6:6447801-6447823 CCTAAGAGGTAGGCAGATTAGGG - Intergenic
1003508325 6:6758502-6758524 GCTAATAGGGAGGCTGAGGTGGG + Intergenic
1003727113 6:8777226-8777248 GCTAAGCGGGAGGCTGAGGCAGG + Intergenic
1003892833 6:10578556-10578578 CCTACGCGGGAGGCTGAGGCAGG - Intronic
1004066139 6:12246274-12246296 CCTAAGAGGCGGGCTGTGGAAGG - Intergenic
1004119513 6:12806561-12806583 GCTAGGAGGGAGGCTGAGGCAGG - Intronic
1004403701 6:15312164-15312186 GCTAATTGGGAGGCTGAGGAAGG - Intronic
1004407393 6:15346845-15346867 GCTACTTGGGAGGCAGAGGAAGG - Intronic
1004714753 6:18206403-18206425 GCTAAGTGGGAGGCTGAGGTGGG + Intronic
1004786787 6:18976699-18976721 GCTACTAGGGAGGCTGAGGAAGG + Intergenic
1004940060 6:20546663-20546685 GCTACTAGGGAGGCAGAGGCAGG - Intronic
1004950971 6:20671848-20671870 GCTACTAGGGAGGCAGAGGCAGG - Intronic
1005301221 6:24472885-24472907 GCTACGAGGGAGGCTGAGGCAGG - Intronic
1005827275 6:29641224-29641246 GCTACGGGGGAGGCTGAGGAAGG + Intergenic
1005903274 6:30237861-30237883 CCTACCTGGGAGGCTGAGGAAGG + Intergenic
1006095505 6:31653791-31653813 CCTACTAGGGAGGCTGAGGTGGG - Intronic
1006095664 6:31655051-31655073 GCTACTAGGGAGGCTGAGGAGGG - Intronic
1006197619 6:32255423-32255445 TTTAAGAGGCAGGCGGAGGAAGG - Intergenic
1006294597 6:33164522-33164544 CCTCAGAGGGAGACAGAGACGGG + Intronic
1006422219 6:33942148-33942170 CCTAAAAAGGAGGCAGGGAATGG + Intergenic
1006484615 6:34328631-34328653 GCTACTTGGGAGGCAGAGGAGGG - Intronic
1006656997 6:35604117-35604139 GCTACTAGGGAGGCTGAGGAAGG - Intronic
1006659043 6:35623826-35623848 GCTACTAGGGAGGCAGAGGCAGG - Intronic
1006670819 6:35728743-35728765 CCTCGGAGGGAGGGAGAGGCAGG + Intergenic
1006732138 6:36244147-36244169 TCTAAGAGAGAGAGAGAGGAAGG - Intronic
1006749726 6:36369345-36369367 CCTAAGTGGCAGGTAGAGCAGGG + Intronic
1006781540 6:36635869-36635891 GCTACTAGGGAGGCTGAGGAAGG - Intergenic
1006889228 6:37410408-37410430 GCTACTAGGGAGGCAGAGGCAGG + Intergenic
1007554751 6:42756502-42756524 CTCAAGAGAGAGGCAGAGGGAGG - Intronic
1007733396 6:43965450-43965472 GCTAAGAGGGAGGGAGATGGGGG - Intergenic
1007817154 6:44532587-44532609 CCTAGGAGGCAGGCAAAGGGGGG + Intergenic
1007834057 6:44660830-44660852 CCTCAAAGGGAAGCAGAAGATGG - Intergenic
1007953955 6:45899540-45899562 ACTAAGAGAGAGGCAGAGGCAGG - Exonic
1007985553 6:46204238-46204260 GCTACTAGGGAGGCAGAGGCAGG - Intergenic
1008544976 6:52576562-52576584 CCCAAGGGGGCGGCAGAGCATGG + Intronic
1008615403 6:53221388-53221410 GCTACCAGGGAGGCAGAGGCAGG - Intergenic
1009463657 6:63944820-63944842 GCTACTAGGGAGGCTGAGGAAGG + Intronic
1009838905 6:69041714-69041736 CCTACTAGGGAGGCTGAGGCGGG - Intronic
1010009829 6:71037073-71037095 TATAAGAGGGAGGCAGAGGGAGG + Intergenic
1010169247 6:72955806-72955828 GCTACTAGGGAGGCAGAGGTGGG + Intronic
1010243476 6:73639932-73639954 CCTACTTGGGAGGCTGAGGAAGG + Intronic
1010417181 6:75625755-75625777 GCTACGTGGGAGGCTGAGGAAGG + Intronic
1010852062 6:80789552-80789574 GCTACTAGGGAGGCTGAGGAAGG + Intergenic
1010885929 6:81240395-81240417 CCTACTCGGGAGGCTGAGGAAGG + Intergenic
1011463186 6:87627405-87627427 GCTACGAGGGAGGCTGAGGCAGG - Intronic
1011463934 6:87635683-87635705 GCTATGAGGGAGGCTGAGGCAGG + Intronic
1011464853 6:87644587-87644609 GCTACGAGGGAGGCTGAGGCAGG + Intronic
1011475282 6:87745376-87745398 CCTACCAGGGAGGCTGAGGTGGG - Intergenic
1011476672 6:87755441-87755463 TATAAGAGGGAGGCAGAGGGCGG - Intergenic
1011587762 6:88945082-88945104 CCTGAGAAGGAGGCAGGGGTTGG - Intronic
