ID: 1131485924

View in Genome Browser
Species Human (GRCh38)
Location 15:92820528-92820550
Sequence CAAAAGGGCCCTGGGCGCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131485924_1131485935 17 Left 1131485924 15:92820528-92820550 CCCCGGCGCCCAGGGCCCTTTTG No data
Right 1131485935 15:92820568-92820590 GAATCCTGTTTTAGTGCGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131485924 Original CRISPR CAAAAGGGCCCTGGGCGCCG GGG (reversed) Intergenic
No off target data available for this crispr