ID: 1131495658

View in Genome Browser
Species Human (GRCh38)
Location 15:92908680-92908702
Sequence GCAGCTATTAAGACTAAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 184}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131495658_1131495665 13 Left 1131495658 15:92908680-92908702 CCCTTTTTAGTCTTAATAGCTGC 0: 1
1: 0
2: 1
3: 16
4: 184
Right 1131495665 15:92908716-92908738 TCTGGAAGCAAAAGTGGGATAGG 0: 1
1: 0
2: 4
3: 28
4: 281
1131495658_1131495661 -5 Left 1131495658 15:92908680-92908702 CCCTTTTTAGTCTTAATAGCTGC 0: 1
1: 0
2: 1
3: 16
4: 184
Right 1131495661 15:92908698-92908720 GCTGCTTGAGTTAGGACCTCTGG 0: 1
1: 0
2: 2
3: 5
4: 113
1131495658_1131495666 23 Left 1131495658 15:92908680-92908702 CCCTTTTTAGTCTTAATAGCTGC 0: 1
1: 0
2: 1
3: 16
4: 184
Right 1131495666 15:92908726-92908748 AAAGTGGGATAGGATGCTGACGG 0: 1
1: 0
2: 3
3: 18
4: 211
1131495658_1131495663 8 Left 1131495658 15:92908680-92908702 CCCTTTTTAGTCTTAATAGCTGC 0: 1
1: 0
2: 1
3: 16
4: 184
Right 1131495663 15:92908711-92908733 GGACCTCTGGAAGCAAAAGTGGG 0: 1
1: 0
2: 3
3: 31
4: 280
1131495658_1131495662 7 Left 1131495658 15:92908680-92908702 CCCTTTTTAGTCTTAATAGCTGC 0: 1
1: 0
2: 1
3: 16
4: 184
Right 1131495662 15:92908710-92908732 AGGACCTCTGGAAGCAAAAGTGG 0: 1
1: 0
2: 1
3: 34
4: 290
1131495658_1131495667 24 Left 1131495658 15:92908680-92908702 CCCTTTTTAGTCTTAATAGCTGC 0: 1
1: 0
2: 1
3: 16
4: 184
Right 1131495667 15:92908727-92908749 AAGTGGGATAGGATGCTGACGGG 0: 1
1: 0
2: 1
3: 17
4: 126
1131495658_1131495668 25 Left 1131495658 15:92908680-92908702 CCCTTTTTAGTCTTAATAGCTGC 0: 1
1: 0
2: 1
3: 16
4: 184
Right 1131495668 15:92908728-92908750 AGTGGGATAGGATGCTGACGGGG 0: 1
1: 0
2: 1
3: 15
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131495658 Original CRISPR GCAGCTATTAAGACTAAAAA GGG (reversed) Intronic
903636405 1:24820563-24820585 GACACTTTTAAGACTAAAAAGGG - Intronic
908103997 1:60822293-60822315 GCAGCTACTAAGAGTGAAATTGG + Intergenic
908709524 1:66999475-66999497 GTACCTTTTAACACTAAAAATGG + Exonic
909240296 1:73204930-73204952 GCAGTTGCTAAGGCTAAAAAGGG + Intergenic
909373491 1:74914111-74914133 GCTCCAATTATGACTAAAAAAGG - Intergenic
912029481 1:105221233-105221255 ACAGCTAGCAAGACTAATAAAGG - Intergenic
912211157 1:107558490-107558512 GCAGCTAGTAAGACAGAAAAAGG + Intergenic
915607122 1:156959495-156959517 GCAGCTCACAAGGCTAAAAAAGG + Intronic
916075829 1:161199591-161199613 GCAGCTGGGAAGAGTAAAAAAGG + Intronic
916933313 1:169602181-169602203 GCAGCTAGACAGAATAAAAATGG - Intronic
918412937 1:184279643-184279665 GCAGAGTTTAAGACTAAAGATGG - Intergenic
919524448 1:198629945-198629967 GCTGCTTTTAAGAATAAAATGGG + Intergenic
