ID: 1131505198

View in Genome Browser
Species Human (GRCh38)
Location 15:93011738-93011760
Sequence TAGGGTGAACATAATGGAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 152}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131505190_1131505198 21 Left 1131505190 15:93011694-93011716 CCTGTCTCATCATATCATTCCCC 0: 1
1: 0
2: 3
3: 19
4: 170
Right 1131505198 15:93011738-93011760 TAGGGTGAACATAATGGAATTGG 0: 1
1: 0
2: 0
3: 8
4: 152
1131505193_1131505198 0 Left 1131505193 15:93011715-93011737 CCTGTTGCGCAGTAACACCATGC 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1131505198 15:93011738-93011760 TAGGGTGAACATAATGGAATTGG 0: 1
1: 0
2: 0
3: 8
4: 152
1131505192_1131505198 1 Left 1131505192 15:93011714-93011736 CCCTGTTGCGCAGTAACACCATG 0: 1
1: 0
2: 0
3: 2
4: 64
Right 1131505198 15:93011738-93011760 TAGGGTGAACATAATGGAATTGG 0: 1
1: 0
2: 0
3: 8
4: 152
1131505191_1131505198 2 Left 1131505191 15:93011713-93011735 CCCCTGTTGCGCAGTAACACCAT 0: 1
1: 0
2: 0
3: 3
4: 42
Right 1131505198 15:93011738-93011760 TAGGGTGAACATAATGGAATTGG 0: 1
1: 0
2: 0
3: 8
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131505198 Original CRISPR TAGGGTGAACATAATGGAAT TGG Intronic
900924571 1:5695896-5695918 TAGAGTGAACCTTGTGGAATAGG + Intergenic
912840064 1:113031404-113031426 GAGGGTGAAAAAAAAGGAATTGG + Intergenic
916806870 1:168268216-168268238 TAGCATCAATATAATGGAATAGG + Intergenic
918335820 1:183511722-183511744 TTGGGAGAACAGAATGAAATGGG + Intronic
919691410 1:200531605-200531627 CAGTGTGAAATTAATGGAATAGG - Intergenic
921494118 1:215815676-215815698 TAGGGTGAAGAAAAAGTAATGGG - Intronic
922399402 1:225237057-225237079 TAGGCTGAAAATAAAGGGATGGG - Intronic
924749827 1:246875817-246875839 TAGTGTAAACATTATGCAATGGG + Intronic
1068148674 10:53103978-53104000 TAAGGTGAATATTAAGGAATGGG - Intergenic
1069217997 10:65846135-65846157 CAGGCTTAACATAATGGAGTTGG - Intergenic
1070484935 10:76921111-76921133 TAGACTTAACATAAAGGAATTGG + Intronic
1070650733 10:78233915-78233937 GTGGGTGAAAATATTGGAATAGG - Intergenic
1072638269 10:97191617-97191639 TAGGAAAAACATAATGTAATAGG - Intronic
1075513514 10:123091507-123091529 TAGGATGAAGATAAGGGAATTGG - Intergenic
1080709464 11:34733296-34733318 TATGTTGCACATAATTGAATTGG - Intergenic
1080989821 11:37518023-37518045 CAGAGTGAAAATAAAGGAATGGG + Intergenic
1084803355 11:71561793-71561815 TAGGATGAATATAATGTAAAAGG + Intronic
1086100552 11:83094904-83094926 TTGGGAGAACAGAATGGAATAGG + Intergenic
1086119595 11:83292258-83292280 TGGGGTGAACAAAATGAAAAAGG + Intergenic
1087026473 11:93654629-93654651 TGGGGTGAGCAGAAAGGAATGGG + Intergenic
1090214388 11:124948087-124948109 TAGGCTCAAAATAAAGGAATAGG + Intergenic
1092953956 12:13532342-13532364 AAGGGTGAACATCAGGGAAGTGG - Intergenic
1093180722 12:15964343-15964365 TGGGGTGAACGCAATGGAAATGG - Intronic
1098476582 12:70911110-70911132 TGGGAAGAACATAATGGAAAAGG - Intronic
1100004864 12:89882478-89882500 TAGGGTGAATGTCAGGGAATTGG - Intergenic
1100455062 12:94743500-94743522 TAGGGTGAAGCTAAAGGAAAAGG + Intergenic
1107699663 13:43035023-43035045 TAGGGAAAAGATAAAGGAATTGG - Intronic
