ID: 1131493237

View in Genome Browser
Species Human (GRCh38)
Location 15:92881127-92881149
Sequence CTGTGTAAGGGAATGTCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131493231_1131493237 10 Left 1131493231 15:92881094-92881116 CCTTGTTGCAGGTCCACCGTGTC No data
Right 1131493237 15:92881127-92881149 CTGTGTAAGGGAATGTCTCTTGG No data
1131493232_1131493237 -3 Left 1131493232 15:92881107-92881129 CCACCGTGTCCAAAGCTACACTG No data
Right 1131493237 15:92881127-92881149 CTGTGTAAGGGAATGTCTCTTGG No data
1131493233_1131493237 -6 Left 1131493233 15:92881110-92881132 CCGTGTCCAAAGCTACACTGTGT No data
Right 1131493237 15:92881127-92881149 CTGTGTAAGGGAATGTCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131493237 Original CRISPR CTGTGTAAGGGAATGTCTCT TGG Intergenic
No off target data available for this crispr