ID: 1131484592

View in Genome Browser
Species Human (GRCh38)
Location 15:92809359-92809381
Sequence CGTGGCCGGCCCGGAGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 124}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131484583_1131484592 2 Left 1131484583 15:92809334-92809356 CCTTCGCTTCCGCGGAGCCGTGC 0: 1
1: 0
2: 0
3: 3
4: 46
Right 1131484592 15:92809359-92809381 CGTGGCCGGCCCGGAGGGACAGG 0: 1
1: 0
2: 0
3: 3
4: 124
1131484580_1131484592 24 Left 1131484580 15:92809312-92809334 CCTGCCGGAAGTTGGGGCGGTGC 0: 1
1: 0
2: 0
3: 5
4: 76
Right 1131484592 15:92809359-92809381 CGTGGCCGGCCCGGAGGGACAGG 0: 1
1: 0
2: 0
3: 3
4: 124
1131484581_1131484592 20 Left 1131484581 15:92809316-92809338 CCGGAAGTTGGGGCGGTGCCTTC 0: 1
1: 0
2: 1
3: 9
4: 91
Right 1131484592 15:92809359-92809381 CGTGGCCGGCCCGGAGGGACAGG 0: 1
1: 0
2: 0
3: 3
4: 124
1131484578_1131484592 29 Left 1131484578 15:92809307-92809329 CCAGTCCTGCCGGAAGTTGGGGC 0: 1
1: 0
2: 0
3: 7
4: 99
Right 1131484592 15:92809359-92809381 CGTGGCCGGCCCGGAGGGACAGG 0: 1
1: 0
2: 0
3: 3
4: 124
1131484585_1131484592 -7 Left 1131484585 15:92809343-92809365 CCGCGGAGCCGTGCCACGTGGCC 0: 1
1: 0
2: 0
3: 2
4: 91
Right 1131484592 15:92809359-92809381 CGTGGCCGGCCCGGAGGGACAGG 0: 1
1: 0
2: 0
3: 3
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131484592 Original CRISPR CGTGGCCGGCCCGGAGGGAC AGG Intronic
900344616 1:2205000-2205022 CGTGGGGAGCCCGGAGGGAGGGG - Intronic
900357455 1:2271669-2271691 TGGGGCGGGCCCGCAGGGACAGG - Intronic
900636560 1:3669002-3669024 CGTGGCCGGCCTGGAGCTGCAGG - Intronic
905912248 1:41662701-41662723 CGGGGCGGGCGCGGAGGGAGGGG - Intronic
906116243 1:43359101-43359123 TGTGGCCGGCCAGGAGCGAAGGG + Exonic
906315851 1:44786113-44786135 CGGCCCAGGCCCGGAGGGACGGG - Exonic
918043735 1:180928520-180928542 CATGGCTGGCACGGAGGGGCCGG - Exonic
922536268 1:226383091-226383113 CGTGGCCGCCACGGAGGCGCTGG + Exonic
1063160714 10:3416162-3416184 TCTGGCCAGCCAGGAGGGACCGG - Intergenic
1066204871 10:33179172-33179194 CCTTGCCTGCCCGGAGGGGCTGG + Exonic
1069639244 10:69944201-69944223 CCTGGGCGGCCAGGAGGGAGAGG + Intronic
1070752086 10:78969920-78969942 TGTGGCTGGCCCTGAGGTACAGG + Intergenic
1072449233 10:95526268-95526290 AGGGCCCAGCCCGGAGGGACAGG - Intronic
1074137963 10:110644251-110644273 CGTGGCCGGCCGGGACGAGCTGG + Intergenic
1074586106 10:114768618-114768640 CCTGGCCGACTCGGAGGGGCTGG - Intergenic
1076707056 10:132307872-132307894 CATGGCCGGCCGGCAGGGCCGGG + Exonic
1077635764 11:3840729-3840751 CGCGGCCGGCCGGGCGGGGCGGG - Intronic