920018947 1:202938776-202938798 GCATTTTTTAAGACTTAAAATGG + Intergenic
920764478 1:208818614-208818636 GCAGCTCTTAAGACAGAAAATGG - Intergenic
923103522 1:230836632-230836654 TAAGCTTTTAAGACTGAAAATGG - Intergenic
923291956 1:232554117-232554139 GTAACTATTAAGAATCAAAATGG + Intronic
924122858 1:240820247-240820269 CTTGCTATTAAAACTAAAAATGG - Intronic
1067475538 10:46563451-46563473 GCAGTATTTAAGCCTAAAAATGG - Intergenic
1067619198 10:47778324-47778346 GCAGTATTTAAGCCTAAAAATGG + Intergenic
1069155573 10:65026335-65026357 GCTGCTCTTAATACCAAAAAAGG - Intergenic
1071777912 10:88809783-88809805 GCAGCTAGTGAGAAAAAAAAAGG - Intronic
1073024582 10:100478083-100478105 GCCCCTTTTAAAACTAAAAATGG - Intronic
1073525824 10:104181130-104181152 GCAGCTATGAAGAGAAAGAAGGG - Intronic
1075105196 10:119535143-119535165 GCAGATATAAAAGCTAAAAATGG - Intronic
1075570361 10:123537352-123537374 TCTGCTAATAAGACTAAAGAGGG + Intergenic
1075903197 10:126059935-126059957 GTAGATATTAAGACTAAACTGGG + Intronic
1078154917 11:8791108-8791130 GCAGGTATTAAGACCCAGAAAGG - Intronic
1079817671 11:25082676-25082698 GCAGATATGAACATTAAAAATGG + Intergenic
1081208075 11:40298261-40298283 TCAGCTATTAAGATTTCAAATGG - Intronic
1087304871 11:96476954-96476976 GCTTCTATTAAGACAAAATATGG - Intronic
1087585505 11:100115294-100115316 TCAACTATTAAGACTAATTAAGG + Intronic
1088653106 11:111975911-111975933 ACAGCTATTAAATGTAAAAAAGG - Exonic
1089649007 11:119900007-119900029 GCAGCTTTTATGAATAACAATGG - Intergenic
1089775997 11:120836406-120836428 ACAGCTATTAACAATAACAATGG - Intronic
1089836568 11:121375728-121375750 GCAGCTACAAAAACTGAAAAGGG + Intergenic
1093743497 12:22713957-22713979 GCATCTAGAATGACTAAAAATGG + Intergenic
1094712487 12:32978831-32978853 GCAGCCATGAAAACTAATAAGGG - Intergenic
1095334017 12:41005297-41005319 GAAGCCAATCAGACTAAAAATGG - Intronic
1096593362 12:52677172-52677194 GCAGCTCTTCATACTAAAGATGG + Exonic
1097259761 12:57711643-57711665 GCAGCTATAAAAACAAAAAAGGG - Intronic
1097508902 12:60510850-60510872 GAAGATATTAAGAATAAAATTGG + Intergenic
1097795801 12:63860594-63860616 GCAGAGATTAAGACGATAAAAGG - Intronic
1099478076 12:83132554-83132576 ACAGCTGTTAACACCAAAAAGGG + Exonic
1100020947 12:90069046-90069068 GCAGCTGATTAGACTTAAAAGGG + Intergenic
1101079051 12:101163270-101163292 GCAGCTATCAAAACTGAAAGTGG - Intronic
1101305156 12:103520745-103520767 GAAGCTATTAAGGAAAAAAATGG + Intergenic
1104177116 12:126343614-126343636 GCAGCTGTTCAGATTATAAAAGG + Intergenic
1106168594 13:27270381-27270403 GCACCTTTTAAAAATAAAAAGGG + Exonic
1106981740 13:35292616-35292638 GGAGCTATCAAGACTTACAAAGG - Intronic