1108889873 13:55244291-55244313 TAGGGTGAACAGAATAAATTTGG + Intergenic
1109465206 13:62722774-62722796 AAGGGTGAAATTAATGGAAAAGG - Intergenic
1111167910 13:84486850-84486872 TAGTGTGAACTTCATGGAGTGGG - Intergenic
1113556423 13:111239273-111239295 TACTGTGAATATAATGTAATAGG + Intronic
1115756755 14:36535203-36535225 TTGGATGAAGAGAATGGAATTGG - Intergenic
1116911270 14:50467456-50467478 TAATGTGAATATAATGTAATTGG - Intronic
1117602128 14:57386879-57386901 GAGGTTGAAAATAATGGAAATGG + Intergenic
1118073747 14:62275966-62275988 AAGGTTGAAAATAAAGGAATGGG - Intergenic
1124972359 15:34500634-34500656 TAGGTTGAATATAATGGAAAAGG + Intergenic
1126184922 15:45822579-45822601 TAGACTGAAAATAATGGGATGGG + Intergenic
1127128563 15:55837551-55837573 TAAAGTGAAGAGAATGGAATAGG + Intronic
1128901778 15:71429292-71429314 TAGGGGGAAATTAATGGACTTGG + Intronic
1130727128 15:86450624-86450646 TAGGGTCAAAATATTAGAATTGG + Intronic
1131505198 15:93011738-93011760 TAGGGTGAACATAATGGAATTGG + Intronic
1136363992 16:29800150-29800172 TAGGGTGAATTTAATGGGAGAGG - Intronic
1138873767 16:60925116-60925138 TGTTGTGAATATAATGGAATTGG + Intergenic
1139067960 16:63342678-63342700 CAGGCTGAAAATAATGGACTAGG - Intergenic
1141025443 16:80541985-80542007 AAGGTTGAACAAAATGGAAGAGG - Intronic
1146480852 17:33203748-33203770 TAGGGTGAGCACACTGGAGTGGG + Intronic
1146990344 17:37265255-37265277 AAGGGTGTACATACAGGAATGGG + Intronic
1148680716 17:49472065-49472087 AAGGGTGAAGATAATAAAATAGG - Intronic
1149590362 17:57824738-57824760 TAGGATGAATATAAAGAAATGGG + Intergenic
1153048206 18:876268-876290 TAGAGGGACCATAATGGAACTGG + Intergenic
1154089883 18:11348118-11348140 TAGGCTGAAAGTGATGGAATGGG + Intergenic
1155014627 18:21821087-21821109 CAGTGGGAACAGAATGGAATGGG - Intronic
1158708235 18:59813695-59813717 AAGGGAGAAAATAAAGGAATAGG + Intergenic
925876406 2:8314772-8314794 CAGGGTCAAAATATTGGAATTGG + Intergenic
926842813 2:17101492-17101514 TAGGATTAGCATAATGGAAATGG + Intergenic
931145923 2:59518259-59518281 TAGGCTGAACCTAAAGCAATAGG + Intergenic
931527063 2:63168376-63168398 AAGGGTAAAAATAAAGGAATGGG - Intronic
931702718 2:64922299-64922321 TAGGGAGAATCTAATGGAACAGG - Intergenic
933379234 2:81521965-81521987 TAGGATGAAGATAAAGGAAAAGG - Intergenic
935059709 2:99596547-99596569 AAGGGTGCACATATTGGAAGAGG + Intronic
937159059 2:119742918-119742940 TAGGGTGAACATAAAGGTGGAGG - Intergenic
939404569 2:141739791-141739813 CAGGGTGAACAATATGGATTTGG - Intronic
939991665 2:148881740-148881762 GAGGGTGAACTCACTGGAATGGG + Intronic
940796013 2:158079683-158079705 CAGGGAGAACATATTGGAAAAGG - Intronic
941982406 2:171473302-171473324 TAGGTTGAAAATATTGGAAAAGG + Intronic
942384701 2:175430029-175430051 GAGGGTGAACATGAAGGAGTAGG + Intergenic
942650502 2:178162294-178162316 CAGAGTGTCCATAATGGAATAGG + Intergenic
943870128 2:192984375-192984397 AAGGGTGAAAATCAAGGAATTGG - Intergenic
944862097 2:203824822-203824844 CAGGGTGAAGACAATGGAACTGG + Intergenic
945711409 2:213301093-213301115 GAGAGTTAACATAATGGTATAGG - Intronic
945761565 2:213921395-213921417 TAGGCTCAAAATAAAGGAATGGG - Intronic
1173085650 20:39913915-39913937 TAGGGTAAACGGCATGGAATGGG - Intergenic