1081860974 11:46333190-46333212 CGTCCCCGGCCCGGGCGGACTGG + Intronic
1082076594 11:47980402-47980424 CGCGGCCGGCTCGGAGGGGGCGG + Intergenic
1083289099 11:61680160-61680182 CGTGGGCGGCCGGGAGGGGCTGG - Intergenic
1084118749 11:67056821-67056843 CGGGGCAGGCCCGGCGGGGCAGG - Exonic
1089016974 11:115173309-115173331 CGTGGCGGGCCCGCCGGAACAGG - Exonic
1090254381 11:125273088-125273110 CTTGTCAGGCCCGGAGAGACTGG + Intronic
1096241330 12:49961800-49961822 CGGGGCCGGCGCGGGGGGGCAGG - Intergenic
1096717420 12:53499686-53499708 CGTGTCCGTCCCGGGGGGCCAGG - Intronic
1101781571 12:107843373-107843395 CGGGGCCTGCACGGAAGGACAGG + Intergenic
1103557423 12:121775009-121775031 CGTGGCCGGCCAGGGGAGTCTGG + Intronic
1105476276 13:20730393-20730415 CAAGCGCGGCCCGGAGGGACTGG + Intronic
1108229035 13:48318580-48318602 CGTGCCCGGCCATGAGGGGCGGG - Intronic
1109284830 13:60397531-60397553 CGGAGCCGGCCCGAAGGGCCCGG - Intronic
1111672728 13:91348902-91348924 CGAGCCCGGCCCAGAGGGGCGGG - Intergenic
1122919453 14:104874055-104874077 CGTGGGCAGCCCTGAGGGCCAGG - Intronic
1125541351 15:40471489-40471511 CGTCCCCAGCCCTGAGGGACAGG - Exonic
1127071168 15:55289656-55289678 CTCGGCCCTCCCGGAGGGACCGG + Intronic
1129853732 15:78810457-78810479 GGAGGCCGGCCCGGCGGGGCGGG + Intronic
1130076578 15:80695241-80695263 CGGGGCCGGCCCGGCGGGCGCGG - Intronic
1131484592 15:92809359-92809381 CGTGGCCGGCCCGGAGGGACAGG + Intronic
1131517625 15:93089346-93089368 CGGGGCCGGCAGGGAGGGGCGGG + Intergenic
1132779303 16:1614187-1614209 CGAGGCCGGCGCGCAGGGCCAGG + Intronic
1132915313 16:2340686-2340708 CGTGGCCGCCCTGGAGGGGAGGG + Exonic
1132942448 16:2514698-2514720 GGCGGCCGGCCCCGAGGGTCAGG + Intronic
1135382644 16:22007880-22007902 CGTGGCCTGCCAGAAGAGACCGG + Intronic
1135409910 16:22225777-22225799 CATGGCCAGCTCGGGGGGACTGG - Exonic
1135517656 16:23149127-23149149 CGCGGCCGGCCCGGACGCCCCGG + Exonic
1136287141 16:29251175-29251197 GGCGGACGGCCCAGAGGGACAGG - Intergenic
1136413645 16:30091148-30091170 GGTAGCCGGCCCCCAGGGACGGG + Exonic
1136487587 16:30583207-30583229 GGTGGCTGGCCAGGAGGGAAGGG + Exonic
1142092747 16:88223807-88223829 GGCGGGCGGCCCAGAGGGACAGG - Intergenic
1145064625 17:19753727-19753749 CCCGGCCGCCCCGGAGGGAGTGG - Intergenic
1150590641 17:66559179-66559201 CGTGCCCGGCCTGGAGGGCTTGG - Intronic
1151370089 17:73642377-73642399 CCTGGACGGCGTGGAGGGACGGG - Intronic
1151479429 17:74361647-74361669 CGCGGCCGGCCAGGAGGGGGCGG - Intronic
1151696578 17:75721206-75721228 CAGGGCCGGACCGGAGGGAGAGG + Intergenic
1151972862 17:77467740-77467762 CGCGGCCGGCACAGAGGGAGCGG + Intronic