1110305852 13:73985708-73985730 GAAGCTATTAAAACTGCAAAAGG + Intronic
1110520125 13:76465697-76465719 GCAAACATTAAGACTAAAAAAGG + Intergenic
1110555078 13:76850710-76850732 GAAGGTATTAAGAAGAAAAACGG + Intergenic
1111021927 13:82461170-82461192 GAATCTATTAAGACGACAAAAGG - Intergenic
1114157098 14:20117319-20117341 GTATCTATTAAGTCTGAAAAAGG - Intergenic
1116492797 14:45526459-45526481 GCAGCTGTTAAGGCTGAAGAGGG + Intergenic
1120109431 14:80536164-80536186 GCAGCAATTAGGAATTAAAAGGG + Intronic
1126591650 15:50346225-50346247 GCATCTATTAAGAGTTAAAGAGG + Intronic
1127316999 15:57806164-57806186 GGAGCAATTAAAAGTAAAAAGGG + Intergenic
1129615053 15:77091970-77091992 GCAGATATTATGGATAAAAATGG - Intergenic
1130754686 15:86750434-86750456 ACAGCTATTAAAAAGAAAAAGGG - Intronic
1131495658 15:92908680-92908702 GCAGCTATTAAGACTAAAAAGGG - Intronic
1133831332 16:9326182-9326204 GCTGCTATGAAGATTAAAGAAGG - Intergenic
1135022701 16:18976294-18976316 CCAGGGATTAAGACTAAACATGG - Intergenic
1139659761 16:68412482-68412504 GCAGCTCTGAAGAGTCAAAATGG + Intronic
1141053076 16:80790394-80790416 ACAGCAATTAAGAGAAAAAAAGG + Intronic
1143927742 17:10387503-10387525 GAAACCATTAACACTAAAAAGGG - Intergenic
1146418561 17:32660752-32660774 GGAGCCATTTTGACTAAAAAGGG - Intronic
1146771764 17:35575188-35575210 TCAGCTTTTAAGGATAAAAAAGG - Exonic
1152137986 17:78516990-78517012 GAAGCTATTATGACTTTAAATGG - Intronic
1155110732 18:22711836-22711858 GTAGCTTTTAAGAAGAAAAATGG - Intergenic
1155878482 18:31115275-31115297 ACAGCTGTAAAAACTAAAAATGG - Intergenic
1156594470 18:38532135-38532157 GTAGCTAATAAGTCTTAAAATGG + Intergenic
1157241203 18:46010908-46010930 GCCGCTATTCAGACTATGAATGG - Intronic
1158586324 18:58739069-58739091 GCAGCTATGAAGAAGAAAATAGG + Intronic
1161950437 19:7464771-7464793 GATGCTAATAAGACTAAAACTGG - Intronic
1163305699 19:16477217-16477239 GGAGCTAACAAGACAAAAAACGG - Intergenic
1168487863 19:56779790-56779812 CCTGCTATGAAGACTAAAAAGGG + Intronic
925187372 2:1858275-1858297 GCAGCAGTGCAGACTAAAAATGG - Intronic
926016504 2:9457605-9457627 GCACCTATTAAGTTTAAAGAAGG + Intronic
926860965 2:17308322-17308344 TCAGCTTTTAAGACTGAAAATGG - Intergenic
928930282 2:36617070-36617092 ACAGATCTTAAGACTAACAAAGG - Intronic
929216274 2:39416973-39416995 GCATGGATTAAGACTAAAATCGG + Intronic
929230646 2:39556512-39556534 CCAGCTATTAATACTTAAGAGGG - Intergenic
929326020 2:40611433-40611455 GCAGAGATTAAGCATAAAAATGG - Intergenic
931182956 2:59921706-59921728 GCAGCAACTAAAACTCAAAAGGG + Intergenic
932171737 2:69563891-69563913 GCAGAAATTAAGACTAAATTAGG + Intronic
932592774 2:73077032-73077054 GCAGTTGTTAAGACTGAGAAGGG - Intronic
933594611 2:84270458-84270480 GCACTTATTAAGAATAAATAAGG - Intergenic