1011678185 6:89756807-89756829 GCTAATAGGGAGGCTGAGGCAGG + Intronic
1011704010 6:89983137-89983159 TTAAAGAAGGAGGCAGAGGATGG - Intronic
1011854707 6:91675368-91675390 GCTACTAGGGAGGCTGAGGAAGG - Intergenic
1012216991 6:96599305-96599327 GCTACGAGGGAGGCTGAGGCAGG - Intronic
1012409162 6:98936507-98936529 ACTAAGAGGGAGGAAGAGGATGG - Intronic
1012897223 6:104964272-104964294 GCTATTAGGGAGGCTGAGGAGGG - Intronic
1012990784 6:105923657-105923679 GCTAATAGGGAGGCTGAGGCAGG - Intergenic
1013250808 6:108331172-108331194 CCTAATTGGGAGGCTGAGGTGGG + Intronic
1013264242 6:108479101-108479123 CCTACCAGGGAGGCTGAGGTGGG - Intronic
1013572203 6:111440176-111440198 ACTAGGAGGGAGGCCGAGGTAGG - Intronic
1014541147 6:122678017-122678039 GCTACTAGGGAGGCAGAGGCAGG - Intronic
1014589963 6:123252730-123252752 GCTACTCGGGAGGCAGAGGAGGG - Intronic
1014742145 6:125158068-125158090 TATAAGAGAGAGGCAGAGGGAGG - Intronic
1015134049 6:129847884-129847906 GCTACCAGGGAGGCTGAGGAAGG - Intronic
1015400238 6:132780343-132780365 CATAAGTGGGAGGCTGAGGTGGG - Intronic
1015530825 6:134219646-134219668 GCTACTAGGGAGGCAGAGGCAGG + Intronic
1016068713 6:139711504-139711526 GCTACTAGGGAGGCTGAGGAGGG - Intergenic
1016097955 6:140061255-140061277 AATAAGATGGAGACAGAGGATGG + Intergenic
1016228314 6:141770579-141770601 CTTAAGTGGGAGGCAGAGGAAGG - Intergenic
1016384386 6:143516261-143516283 CCTTAGAGAGAAGCAGGGGAGGG + Intergenic
1016480431 6:144475461-144475483 GGTTAGAGGTAGGCAGAGGATGG + Intronic
1016801792 6:148176238-148176260 GCTACCAGGGAGGCAGAGGCAGG + Intergenic
1016809343 6:148244560-148244582 CTCTAGTGGGAGGCAGAGGAAGG + Intergenic
1016967662 6:149733934-149733956 GCTACTAGGGAGGCAGAGGCAGG - Intronic
1017097500 6:150817667-150817689 GCTAACAGGGAGGCTGAGGCAGG - Intronic
1017516272 6:155158664-155158686 TCTATGTGGGAGGCAGAGGTGGG - Intronic
1018070358 6:160159285-160159307 GCTATTAGGGAGGCAGAGGTGGG + Intergenic
1018130085 6:160721695-160721717 CCTAAGAGGGAGGTAGACCAGGG - Intronic
1018367471 6:163136232-163136254 CATCAGAGAGAGGCAGAGCAGGG - Intronic
1018607398 6:165612478-165612500 GCTAATAGGGAGGCTGAGGCAGG - Intronic
1018632122 6:165830454-165830476 CCTCATATGGAGGCAGAGGCTGG - Intronic
1019213283 6:170423240-170423262 CCTAAGCGGGCGGCACAGAAGGG + Intergenic
1019606165 7:1911304-1911326 CCTGAGGAGGAGGGAGAGGAGGG - Intronic
1019672397 7:2288230-2288252 CCTACTCGGGAGGCTGAGGAAGG + Intronic
1019785123 7:2971866-2971888 GCTACGAGGGAGGCTGAGGCAGG + Intronic
1020056144 7:5118571-5118593 GCTAAGTGGGAGGCTGAGGCAGG + Intergenic
1020327714 7:6987972-6987994 GCTACTAGGGAGGCTGAGGAAGG + Intergenic
1020565983 7:9796158-9796180 CATAAAATGGAGGAAGAGGAAGG - Intergenic
1020639653 7:10739397-10739419 CCTACGTGGGAGGCTGAGGCAGG + Intergenic
1020672677 7:11137695-11137717 CCTAATCGGGAGGCTGAGGTAGG - Intronic
1020674561 7:11165675-11165697 CCTAAGAGGAAGGAAAAGAATGG + Intronic
1020814974 7:12894182-12894204 GCTACTAGGGAGGCAGAGGCAGG - Intergenic
1021687716 7:23203286-23203308 CCCAAGAGGGAGGTAGTAGAAGG + Intergenic
1021900372 7:25279298-25279320 ACAAAAAGGCAGGCAGAGGAAGG + Intergenic
1021981960 7:26064044-26064066 GCTACTAGGGAGGCAGAGGCAGG + Intergenic
1022176234 7:27874379-27874401 CCTGAGGGGGTGGCAAAGGAGGG - Intronic
1022257232 7:28671141-28671163 CCTACGTGGGAGGCTGAGGTGGG + Intronic
1023054865 7:36283332-36283354 CAGGTGAGGGAGGCAGAGGAAGG + Intronic
1023076387 7:36486495-36486517 ACTCAAAGGCAGGCAGAGGAAGG - Intergenic
