ID: 1131501326

View in Genome Browser
Species Human (GRCh38)
Location 15:92969723-92969745
Sequence ATGAATTAGCTTGGTGTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2446
Summary {0: 1, 1: 1, 2: 22, 3: 533, 4: 1889}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131501326 Original CRISPR ATGAATTAGCTTGGTGTGGT TGG (reversed) Intronic
Too many off-targets to display for this crispr