ID: 1131492160

View in Genome Browser
Species Human (GRCh38)
Location 15:92872605-92872627
Sequence GGGAGAACACTGGTTCTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131492150_1131492160 12 Left 1131492150 15:92872570-92872592 CCTCCCTATGCTCCCAGATCTAT No data
Right 1131492160 15:92872605-92872627 GGGAGAACACTGGTTCTGCCTGG No data
1131492154_1131492160 -1 Left 1131492154 15:92872583-92872605 CCAGATCTATCTCCTCCATTTAG No data
Right 1131492160 15:92872605-92872627 GGGAGAACACTGGTTCTGCCTGG No data
1131492153_1131492160 0 Left 1131492153 15:92872582-92872604 CCCAGATCTATCTCCTCCATTTA No data
Right 1131492160 15:92872605-92872627 GGGAGAACACTGGTTCTGCCTGG No data
1131492151_1131492160 9 Left 1131492151 15:92872573-92872595 CCCTATGCTCCCAGATCTATCTC No data
Right 1131492160 15:92872605-92872627 GGGAGAACACTGGTTCTGCCTGG No data
1131492152_1131492160 8 Left 1131492152 15:92872574-92872596 CCTATGCTCCCAGATCTATCTCC No data
Right 1131492160 15:92872605-92872627 GGGAGAACACTGGTTCTGCCTGG No data
1131492148_1131492160 18 Left 1131492148 15:92872564-92872586 CCTGGCCCTCCCTATGCTCCCAG No data
Right 1131492160 15:92872605-92872627 GGGAGAACACTGGTTCTGCCTGG No data
1131492149_1131492160 13 Left 1131492149 15:92872569-92872591 CCCTCCCTATGCTCCCAGATCTA No data
Right 1131492160 15:92872605-92872627 GGGAGAACACTGGTTCTGCCTGG No data
1131492147_1131492160 21 Left 1131492147 15:92872561-92872583 CCACCTGGCCCTCCCTATGCTCC No data
Right 1131492160 15:92872605-92872627 GGGAGAACACTGGTTCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131492160 Original CRISPR GGGAGAACACTGGTTCTGCC TGG Intergenic