1023159880 7:37286653-37286675 CCAAAGAAGGAGGGAGAGAAGGG + Intronic
1023282711 7:38588061-38588083 CCTACTTGGGAGGCAGAGGTGGG - Intronic
1023362003 7:39426567-39426589 AAGAAGAGGGAGGAAGAGGAGGG - Intronic
1023566946 7:41532858-41532880 TCTCAGAGAAAGGCAGAGGAAGG - Intergenic
1023959447 7:44914175-44914197 CCAAAGAGGGAGGGAGGGAAAGG - Intergenic
1023985476 7:45091978-45092000 CCTACTAGGGAGGCTGAGGCAGG + Intergenic
1024136961 7:46419045-46419067 GCTAAGAGTGTGGCAGAGTAAGG + Intergenic
1024429291 7:49267299-49267321 GCTATGAGGGAGGCTGAGGCAGG + Intergenic
1024726580 7:52203903-52203925 GCTACTAGGGAGGCTGAGGAGGG - Intergenic
1024855870 7:53778616-53778638 GCTACTTGGGAGGCAGAGGAGGG + Intergenic
1025052300 7:55741512-55741534 GCCATGAGGGAGGCAGAGGCCGG - Intergenic
1025113142 7:56236061-56236083 GCTAATAGGGAGGCTGAGGTGGG + Intergenic
1025114864 7:56248850-56248872 CCTACTAGGGAGGCTGAGGCAGG + Intergenic
1025126051 7:56346008-56346030 CCTACTGGGGAGGCTGAGGAAGG + Intergenic
1025130278 7:56371296-56371318 GCCATGAGGGAGGCAGAGGCCGG - Intergenic
1025130598 7:56372594-56372616 GCCATGAGGGAGGCAGAGGCCGG - Intergenic
1025130916 7:56373888-56373910 GCCATGAGGGAGGCAGAGGCCGG - Intergenic
1025176023 7:56802904-56802926 GCCATGAGGGAGGCAGAGGCTGG + Intergenic
1025187874 7:56875127-56875149 CCTACTAGGGAGGCTGAGGTGGG + Intergenic
1025188149 7:56876801-56876823 CCTACTAGGGAGGCTGAGGTGGG + Intergenic
1025188363 7:56878127-56878149 CCTACTAGGGAGGCTGAGGTGGG + Intergenic
1025617656 7:63136737-63136759 GCTACTAGGGAGGCTGAGGAAGG + Intergenic
1025683567 7:63698793-63698815 CCTACTAGGGAGGCTGAGGTGGG - Intergenic
1025683774 7:63700119-63700141 CCTACTAGGGAGGCTGAGGTGGG - Intergenic
1025684047 7:63701797-63701819 CCTACTAGGGAGGCTGAGGTGGG - Intergenic
1025694080 7:63766006-63766028 GCCATGAGGGAGGCAGAGGCTGG + Intergenic
1025695772 7:63773518-63773540 GCCATGAGGGAGGCAGAGGCTGG - Intergenic
1025769937 7:64495127-64495149 CATTAGAGGGACGCACAGGAAGG - Intergenic
1025930093 7:65986541-65986563 GCTAATGGGGAGGCTGAGGAAGG + Intergenic
1025933134 7:66012270-66012292 CCTACTCGGGAGGCAGAGGCAGG + Intergenic
1025952263 7:66154726-66154748 GCTACTCGGGAGGCAGAGGAAGG - Intergenic
1026020923 7:66705323-66705345 CCTACTAGGGAGGCTGAGGCAGG + Intronic
1026138214 7:67682019-67682041 CCTAGTAGGGAGGCTGAGGCAGG + Intergenic
1026262909 7:68771193-68771215 CCTTAAAGGGAGGCTGAGGCAGG + Intergenic
1026405994 7:70065952-70065974 CCTGAGAAGGAGGCTGAGGCAGG - Intronic
1026467606 7:70668089-70668111 CCTACGTGGGAGGCTGAGGCAGG - Intronic
1026653482 7:72235995-72236017 GCTCTTAGGGAGGCAGAGGAGGG + Intronic
1026737248 7:72956811-72956833 TATAAGAGAGAGGCAGAGGAAGG + Intergenic
1026787446 7:73310793-73310815 TATAAGAGAGAGGCAGAGGAAGG + Intergenic
1026950748 7:74344913-74344935 CCCAAGGAGGAGACAGAGGAGGG + Intronic
1026977033 7:74505337-74505359 CCTCAGATGGAGGGAGAGGCAGG - Intronic
1027056041 7:75050168-75050190 GCTACCAGGGAGGCTGAGGAAGG + Intronic
1027106484 7:75408257-75408279 TATAAGAGAGAGGCAGAGGAAGG - Intronic
1027129698 7:75582151-75582173 TCTGGAAGGGAGGCAGAGGAAGG + Exonic
1027195267 7:76025676-76025698 GCTACGAGGGAGGCTGAGGCAGG + Intronic
1027221664 7:76218086-76218108 CCTGGGAGCTAGGCAGAGGAAGG - Intronic
1027251148 7:76399645-76399667 GCTACTTGGGAGGCAGAGGAGGG - Intronic
1027262357 7:76474031-76474053 CCTACTAGGGAGGCTGAGGCAGG - Intronic
1027263222 7:76479531-76479553 GCTAATAGGGAGGCTGAGGTGGG + Intronic