1152606785 17:81295377-81295399 AGAGGCGGGCCCGGAGGGGCGGG + Intronic
1156008482 18:32470578-32470600 CTGGGGCGGCCCGGAGGGAGGGG + Intergenic
1156490321 18:37492159-37492181 CTTGGCCGGCCTGGAGGAAGTGG + Intronic
1157228623 18:45891977-45891999 CCTGGCTGGCCTGGAGAGACAGG + Intronic
1160837970 19:1133344-1133366 CGTGGCTGGGCCGGAGGGCTCGG + Intronic
1161390586 19:4018476-4018498 CGTGCCCGGGCCGGAGGGCCTGG + Intronic
1161583577 19:5093374-5093396 CCTGGCTGGCCGGGAGGGGCAGG + Intronic
1161741042 19:6021456-6021478 GGTCGCCGCCACGGAGGGACTGG + Intronic
1163035183 19:14565693-14565715 GGCTGCCGGCCCGGAGGGGCAGG - Intronic
1163627143 19:18396777-18396799 CGTTGCTGGCCCGCAGAGACTGG + Exonic
1164643693 19:29843724-29843746 CCAGGCCGGCCCTGAGGGGCAGG + Intergenic
1165099924 19:33432955-33432977 TGTGGCTGGCCTGGAGCGACAGG + Intronic
1165427866 19:35755710-35755732 CGCCGCCGGGCCGGAGGGGCGGG - Intronic
1166773663 19:45299688-45299710 CCTCACCAGCCCGGAGGGACTGG + Intronic
1167274359 19:48527606-48527628 CGTGCCCGGCCCCCAGGGAATGG + Intergenic
1167595190 19:50423721-50423743 CGTGGCTGGCCCCGAGGGGAAGG + Exonic
1167638524 19:50668228-50668250 TGGGGGCGGCCCGGAGGGAGGGG - Exonic
1167648604 19:50718476-50718498 CGGAGCCGGCCCGGGGGGGCTGG - Intronic
932398956 2:71466586-71466608 CGCGGCGGGCGGGGAGGGACAGG - Intronic
934979702 2:98829716-98829738 CATGGGCGGCCCTGAGTGACAGG + Intronic
940876259 2:158900553-158900575 CGTGCCCGGCCGGGATGGTCTGG - Intergenic
946186533 2:217983737-217983759 CATGGCCGGCACAGAGGCACAGG + Intronic
947399073 2:229714421-229714443 CATGGCCGGCCGGGAGGGCGCGG + Exonic
947399266 2:229715060-229715082 CGTGGCCGGGCGGGAGGGCTTGG - Intergenic
947715783 2:232338246-232338268 CGTGGGAGGCCCTGGGGGACAGG - Intronic
947734807 2:232448992-232449014 CGTGGGAGGCCCTGGGGGACAGG - Intergenic
948050309 2:234974982-234975004 CTTGGCCTGCTCCGAGGGACGGG - Intronic
948473655 2:238203177-238203199 CGTGGGCCGACCCGAGGGACCGG - Intronic
1169422516 20:5471575-5471597 GGAGGCCGGCCCTGGGGGACAGG - Intergenic
1173913530 20:46689087-46689109 CGTGGGCGGCCCCGAGGCTCTGG - Intronic
1174290048 20:49501905-49501927 CATGGCAGGGCCAGAGGGACAGG - Intergenic
1176084202 20:63288649-63288671 CGTGGCCAGGCAGGAGGGGCCGG + Exonic
1176095601 20:63342818-63342840 CGTGGCCGGCCGGGCTGGGCAGG + Intergenic
1176247071 20:64102427-64102449 CGCGGCCAGCCGGGAGGGAGGGG - Intergenic
1179186313 21:39087611-39087633 GATGGCCGGCCCGGTGGGCCTGG - Intergenic
1180710667 22:17837257-17837279 CATGGCCAGCCCTGAGGGAGCGG + Intronic
1181057857 22:20268325-20268347 CGTGGGCGGCGCGGCGGGCCGGG + Exonic