936227171 2:110666340-110666362 ACAGCTATTAAAACAGAAAATGG - Exonic
939621390 2:144423075-144423097 GCAGGTATTATGAGAAAAAAGGG + Intronic
940301493 2:152180327-152180349 CAAGCTATTAATACTAAAAAAGG - Intergenic
940955543 2:159723075-159723097 GCAGCTATGAAGACACTAAAGGG - Intronic
940988737 2:160076189-160076211 GCAGCTATTAGGAAGGAAAAAGG - Intergenic
942140815 2:172976147-172976169 TCTGCTATTAGGACTAGAAAGGG + Intronic
942203740 2:173598633-173598655 CCAGCTATTATGAGTAAAGATGG + Intergenic
942679959 2:178467884-178467906 GCTGCTATTCACTCTAAAAAAGG + Intronic
942937850 2:181579672-181579694 GCAGTTTTTAAGTCTCAAAAGGG - Intronic
944207535 2:197172302-197172324 CAAGCTATTAAGAATAATAATGG - Intronic
946852066 2:223917299-223917321 GCCGATATCAACACTAAAAAAGG - Intronic
1169652750 20:7887892-7887914 GCAGCTATTGAAAGAAAAAAGGG - Intronic
1169754268 20:9026446-9026468 GAAGCTATGAAGACAAAAAAAGG + Intergenic
1169950765 20:11040913-11040935 GGAGGTAGTAAGAGTAAAAAGGG - Intergenic
1173154689 20:40597847-40597869 GCTGCGATGAAGACTAAATAAGG - Intergenic
1174744632 20:53049188-53049210 GCAGCTATGAGGACCAAAGAGGG + Intronic
1177391317 21:20476557-20476579 GCAGCTAATAACATAAAAAAGGG + Intergenic
1177895268 21:26849690-26849712 TGAACTATTAAGAATAAAAAAGG - Intergenic
951037021 3:17944236-17944258 GCAGCTATAATAACTATAAATGG + Intronic
951582364 3:24179338-24179360 GCAGGTATTTAGAGTTAAAAGGG + Intronic
953794956 3:45977761-45977783 GTAGCTATTTAGGCTAAAATAGG - Intronic
953936052 3:47044003-47044025 TCAGCTTTTAAGAATACAAATGG + Intronic
955979255 3:64508229-64508251 GAAGATATCAAGACTAAAAGGGG - Intergenic
956075712 3:65502983-65503005 ACAGCTATGTAGACTCAAAAGGG + Intronic
957696649 3:83648513-83648535 GAAGCTATTCAGACTAACAGTGG - Intergenic
957769159 3:84666414-84666436 GCAAATATTAAGGCTAAAAATGG + Intergenic
958677607 3:97286993-97287015 GCAGCTGTTAAAAAAAAAAAAGG + Intronic
959808897 3:110592881-110592903 ACGGCTATGAAGAATAAAAATGG + Intergenic
961180134 3:124869869-124869891 GAAGCTATTTAAAGTAAAAATGG + Intronic
963180402 3:142349260-142349282 TCAGTTATTAAGAGTCAAAATGG + Intronic
963789782 3:149572281-149572303 GCAGCAATTATGAAAAAAAAAGG + Intronic
964834034 3:160917613-160917635 GCAGCTATTAAAAGCAAAAAAGG + Intronic
967713513 3:192737020-192737042 GAAGAAAGTAAGACTAAAAAAGG - Intronic
970787709 4:19819486-19819508 GCAGCTATTAAAAATGAATAAGG - Intergenic
970845189 4:20529176-20529198 GCAATTATTAATAATAAAAATGG - Intronic
974436229 4:61860703-61860725 GCAGCTATTAATAATATGAAAGG - Intronic
975860442 4:78671214-78671236 GCAGCAATAAAGACAAAAACAGG - Intergenic
977364690 4:96052950-96052972 TCAGATATTAAGACCAAACAAGG - Intergenic