1027313739 7:76972130-76972152 CCTACTAGGGAGGCTGAGGCAGG - Intergenic
1027314606 7:76977636-76977658 GCTAATAGGGAGGCTGAGGTGGG + Intergenic
1027343520 7:77234621-77234643 CCTAATTGGGAGGCTGAGGCAGG + Intronic
1027913836 7:84288584-84288606 GCTACTAGGGAGGCTGAGGAAGG + Intronic
1028129456 7:87152738-87152760 CCTAAGAGGGAGGCCCTGGCCGG - Exonic
1028209185 7:88052395-88052417 GCTACCAGGGAGGCAGAGGCAGG + Intronic
1028405101 7:90466010-90466032 CCTAGGCAGGAGGAAGAGGAAGG - Intronic
1028443592 7:90892888-90892910 GCTAATTGGGAGGCAGAGGCAGG - Intronic
1028608060 7:92677505-92677527 GCTAATAGGGAGGCTGAGGCAGG + Intronic
1028610066 7:92700732-92700754 CCTTTGAGGAAGGCAGAGGTGGG + Intronic
1028866334 7:95717832-95717854 GCTAAGTGGGAGGCTGAGGCTGG - Intergenic
1028965511 7:96797336-96797358 GCTACTAGGGAGGCTGAGGAAGG - Intergenic
1029024549 7:97402126-97402148 ACTTGGAGGGAGGGAGAGGAGGG + Intergenic
1029116446 7:98239995-98240017 GCTACGAGGGAGGCTGAGGCAGG + Intronic
1029516394 7:101026139-101026161 CCTAAGAGGTGGGAAGAGGGTGG - Intronic
1029601438 7:101565799-101565821 ACTCAGAAGGAGGCAGAGGCTGG - Intergenic
1029998339 7:105031638-105031660 CCTAATTGGGAGGCTGAGGCAGG + Intronic
1030099117 7:105929510-105929532 GCTACGAGGGAGGCTGAGGAGGG + Intronic
1030213044 7:107015308-107015330 CCTAATTGGGAGGCTGAGGCAGG + Intergenic
1030297617 7:107944656-107944678 CCTAAGAGGCAGGCACCAGAAGG + Intronic
1030352085 7:108500955-108500977 CCTCAGATGGTGGCAGTGGAAGG - Intronic
1031411826 7:121448570-121448592 ACTACTAGGGAGGCAGAGGCAGG + Intergenic
1031434771 7:121719710-121719732 ACTAAGGGGGAGGAAGAAGAGGG - Intergenic
1031798008 7:126202167-126202189 GCTAGTAGGGAGGCAGAGGCAGG + Intergenic
1031964260 7:128016227-128016249 GCTACTAGGGAGGCTGAGGAGGG - Intronic
1032169299 7:129571089-129571111 TCTAAGAGACAGGTAGAGGAAGG - Intergenic
1032197191 7:129796285-129796307 ACGCAGAGGGAGGCTGAGGAGGG - Intergenic
1032221946 7:130001114-130001136 GCTATTAGGGAGGCTGAGGAAGG - Intergenic
1032384427 7:131511700-131511722 GCTCTGAGGGAGGCAGAGGCGGG - Intronic
1032576604 7:133061129-133061151 CCTAAGAGGAAGGCCGGGGTGGG + Intronic
1033087719 7:138357673-138357695 CCTACGCGGGAGGCTGAGGCAGG - Intergenic
1033099198 7:138456290-138456312 CCTACTCAGGAGGCAGAGGAGGG - Intergenic
1033423901 7:141226108-141226130 TCCAAGAGTGAGGCAGTGGATGG - Intronic
1033641743 7:143268361-143268383 CCTCAGTGGGAGGCTGAGGCAGG + Intronic
1033800194 7:144892156-144892178 CCTAAGCAGGAAGCAGAGCAAGG - Intergenic
1033859261 7:145605071-145605093 GCTACTAGGGAGGCAGAGGTGGG + Intergenic
1033923502 7:146426072-146426094 GCTACGCGGGAGGCTGAGGAAGG + Intronic
1034514430 7:151563689-151563711 GCTAATAGGGAAGCTGAGGAAGG - Intronic
1034552796 7:151832198-151832220 GATTAGAGGGAGGAAGAGGAGGG + Intronic
1034579553 7:152030855-152030877 CATAAGTGGCTGGCAGAGGAAGG - Intronic
1034950364 7:155292587-155292609 CCTGAGTGGGAGGCTAAGGAGGG + Intergenic
1035734794 8:1880334-1880356 CGTAAGAGGGAGACAGTGAAAGG - Intronic
1035795682 8:2354437-2354459 GCTAATCGGGAGGCTGAGGAAGG + Intergenic
1035891794 8:3352726-3352748 CCTAATTGGGAGGCTGAGGCCGG + Intronic
1036134080 8:6142808-6142830 CCTACTTGGGAGGCTGAGGAGGG + Intergenic
1036255242 8:7201010-7201032 GCTACGTGGGAGGCTGAGGAAGG - Intergenic
1036362245 8:8086486-8086508 GCTACGTGGGAGGCTGAGGAAGG + Intergenic
1036422842 8:8613948-8613970 AGTCAGAGGGAGGCAGTGGAAGG + Intergenic
1036487937 8:9196520-9196542 GCTACTTGGGAGGCAGAGGAGGG - Intergenic