1174168481 20:48601320-48601342 GAGGATGAACACACTGGAATGGG - Intergenic
1175036810 20:56007037-56007059 TAGAGAGAATATATTGGAATTGG - Intergenic
1175854478 20:62113037-62113059 GAGGGCGAGGATAATGGAATTGG + Intergenic
1177064750 21:16416341-16416363 TATGGGAAACATAATGGAGTAGG - Intergenic
1177904481 21:26958932-26958954 TAGTGGAAACATAATGGAATGGG + Intronic
1182056887 22:27365451-27365473 AAAGGTGAACATAATGTACTGGG + Intergenic
1182946871 22:34332478-34332500 TATCATCAACATAATGGAATAGG + Intergenic
953458407 3:43062251-43062273 TAGGGTAACCATAATCAAATTGG - Intergenic
956829798 3:73034990-73035012 TAGAGTGAAGAAAATGAAATGGG + Intronic
957934007 3:86919238-86919260 AAGGGTGAACATAATATAGTAGG + Intergenic
958673834 3:97239898-97239920 TAGGCTGAATATGATGTAATAGG + Intronic
958855098 3:99375642-99375664 TAAGGTGAATTTATTGGAATGGG + Intergenic
960213103 3:114995535-114995557 TAGGGTGAAGCTTATGAAATAGG - Intronic
960244639 3:115386719-115386741 GAGGAGGAACATAATGGAATTGG + Intergenic
961584295 3:127909599-127909621 TAGGGTGAGCATCATGTAATGGG + Intergenic
962678753 3:137776945-137776967 TGGAGTGAGCATAATGAAATGGG - Intergenic
963557366 3:146809712-146809734 TAGGCTGCATATAATGGACTGGG + Intergenic
964161449 3:153650546-153650568 TAGGATGAACAGAATGAAACTGG + Intergenic
965535307 3:169817790-169817812 TAAGCTGAAAATAAAGGAATGGG - Intergenic
969132266 4:5000226-5000248 TAGGCTCAAAATAAAGGAATGGG - Intergenic
970460006 4:16265143-16265165 TAGGGTGAAAACACTGGTATAGG + Intergenic
971395756 4:26225845-26225867 TAGGGGGAAAAAAAAGGAATAGG + Intronic
973308487 4:48679400-48679422 TAGGGAGAATATAAGGTAATGGG + Intronic
974560302 4:63508233-63508255 TAGGCTCAAAATAAAGGAATGGG + Intergenic
976409737 4:84699730-84699752 TAGGATGACCATAATGGGGTGGG - Intronic
977185801 4:93933986-93934008 TAGACTGAACATAAAGGGATGGG + Intergenic
978257890 4:106714390-106714412 TAGGCTCAAAATAAAGGAATGGG + Intergenic
982156793 4:152531293-152531315 TAGGGTGAAAATATAGGGATTGG - Intronic
982805061 4:159753173-159753195 TAGGCTGAAAATAAAGAAATTGG - Intergenic
986219741 5:5757273-5757295 TAGGGTGAAAACAGAGGAATGGG - Intergenic
987915038 5:24201675-24201697 AAGGCTCAACATAAAGGAATGGG + Intergenic
988599967 5:32630804-32630826 TAGGGTGACCATTATGTGATAGG + Intergenic
991332654 5:65509115-65509137 AAGGGTAAACATAAAGGGATGGG - Intergenic
994063020 5:95502760-95502782 TTGGGTGAACAAAAGGGATTGGG - Intronic
994590444 5:101765238-101765260 TAGTATGAACACAATGGATTTGG - Intergenic
994812546 5:104540119-104540141 TAGGATGCACAGAATGGAATAGG - Intergenic
997431445 5:133843812-133843834 TAGGCTGCACAGCATGGAATAGG + Intergenic
999995541 5:157088922-157088944 TAAGGTAAGAATAATGGAATGGG - Exonic
1003264697 6:4555039-4555061 TAGAGTGAACATATTTCAATGGG - Intergenic
1004494113 6:16147395-16147417 TAGGGGGAGCGTAAAGGAATAGG - Intronic
1005384494 6:25272529-25272551 GATGGTGAATATAATGGATTTGG - Intergenic
1008168014 6:48164647-48164669 TAGGGTCAGAATTATGGAATAGG + Intergenic
1008537534 6:52518211-52518233 CAGGGTGAACAGAACGGCATTGG + Intronic
1009407702 6:63330603-63330625 TATGGTGGACATCATTGAATGGG + Intergenic
1009906199 6:69872653-69872675 GATGGTGAGAATAATGGAATGGG + Intronic