978042377 4:104083946-104083968 GGAGCTATTAAGCCATAAAAAGG - Intergenic
980698500 4:136392737-136392759 GCAGCTCTTCAGAGTACAAATGG + Intergenic
981643960 4:146976979-146977001 GCAGTTATTTAGACTGAAAATGG + Intergenic
985099631 4:186445745-186445767 ACAGCTATTAAGAAAACAAATGG + Intronic
986512810 5:8526222-8526244 TCACATATTAAGACTAATAAAGG - Intergenic
987271750 5:16316467-16316489 GCAGCATTTAAGAATAAAACAGG - Intergenic
989822369 5:45808934-45808956 GAAGCTATTAGGGCTAAAGAAGG + Intergenic
993463742 5:88218728-88218750 GCAGTTCTTAAGAGTAAGAATGG + Intronic
994362512 5:98868911-98868933 TCAGTTATTGAGACTAATAAGGG + Intronic
995491687 5:112699570-112699592 GCAGCTATTAAAAGAATAAAAGG - Intergenic
996787160 5:127251512-127251534 GCTGCTATTAATAATAAAAATGG + Intergenic
999634401 5:153605205-153605227 TGAGCTATTAACACTTAAAAAGG + Intronic
1002787451 6:414280-414302 GCAGATAACAAGACTTAAAATGG + Intergenic
1004410315 6:15375465-15375487 GCAAATGTTAAGACTCAAAATGG - Intronic
1005325045 6:24691978-24692000 GCTACTATTGAGACTAAACATGG + Intronic
1007646991 6:43390588-43390610 ACAGCTGTTAAAACTTAAAATGG + Intergenic
1008318243 6:50073701-50073723 GATGCTTTTAACACTAAAAAGGG + Intergenic
1008400659 6:51058843-51058865 ACAGCTATTAACTCTGAAAATGG - Intergenic
1010590130 6:77702637-77702659 GCTGCAATTTAGACTAGAAAGGG - Intronic
1010873811 6:81075865-81075887 GCAGCTATCAACCCTGAAAAGGG + Intergenic
1010907785 6:81514016-81514038 GCAGCTATAAAGAGGAATAAAGG + Intronic
1011899425 6:92274083-92274105 GCAGCTACTAACTCTGAAAATGG - Intergenic
1012180310 6:96144616-96144638 TCAGCTATTAAGATTCCAAATGG + Intronic
1013937530 6:115616203-115616225 GCAGCCATTAGGACTACAAAAGG - Intergenic
1014356302 6:120414702-120414724 ACAGATTTTATGACTAAAAATGG - Intergenic
1014740316 6:125141951-125141973 GGAGCTATAAAGAAAAAAAAAGG + Intronic
1014961514 6:127691922-127691944 GAACCTATTAAGAGTTAAAAGGG + Intergenic
1015980176 6:138830567-138830589 GCAGCTATACGGACTTAAAAGGG - Intronic
1016206779 6:141477337-141477359 GCAGCTATTAAGAGGAGAATGGG - Intergenic
1017240626 6:152164147-152164169 GCAGCAGGTAAGACTTAAAATGG - Exonic
1019005098 6:168790146-168790168 GCAGAAATTGATACTAAAAATGG + Intergenic
1020731046 7:11880826-11880848 GAAGCTTTTAAAACAAAAAAAGG + Intergenic
1028188335 7:87816379-87816401 GCAGCCATTATGATTAAAAATGG + Intronic
1028459856 7:91079266-91079288 GCAGTTATAAAGAGTAAAACAGG - Intronic
1029700790 7:102245606-102245628 GAAGTTATTAAGATTAAATAAGG - Intronic
1030237596 7:107283091-107283113 ACAGCTTTTAAGACTAAAAAGGG - Intronic
1030463668 7:109873203-109873225 GCAGCTATTACCACTAAATTGGG + Intergenic
1033028645 7:137803029-137803051 GCAAATATTAACACTACAAAAGG + Intronic