1036526005 8:9535372-9535394 CCTAATGGGGAGGCTGAGGCAGG + Intergenic
1036822819 8:11953777-11953799 CCTCAGAGGTGGGCAGAAGATGG + Intergenic
1037030615 8:14099611-14099633 CCTACTAGGGAGGCTGAGGCAGG + Intronic
1037156580 8:15707885-15707907 CCTAAGAAAGAGGCATGGGATGG - Intronic
1037289225 8:17333735-17333757 CCTACTTGGGAGGCAGAGGTGGG + Intronic
1037584318 8:20266132-20266154 GCTACTTGGGAGGCAGAGGAAGG - Intronic
1037721108 8:21444819-21444841 TCAAAGAGGGAGGAAGAGGCAGG + Intergenic
1037781890 8:21875182-21875204 ACTACTAGGGAGGCAGAGGTAGG - Intergenic
1037992601 8:23331335-23331357 GATAAGAGAGAGCCAGAGGAGGG - Intronic
1038062866 8:23931475-23931497 GCTACTAGGGAGGCTGAGGATGG + Intergenic
1038290148 8:26241932-26241954 CCTGGGAGGGAGGCTGAGGTGGG + Intergenic
1038395249 8:27241655-27241677 GGTAGGAGGGAGGCAGCGGAGGG - Exonic
1038758396 8:30363199-30363221 CCAAGGAGGGAGGCCAAGGAGGG + Intergenic
1038866788 8:31447231-31447253 TATAAGAGAGTGGCAGAGGAAGG - Intergenic
1038932150 8:32205851-32205873 CCTAAGTGGGAGGCTTAGGCAGG + Intronic
1038969990 8:32622512-32622534 GCTACTAGGGAGGCTGAGGAAGG - Intronic
1039382588 8:37099948-37099970 CCTAGGAGGGAGGAACAGGCAGG - Intergenic
1039560890 8:38511609-38511631 GCTACTAGGGAGGCTGAGGAAGG - Exonic
1039635092 8:39156257-39156279 GCTAATTGGGAGGCAGAGGCAGG - Intronic
1039711654 8:40061559-40061581 CCCAGGAGGGAGGGAGAGGCCGG + Intergenic
1039812892 8:41065418-41065440 GCTACTAGGGAGGCTGAGGAGGG + Intergenic
1039941171 8:42092452-42092474 GCTACCAGGGAGGCAGAGGTAGG + Intergenic
1040469943 8:47728691-47728713 CCGAAGAGGGGAGCAGAGGAGGG - Intronic
1040582037 8:48705952-48705974 CCGCAGAGGGATGCTGAGGAAGG + Intergenic
1040682975 8:49836370-49836392 TCTATGAGCGAGACAGAGGAGGG + Intergenic
1040761426 8:50849848-50849870 GCTAATCGGGAGGCTGAGGAGGG - Intergenic
1040788898 8:51201684-51201706 CCTACTCGGGAGGCTGAGGAAGG + Intergenic
1041192950 8:55371998-55372020 CCTCAGAGGGAAGGAGAGGCAGG - Intronic
1041365030 8:57092808-57092830 GCTAATAGGGAGGCTGAGGCAGG + Intergenic
1042411839 8:68475157-68475179 CTGAAGAGGGAAGCAGTGGAAGG - Intronic
1042557253 8:70043872-70043894 GCTACTAGGGAGGCTGAGGAAGG + Intergenic
1042563589 8:70091810-70091832 GCTAAGTGGGAGGCTGAGGTAGG - Intergenic
1042566348 8:70116073-70116095 GCTACTAGGGAGGCTGAGGAAGG + Intronic
1042588116 8:70365218-70365240 GCTACGAGGGAGGCTGAGGTGGG + Intronic
1043078613 8:75735509-75735531 CCTAAGAGGGAGGTCTAGGCAGG + Intergenic
1043113536 8:76218704-76218726 GCTACGAGGGAGGCTGAGGGAGG - Intergenic
1043360572 8:79466994-79467016 ACTAAGATGGAGACAGAGGCAGG - Intergenic
1043451822 8:80375423-80375445 GCTAATAGGGAGGCTGAGGCAGG + Intergenic
1043458766 8:80438554-80438576 GCTAATAGGGAGGCTGAGGCAGG + Intergenic
1043538432 8:81232081-81232103 GCTACTAGGGAGGCTGAGGATGG - Intergenic
1043578837 8:81688547-81688569 GCTACGAGGGAGGCTGAGGCAGG + Intergenic
1043765753 8:84130063-84130085 CAAAAGAGGCAGGAAGAGGAGGG - Intergenic
1044412437 8:91898962-91898984 GCTACTTGGGAGGCAGAGGAAGG + Intergenic
1044782139 8:95754103-95754125 CCTAATCGGGAGGCTGAGGCAGG - Intergenic
1044953240 8:97453718-97453740 GCTAATAGGGAGGCTGAGGCAGG + Intergenic
1045351024 8:101339726-101339748 GCTAATAGGGAGGCTGAGGCAGG - Intergenic
1045917722 8:107492445-107492467 GCTACTAGGGAGGCTGAGGAAGG - Intronic
1045948082 8:107819703-107819725 GCTAAGAGGCAGGAAGAGGAGGG - Intergenic
1046327604 8:112670618-112670640 GCAAAGAGTGAGTCAGAGGAAGG + Intronic