1009921800 6:70071725-70071747 GAGGGAGAACAGAATGGCATTGG + Intronic
1013959133 6:115876873-115876895 TAGGTTAAACAGAATGGAACTGG - Intergenic
1014406336 6:121056449-121056471 TATAGTGAGTATAATGGAATTGG + Intergenic
1014514366 6:122362748-122362770 TAGCATCAATATAATGGAATAGG - Intergenic
1014804006 6:125808946-125808968 TAGGCAGAGAATAATGGAATAGG + Intronic
1015311369 6:131770763-131770785 TAGGGTGAACGTCATTGAAAAGG + Intergenic
1020733198 7:11910578-11910600 TAACGTAAGCATAATGGAATTGG + Intergenic
1022036584 7:26540196-26540218 TAGAGAGAACTTAATGGTATGGG - Intergenic
1024655174 7:51446150-51446172 TTGGGTGAAAATAATGAAAAGGG - Intergenic
1026239372 7:68558910-68558932 TAGGGTCAATATATTGGAAAGGG - Intergenic
1026563456 7:71469759-71469781 TAGGCTAAACTTAATTGAATAGG + Intronic
1027603844 7:80274784-80274806 AAGGTTGAAAATACTGGAATGGG - Intergenic
1030258165 7:107534442-107534464 TAGGCTGAAAATAAAGGGATGGG + Intronic
1031138544 7:117914242-117914264 AAGGGTGACCATAAGGTAATGGG - Intergenic
1035703328 8:1653743-1653765 TAAGGTGACCCTAATGGAAAAGG - Intronic
1038968292 8:32601681-32601703 GAGGGTGATCAGAATTGAATAGG - Intronic
1041563358 8:59246491-59246513 AAGGGTGAGCATACTGGGATGGG + Intergenic
1042577927 8:70241561-70241583 CAGGATGAACATAATGGACAAGG - Intronic
1042792931 8:72628732-72628754 TAGGGTCAACATTTGGGAATAGG + Intronic
1044007721 8:86958692-86958714 TAGGCTGAAAATAAAGGGATGGG - Intronic
1044081418 8:87889929-87889951 TAGGGGGAAAATAATGGAGCAGG + Intergenic
1044627533 8:94248648-94248670 TAGGGAGAAGAGAATGAAATAGG + Intergenic
1046018071 8:108630112-108630134 TAGGCTCAAAATAAAGGAATGGG + Intronic
1046141024 8:110092390-110092412 TAGGGTGTTGATAATGGAAATGG + Intergenic
1046790433 8:118316196-118316218 GAGGGTCAAGATAATGGAACTGG - Intronic
1047782330 8:128120206-128120228 TAGGGAATAAATAATGGAATGGG - Intergenic
1048109912 8:131456183-131456205 TAGGCTCAAAATAAAGGAATGGG + Intergenic
1048340378 8:133534131-133534153 TTGGTTGAATAGAATGGAATTGG - Intronic
1050174056 9:2851755-2851777 TAGAGTGAACACAATGGCAGAGG - Intergenic
1051874513 9:21777251-21777273 TAGGGTGAACATGATGGGGTTGG + Intergenic
1052009378 9:23387782-23387804 TTGGGTGAAGATATGGGAATGGG - Intergenic
1058768053 9:108201377-108201399 TAGACTGAAAATAAAGGAATGGG + Intergenic
1059181604 9:112219007-112219029 CAGTGTGAACAGAATGGATTAGG - Exonic
1059654465 9:116345017-116345039 CAGTGAGAACATAATTGAATGGG + Intronic
1187592928 X:20738866-20738888 GAGGGTGAAAATAATAGAAATGG - Intergenic
1188192302 X:27187337-27187359 TAGGTTGAAAATAATAGTATGGG + Intergenic
1188917512 X:35931380-35931402 TAGGGTGAAAGTAAACGAATAGG - Intronic
1190943257 X:55065410-55065432 TAAAGTGAAAATAATGGGATGGG - Intergenic
1192564238 X:72150162-72150184 TAGGGTGCACATATTGAATTTGG - Intergenic
1193825916 X:86226854-86226876 TAGTGTGAATATAATGTCATTGG + Intronic
1195400886 X:104459843-104459865 TAAAGTGAATTTAATGGAATTGG + Intergenic
1197419906 X:126226071-126226093 AAGAGTGAACATCTTGGAATCGG - Intergenic
1198443328 X:136685834-136685856 AAAGCAGAACATAATGGAATAGG + Intronic
1199407819 X:147483731-147483753 TAGGCTCAAGGTAATGGAATGGG - Intergenic