ID: 1131485519

View in Genome Browser
Species Human (GRCh38)
Location 15:92816874-92816896
Sequence GTAAACACCGTGAAAAGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131485519_1131485526 23 Left 1131485519 15:92816874-92816896 CCCAGACTTTTCACGGTGTTTAC No data
Right 1131485526 15:92816920-92816942 CATGTGTGGAAGGTTTCCCTGGG No data
1131485519_1131485521 9 Left 1131485519 15:92816874-92816896 CCCAGACTTTTCACGGTGTTTAC No data
Right 1131485521 15:92816906-92816928 TACAGCACTTATCCCATGTGTGG No data
1131485519_1131485525 22 Left 1131485519 15:92816874-92816896 CCCAGACTTTTCACGGTGTTTAC No data
Right 1131485525 15:92816919-92816941 CCATGTGTGGAAGGTTTCCCTGG No data
1131485519_1131485522 13 Left 1131485519 15:92816874-92816896 CCCAGACTTTTCACGGTGTTTAC No data
Right 1131485522 15:92816910-92816932 GCACTTATCCCATGTGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131485519 Original CRISPR GTAAACACCGTGAAAAGTCT GGG (reversed) Intergenic
No off target data available for this crispr