1046645624 8:116782611-116782633 GCTACTAGGGAGGCTGAGGAAGG - Intronic
1046871129 8:119207130-119207152 ACTAAGAGGTGGGGAGAGGAGGG + Intronic
1046978644 8:120312229-120312251 CATAAGAGGAAGGGAGAGGGAGG - Intronic
1048328885 8:133458995-133459017 GCTACTAGGGAGGCTGAGGAGGG - Exonic
1048494349 8:134922748-134922770 CCAAAAAGGGAGTCAGTGGAGGG + Intergenic
1048623894 8:136163747-136163769 GCTACTAGGGAGGCTGAGGAAGG - Intergenic
1049050070 8:140187784-140187806 GCTACTAGGGAGGCAGAGGTGGG - Intronic
1049235835 8:141511834-141511856 TACAAGAGGGAGGCAGAGGCAGG + Intergenic
1049320825 8:141995295-141995317 ACCAAGAGGGAGACAGAGGGAGG - Intergenic
1049936748 9:506762-506784 CCCAAGTGGGAGGAGGAGGATGG + Intronic
1050354520 9:4770165-4770187 CCTCAGCTGGAGGCAGAGGTTGG - Intergenic
1050357332 9:4795187-4795209 GCTACGAGGGAGGCTGAGGCAGG - Intronic
1050458000 9:5852372-5852394 GCTATGAGGGAGGCTGAGGAGGG - Intergenic
1050536398 9:6634415-6634437 GCTACTAGGGAGGCTGAGGAGGG + Intronic
1050550989 9:6748052-6748074 CCTATGAGGGAGGCTGAGGCAGG + Intronic
1050913440 9:11102439-11102461 CGTAGGGGGGAGGCAGGGGAGGG + Intergenic
1051016731 9:12485779-12485801 CCTACTAGGGAGGCTGAGGCAGG + Intergenic
1051399144 9:16660340-16660362 GCTACTAGGGAGGCTGAGGAAGG + Intronic
1051507469 9:17842457-17842479 CCTCAGAGAGGGGCAGAGGGAGG - Intergenic
1051624528 9:19086197-19086219 CCTACTAGGGAGGCTGAGGCAGG + Intronic
1052001328 9:23285106-23285128 GGAGAGAGGGAGGCAGAGGAAGG + Intergenic
1052290961 9:26840164-26840186 CCTACGCGGGAGGCTGAGGCAGG - Intergenic
1052462560 9:28784834-28784856 CCTAACTGGGAGGCTGAGGCAGG + Intergenic
1052854894 9:33401141-33401163 CCCAAGGGAGAGGCTGAGGATGG + Intronic
1053160568 9:35810822-35810844 ACTCAGAGGGAAGAAGAGGAAGG - Intronic
1053231416 9:36413115-36413137 GCTACTAGGGAGGCAGAGGCAGG + Intronic
1053232829 9:36425580-36425602 GCTAATAGGGAGGCTGAGGAAGG + Intronic
1053244113 9:36520382-36520404 GCTAATAGGGAGGCTGAGGCAGG - Intergenic
1053257349 9:36628976-36628998 CCTACTAGGGAGGCTGAGGCAGG - Intronic
1053293370 9:36896739-36896761 CCCATGAGGGAGGCAGGGCAGGG - Intronic
1053306034 9:36985565-36985587 CCGAAGGGGGAGGCAGGAGAAGG + Intronic
1053372600 9:37575661-37575683 CCTAAGAGCGAGGCAGGACAGGG + Intronic
1053682915 9:40497470-40497492 CCCAAGGGAGAGGCTGAGGATGG + Intergenic
1053932896 9:43125784-43125806 CCCAAGGGAGAGGCTGAGGATGG + Intergenic
1053940058 9:43239146-43239168 CCTAAGCCGGTGGCAGAGGAAGG + Intergenic
1054280799 9:63127458-63127480 CCCAAGGGAGAGGCTGAGGATGG - Intergenic
1054296015 9:63332970-63332992 CCCAAGGGAGAGGCTGAGGATGG + Intergenic
1054394031 9:64637465-64637487 CCCAAGGGAGAGGCTGAGGATGG + Intergenic
1054428680 9:65142677-65142699 CCCAAGGGAGAGGCTGAGGATGG + Intergenic
1054501699 9:65878865-65878887 CCCAAGGGAGAGGCTGAGGATGG - Intronic
1055053298 9:72000838-72000860 GCTACTAGGGAGGCTGAGGAAGG - Intergenic
1055205478 9:73724182-73724204 GCTGAGAAGGAGGAAGAGGAGGG - Intergenic
1055451602 9:76436061-76436083 CCTACTGGGGAGGCTGAGGAGGG - Intronic
1056167417 9:83952681-83952703 GCTACGAGGGAGGCTGAGGCAGG + Intronic
1056381391 9:86060276-86060298 GCAAAGAGGGAGACAGAGAAGGG + Intronic
1056593361 9:87983627-87983649 CCTACTAGGGAGGCTGAGGCAGG + Intergenic
1057008463 9:91581353-91581375 CTCAACAGGGAGGCCGAGGAGGG - Intronic
1057599402 9:96444086-96444108 CCTATTAGGGAGGCTGAGGCAGG + Intergenic
1057709687 9:97428151-97428173 CCTAACAAGGAGGAAGAGGGTGG - Intronic