1033435616 7:141330997-141331019 GCAGCTGCTAAGACCAAAAAAGG - Intronic
1033888297 7:145976152-145976174 GCTGATATTAAGAAAAAAAATGG + Intergenic
1034390093 7:150779786-150779808 GCAGGTATTAAGACGTAAATGGG + Intergenic
1036065256 8:5373432-5373454 GTAGCAATAAAAACTAAAAATGG + Intergenic
1037002209 8:13733554-13733576 GCAGCCAGTAAAACTAAAATTGG - Intergenic
1037176000 8:15946466-15946488 GCAGCAATGAAGTCTGAAAATGG - Intergenic
1037629037 8:20636349-20636371 GATGCTTTTAAGAGTAAAAAGGG - Intergenic
1040082349 8:43299882-43299904 GCAGTTATTAAGAATACACATGG + Intergenic
1041753020 8:61281891-61281913 GCAGTTTTTAAGACTGAAATTGG - Intronic
1046279963 8:112014845-112014867 ACAAATATTAAGAATAAAAAAGG + Intergenic
1046505277 8:115129098-115129120 GGAGCTAATAAAACAAAAAAGGG + Intergenic
1046936690 8:119891322-119891344 GCAGCAATCAAGACTGAAGACGG + Intronic
1047372049 8:124264308-124264330 GCAGTTATTCAGCCTTAAAAAGG - Intergenic
1048222225 8:132552523-132552545 GCAGGTAGTCAGAGTAAAAAGGG + Intergenic
1049497008 8:142940396-142940418 GCAACTTTTAAAATTAAAAAAGG + Intergenic
1050339892 9:4626198-4626220 GCAGCTGTTAAGGCGAAGAATGG - Intronic
1050712552 9:8482079-8482101 GAAGTTATTAAGATTAAAGATGG - Intronic
1051165800 9:14261013-14261035 ACAGCATTTAAGACTGAAAAGGG + Intronic
1051830013 9:21265707-21265729 GCATCTAGTAAACCTAAAAAGGG - Intergenic
1052226638 9:26096836-26096858 TCAGATATTAAGACCAACAATGG - Intergenic
1052259467 9:26496373-26496395 GCAGCAAATATAACTAAAAAAGG + Intergenic
1052745189 9:32433603-32433625 GTGGCTATTGAGAATAAAAATGG + Intronic
1055075056 9:72205555-72205577 GCAGCATTTAAGACAGAAAATGG + Intronic
1056932696 9:90891987-90892009 GAGTCCATTAAGACTAAAAAGGG - Intronic
1058339084 9:103872304-103872326 ACAGTTATTTAGACTAGAAATGG + Intergenic
1059651166 9:116317402-116317424 AGAGCTATTAAGACTAAAGGGGG - Intronic
1060800421 9:126541268-126541290 GAAATTATTAAGACTAAAAAAGG + Intergenic
1062553786 9:137104606-137104628 GCAGATATTCAGCCTGAAAAAGG - Intronic
1186318894 X:8402260-8402282 GCAGCCATTAAGTCTAAAGGGGG - Intergenic
1186749986 X:12611388-12611410 GAAGCTAAAAAGTCTAAAAAGGG - Intronic
1188642030 X:32518248-32518270 GCTGCTATTAATACTAATAGAGG - Intronic
1190022334 X:46890554-46890576 GCAGTTATAAAGCCTAAACATGG + Intronic
1194777689 X:97985188-97985210 GGAGCTAGTAAGATTGAAAATGG + Intergenic
1195120190 X:101741928-101741950 CCAGGTATTAAGACAAAAAGAGG - Intergenic
1198625727 X:138571192-138571214 GCAGGGATTAACACTAAAAGTGG + Intergenic
1199320843 X:146436816-146436838 GCAGGTATTCAGCCTATAAAAGG - Intergenic
1200679234 Y:6189935-6189957 ACAGTTATTAAAAGTAAAAAAGG + Intergenic
1200757123 Y:7000577-7000599 GCAGCAACTAAGACTAAACCTGG + Intronic