1181514327 22:23402591-23402613 CCTGGCCGGCCCAGGGGAACTGG - Intergenic
1181806143 22:25375630-25375652 CGTGGCTGGCCAGGGGGCACGGG - Intronic
950069640 3:10141970-10141992 AGAGTCCGGCCCGGAGGAACTGG + Exonic
950109992 3:10412718-10412740 GGTGCCAGGCCCTGAGGGACAGG - Intronic
956229583 3:66998534-66998556 GGTGGGCGGTCCGGCGGGACCGG + Intronic
959815202 3:110666416-110666438 TGTGGCAGGCAGGGAGGGACAGG + Intergenic
961383355 3:126510032-126510054 GGTGCCAGGCCCGGAGGTACTGG + Intronic
962254369 3:133860386-133860408 CGAGGAAGGCCCGGAGGCACTGG + Intronic
962353495 3:134673562-134673584 CATGGCCCGCCCTGAGGGTCAGG + Intronic
964887662 3:161503157-161503179 CCTGGCCTGCACGGAGGGCCTGG + Exonic
967390314 3:188948359-188948381 AGGGGCTGGCCCGGAGGGGCTGG - Intronic
968631705 4:1655308-1655330 CGTGGCGGGCGAGGTGGGACCGG + Exonic
972484465 4:39528087-39528109 GGTTGCCGGCCCGGAGGGCGCGG - Intronic
981474995 4:145179755-145179777 CGGGGACGGCCCGGCGGGTCTGG - Intronic
985372481 4:189301193-189301215 CATGGCCAGCCAGGAGAGACAGG + Intergenic
985867997 5:2530387-2530409 CGTGGATGGCAGGGAGGGACTGG - Intergenic
992190408 5:74286039-74286061 CGTGGCCAGCCTTGAGGGAGTGG - Intergenic
997303036 5:132820222-132820244 TGTGGCTGGCCCAGAGGGCCTGG + Intergenic
1002645296 5:180649696-180649718 CGCGGCGGGCTGGGAGGGACGGG - Intergenic
1006934084 6:37705409-37705431 CGGGGCCGGGCCCCAGGGACAGG + Intergenic
1019413165 7:915419-915441 CGTGGCCGCCCCGCCGGGCCTGG + Intronic
1019590537 7:1828251-1828273 GGTGGCGGGCCCTGAGAGACGGG + Intronic
1019724227 7:2592131-2592153 CGTAGCTGGCCGGGAGGCACCGG - Intronic
1023703072 7:42911822-42911844 CAGGGCCGGCCCGGCGGGAAGGG - Intronic
1029714239 7:102317426-102317448 AGTGGCCAGCCCTGAGGGAGAGG + Intronic
1033253178 7:139777775-139777797 CGTGGCCGGCGCCGGGGGAGGGG + Intronic
1034306210 7:150047422-150047444 CATCGCCGTCCCGGAGGGAGCGG - Intergenic
1036739548 8:11348010-11348032 CATGGCCGGCCCGGCGAAACCGG + Intergenic
1045480854 8:102590991-102591013 TGTGTCCGGCCTGGAGGGACTGG - Intergenic
1049531343 8:143157107-143157129 GTGGGCTGGCCCGGAGGGACTGG - Intergenic
1058991234 9:110256596-110256618 CGTGGCCGGGGCGCAGCGACGGG - Exonic
1061123243 9:128657064-128657086 CGTGGCCGGCCCGCGAGGTCTGG + Intergenic
1061365982 9:130172624-130172646 CGGGTCCGGCCCGGGGGGGCGGG + Exonic
1062600572 9:137317073-137317095 CGTGGCGGGCCTGGAGGGGGTGG + Intronic
1203773582 EBV:61196-61218 TTTGGCCGGCCCTCAGGGACCGG + Intergenic
1187281429 X:17860916-17860938 CGGGGCCGGCTGGGAGGGCCGGG - Intronic
1192503054 X:71665718-71665740 GGTGGCCGGCCCTGGGGGAGTGG + Intergenic