1057761265 9:97876497-97876519 CTTAAGAGGGAGATGGAGGAAGG + Intergenic
1057786432 9:98091343-98091365 GCTATGAGGGAGGCTGAGGTGGG + Intronic
1058242491 9:102582966-102582988 CCTAATAGGGAGGCTGAGACAGG + Intergenic
1058546966 9:106070842-106070864 CCAAAGAAAGAGGCAGAAGATGG + Intergenic
1058655993 9:107220964-107220986 CCTACTAGGGAGGCTGAGGCAGG + Intergenic
1058997065 9:110309445-110309467 GCTACTAGGGAGGCAGAGGCAGG - Intronic
1059009120 9:110437571-110437593 TCTAAGAGGCAGGCAGAGAAGGG - Intronic
1059154435 9:111977283-111977305 CCTAAGTGGGAGGCTGAGGCAGG + Intergenic
1059203917 9:112445634-112445656 GCTACTAGGGAGGCTGAGGAAGG - Intronic
1059862988 9:118485721-118485743 CCGAAAAGAGAGTCAGAGGAGGG + Intergenic
1059876342 9:118639551-118639573 ACAAAGAGGGAGGCTGAGGTTGG - Intergenic
1060175194 9:121492583-121492605 GCTATGAGGGAGGCTGAGGCAGG - Intergenic
1060588848 9:124803372-124803394 GCTATTAGGGAGGCTGAGGAGGG - Intronic
1060980925 9:127791453-127791475 CCTACTAGGGAGGCTGAGGCAGG - Intergenic
1061086092 9:128399478-128399500 GCTAAGTGGGAGGCTGAGGCAGG - Intergenic
1061093099 9:128438262-128438284 GCTACTAGGGAGGCTGAGGAAGG - Intergenic
1061163090 9:128907135-128907157 CCTAAAAGGGAGCCATAGGAGGG - Exonic
1061237540 9:129351511-129351533 CAGAAGAGGGCGGAAGAGGAAGG + Intergenic
1061246632 9:129404161-129404183 CCCCAGGAGGAGGCAGAGGAAGG + Intergenic
1061248602 9:129413992-129414014 CCTAAGCGGGCGGCAGGGGCAGG - Intergenic
1061390444 9:130314748-130314770 CCTGGGTGGGAGGCAGAGGCTGG + Intronic
1061660426 9:132126492-132126514 CCTAAGAGGGGGTCACAGGCAGG - Intergenic
1061913766 9:133738486-133738508 CCTCTGAGGGCGGCAGAGCAGGG + Intronic
1062050526 9:134444455-134444477 GGAAAGAGGGAGGCAGGGGAAGG - Intergenic
1062223386 9:135433276-135433298 GCTACTAGGGAGGCTGAGGAAGG + Intergenic
1062329086 9:136028956-136028978 CACAAGAGGGAGGCCGAGGTGGG + Intronic
1062431227 9:136527699-136527721 CCTAAGAGGGACGCACGGAAGGG - Intronic
1203779193 EBV:91494-91516 CCAAAGAGGCAGGCAGGGGCCGG + Intergenic
1203624052 Un_KI270749v1:153759-153781 CCTAAGCAGGTGGAAGAGGAAGG + Intergenic
1185499971 X:589284-589306 CCTACTAGGGAGGCTGAGGCAGG - Intergenic
1185587854 X:1253767-1253789 CGTATGAGGGAAGCAGAGAACGG + Intergenic
1185740490 X:2528103-2528125 GCTAATAGGGAGGCTGAGGTAGG - Intergenic
1185872494 X:3675576-3675598 CCCCAGTGGGAGGAAGAGGAGGG - Intronic
1185935933 X:4257282-4257304 CATGAGAGGGAGGCCAAGGAAGG + Intergenic
1185938652 X:4288377-4288399 CATAAGACGGAGGCAGAGATAGG - Intergenic
1186526538 X:10254331-10254353 CCTAGGAGAGAGGCACAGAAAGG - Intergenic
1186550619 X:10501195-10501217 GCTAATCGGGAGGCAGAGGCAGG + Intronic
1186929152 X:14369544-14369566 CCTACTTGGGAGGCTGAGGAAGG + Intergenic
1187071954 X:15897387-15897409 CCTACTAGGGAGGCTGAGGCAGG - Intergenic
1187165434 X:16800364-16800386 ACTAATCGGGAGGCAGAGGCAGG - Intronic
1187701098 X:21965040-21965062 CATAAGACGGAGGCAGAGATTGG - Intronic
1187924276 X:24236025-24236047 CCTAATTGGGAGGCTGAGGTGGG + Intergenic
1188461782 X:30435516-30435538 CATAAGAGGGAGCAGGAGGAGGG - Intergenic
1189292291 X:39894925-39894947 GCTTTGAGGGAGGCAGAAGAAGG - Intergenic
1189434797 X:40982453-40982475 CCTAAGAGAGAGGAAGAGTCTGG + Intergenic
1190054443 X:47173635-47173657 CCCAAGGGGGAAGCAGGGGATGG + Intronic
1190054651 X:47174630-47174652 CCAAAGAAGGAGGGAGGGGATGG - Intronic
1190754824 X:53392278-53392300 GCTACGTGGGAGGCTGAGGAAGG + Intronic
1192088599 X:68128159-68128181 TCTACTCGGGAGGCAGAGGAGGG - Intronic
1192127620 X:68516928-68516950 CCTACTAGGGAGGCTGAGGCAGG - Intronic
1192174514 X:68877588-68877610 CCTACGAGGTAGGCAGATGGGGG + Intergenic
1192232018 X:69271958-69271980 TCCAATAAGGAGGCAGAGGAAGG + Intergenic
1192659439 X:73026833-73026855 CCTAAGAGGGAGGCTGGGCTAGG + Intergenic
1193086657 X:77452963-77452985 GCTACGAGGGAGGCTGAGGTGGG + Intronic
1193525865 X:82588097-82588119 CCTATGAAGGAGGCAGAGCAAGG - Intergenic
1193824454 X:86205670-86205692 GCTACTAGGGAGGCTGAGGAGGG - Intronic
1194059382 X:89178375-89178397 GCTACTAGGGAGGCTGAGGAAGG - Intergenic
1194291638 X:92080065-92080087 TAGAAGAGGAAGGCAGAGGAAGG + Intronic
1195000918 X:100642521-100642543 GCTAGGAGGAAGTCAGAGGAGGG - Intergenic
1195238464 X:102926335-102926357 CCTCTCAGGGAGGTAGAGGATGG + Intergenic
1195308834 X:103610178-103610200 CCTATGGGGGAGCCATAGGATGG - Intronic
1195321746 X:103726726-103726748 CCTGAGAGTGGGGCTGAGGACGG - Intronic
1195544285 X:106098019-106098041 ACTAATAGGGAGGCTGAGGCAGG + Intergenic
1195663642 X:107407920-107407942 GCTAATAGGGAGGCTGAGGTGGG - Intergenic
1195893100 X:109717382-109717404 CCTACTAGGGAGGCTGAGGCAGG + Intronic
1195942853 X:110179710-110179732 CGTAAGAGGGAGGCAAATGATGG - Intronic
1196060599 X:111403932-111403954 GCTACTAGGGAGGCTGAGGAAGG + Intronic
1196835746 X:119812139-119812161 GCTACTTGGGAGGCAGAGGAAGG + Intergenic
1196851397 X:119942360-119942382 GCTATGAGGGAGGCTGAGGTGGG + Intronic
1197210702 X:123825957-123825979 CCTACTTGGGAGGCTGAGGAAGG + Intergenic
1197744373 X:129921260-129921282 TCTGAGAGTGAGGAAGAGGAGGG + Exonic
1198167941 X:134075642-134075664 CCTACTAGGGAGGCTGAGGTGGG + Intergenic
1198189445 X:134287909-134287931 CATGGGAGGGAGGCAGAGGGGGG + Intergenic
1198301530 X:135338325-135338347 CCTGAGGGGGTGTCAGAGGATGG + Intronic
1198457774 X:136834133-136834155 GCTAATAGGGAGGCTGAGGTAGG + Intergenic
1198511937 X:137360840-137360862 CCACAGAGGGAAGCAGAGCAGGG - Intergenic
1198775608 X:140176061-140176083 CCTAAGAGTCAGGCACTGGAAGG - Intergenic
1198996808 X:142581540-142581562 CCTAGGAAAGAGGCAGAGCAAGG - Intergenic
1199068123 X:143444118-143444140 CCTACTAGGGAGGCTGAGGCAGG + Intergenic
1199244966 X:145593217-145593239 AGTAAAAGGGAGGCAGAGAAAGG - Intergenic
1200150101 X:153947128-153947150 TTTAAGAGGAAGCCAGAGGAAGG + Intergenic
1200229023 X:154434854-154434876 CCTAAGAGGGAGTAAAAGGAGGG + Intronic
1200278486 X:154756801-154756823 GCTAATAGGGAGGCTGAGGCAGG + Intergenic
1200609154 Y:5304644-5304666 TAGAAGAGGAAGGCAGAGGAAGG + Intronic
1200717997 Y:6572249-6572271 GCTATGAGGGAGGCTGAGGCAGG - Intergenic
1200791421 Y:7303126-7303148 CCCCAGTGGGAGGAAGAGGAGGG + Intergenic
1200803140 Y:7404746-7404768 CGTAAGAGGGACGCAGTGGGAGG + Intergenic
1200897690 Y:8393026-8393048 CCTACTTGGGAGGCAGAGGCAGG + Intergenic
1201262721 Y:12176198-12176220 GCTACGGGGGAGGCAGAGGCAGG + Intergenic
1201369150 Y:13241952-13241974 GCTACTAGGGAGACAGAGGAAGG + Intergenic
1201477913 Y:14403954-14403976 GCTAATAGGGAGGCTGAGGTGGG - Intergenic
1201598256 Y:15696600-15696622 ACTACTAGGGAGGCTGAGGAAGG - Intergenic
1201753072 Y:17455259-17455281 GCTAATAGGGAGGCTGAGGCAGG + Intergenic
1201930577 Y:19341023-19341045 GCTAACTGGGAGGCTGAGGAAGG - Intergenic
1202115245 Y:21465551-21465573 ACTAAGAAGGAGAAAGAGGATGG + Intergenic
1202380953 Y:24276380-24276402 GCCATGCGGGAGGCAGAGGACGG + Intergenic
1202489832 Y:25393746-25393768 GCCATGCGGGAGGCAGAGGACGG - Intergenic