ID: 1131506584

View in Genome Browser
Species Human (GRCh38)
Location 15:93025181-93025203
Sequence GCTGATGGGGAGTGGCGAGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 260}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131506584 Original CRISPR GCTGATGGGGAGTGGCGAGT TGG Exonic
900155862 1:1203062-1203084 GCTGCCGGGGAGTGGCGGGCAGG - Intergenic
900940902 1:5798092-5798114 GCTGATGGGGAGAGAGGAGGTGG + Intergenic
901274321 1:7979296-7979318 GGGCCTGGGGAGTGGCGAGTGGG - Intronic
901861662 1:12078592-12078614 TCTCATGGGGAGTGGGGAGCAGG + Intronic
901875973 1:12167293-12167315 GCGGATGGGGGGCGGCGACTGGG - Intronic
902644482 1:17788815-17788837 GATGTTGGGGAGAGGAGAGTTGG + Intronic
902940605 1:19798169-19798191 GCTGATGAGGAGTGGGGAACTGG - Exonic
903791209 1:25894295-25894317 GCTGTTGGGGACTGGAGAGATGG + Intronic
904977827 1:34472193-34472215 GGTATTGGGGAGTGGAGAGTGGG - Intergenic
906077511 1:43062964-43062986 GCTGGTGGGGAGTGGGAAGGGGG + Intergenic
906201611 1:43964014-43964036 CCTGAGGAGGAGTGGGGAGTAGG + Intronic
907398433 1:54208837-54208859 GTGGATGGGGTGTGGGGAGTTGG + Intronic
908104380 1:60826262-60826284 GATGGTGGGGAGTGGGAAGTGGG - Intergenic
913472350 1:119201808-119201830 CCTGATGGGGGGTGGGGACTGGG + Intergenic
915334071 1:155130373-155130395 GCTGGTGGGGAGGGGCTGGTGGG + Intronic
916256097 1:162789639-162789661 GCTACTGGGGAGTGGGGAGATGG + Intergenic
918148896 1:181781402-181781424 GCTCATGGAGGGTGGTGAGTTGG - Intronic
919507486 1:198417464-198417486 GCAGAAGGAGAGTGGCCAGTTGG - Intergenic
919747461 1:201017574-201017596 TCTGGTGGGGAATGGCCAGTGGG + Intronic
919781227 1:201222527-201222549 GCTGATGGGGAGATGCTAGCGGG - Intronic
921582948 1:216916059-216916081 GCTGAAAGGGAGAGGAGAGTGGG - Intronic
922800272 1:228361903-228361925 GCTGAGGGGGAGCTGCCAGTGGG + Intronic
924673610 1:246153364-246153386 GCTGAGGGGAAGTGATGAGTGGG - Intronic
1064681099 10:17811679-17811701 GCTACTGGGGAGTTGGGAGTGGG - Intronic
1066126264 10:32346386-32346408 GCTGTGGGGGTGCGGCGAGTCGG - Intronic
1066722559 10:38355293-38355315 GCTACTGGGGAGTGGGGAGATGG + Intergenic
1067106711 10:43371512-43371534 GCTGTTGGGGAGGGGCGGGCTGG - Intergenic
1068652138 10:59534195-59534217 CCTGTTGGGGGGTGGGGAGTGGG + Intergenic
1070555922 10:77527725-77527747 GCTGGTGGGGAGTGAGGAGGAGG + Intronic
1070881982 10:79858689-79858711 GCTAATGGGCAGTGAAGAGTTGG - Intergenic
1071648557 10:87375000-87375022 GCTAATGGGCAGTGAAGAGTTGG - Intergenic
1072940899 10:99762643-99762665 GCTGGTGAGGAGTGGGAAGTTGG + Intergenic
1073623805 10:105075555-105075577 GCTGATGGGGAGTGACACCTTGG + Intronic
1075844651 10:125535542-125535564 GTTGATGGGAAGGGGCCAGTAGG - Intergenic
1076999579 11:315948-315970 GCTGCTGGGCCGTGGCGAGCTGG - Intergenic
1077065873 11:640730-640752 GCTGATGGGGAGTGGGGAAGAGG + Intergenic
1077177731 11:1198208-1198230 GCTGAGGGTGAGGGGAGAGTGGG + Intronic
1078512795 11:11997973-11997995 CCTGCTGAGGAGTGGCCAGTAGG - Intronic
1081807741 11:45899631-45899653 GCCGAGGGGGAGGGGCGAGCGGG - Intronic
1083615560 11:64024442-64024464 GCAGCTGGGGAGTGGGGAGCTGG + Intronic
1083752066 11:64766297-64766319 GGTGATGGGGAGTGGAGGGGTGG + Intronic
1084085491 11:66853152-66853174 GGTCATGGGGAGTGGCAAGGAGG + Intronic
1085525507 11:77161376-77161398 GCAGATCGGCAGTGGCCAGTGGG - Intronic
1087969483 11:104461800-104461822 GGTGGTGGGGAGTGGGGAATGGG + Intergenic
1090188745 11:124754402-124754424 GCAGATGGGGTGGGGAGAGTGGG - Intronic
1090921542 11:131210488-131210510 GGTGATGGGGAGGGGGAAGTGGG + Intergenic
1091751325 12:3022857-3022879 GCTGAAGGGGAGTGGGGAAGAGG - Intronic
1093417395 12:18935429-18935451 GCAGATGGAAAGTGGGGAGTGGG + Intergenic
1095090417 12:38099391-38099413 GCTGAGGGGGAGTGGCGGTGGGG + Intergenic
1095298473 12:40554676-40554698 GCTGGTGTGGAGTGGCAAGTTGG - Intronic
1096072419 12:48782667-48782689 GCGGATGGGGAGGAGCGTGTAGG + Exonic
1100555484 12:95689072-95689094 GCTTATGGGGAGGGGCGTGGGGG - Intronic
1101213144 12:102554526-102554548 GGTGGTGGGGACTGGCAAGTTGG + Intergenic
1102345893 12:112161309-112161331 GGTGATGGGGAGTGCTGGGTGGG + Exonic
1102866899 12:116381884-116381906 GATGCTGGGGAGAGGGGAGTTGG - Intergenic
1103452735 12:121040729-121040751 GCCAATGTGGAGTGGGGAGTTGG - Intergenic
1103938707 12:124490284-124490306 CCTTGTGGGGAATGGCGAGTTGG - Intronic
1103948744 12:124540729-124540751 GGGGATGGGGAGTGGGGAGATGG + Intronic
1103948886 12:124541139-124541161 GGGGATGGGGAGTGGAGAGCTGG + Intronic
1103948985 12:124541442-124541464 GGGGATGGGGAGTGGAGAGCTGG + Intronic
1103949160 12:124541921-124541943 GGGGATGGGGAGTGGAGAGCTGG + Intronic
1104450503 12:128864771-128864793 GCTGTTGGGGAGGGGTGAGCTGG + Intronic
1105899945 13:24745500-24745522 GCTGGTGGGGACTGGCGTGAGGG - Intergenic
1108991470 13:56663095-56663117 CCTGTTGGGGGGTGGGGAGTTGG + Intergenic
1109988356 13:70019466-70019488 GCTGATAGTGAGGGGCTAGTGGG + Intronic
1110761811 13:79239040-79239062 GCTGAGGGGTAGTGGAGATTGGG - Intergenic
1112120089 13:96400550-96400572 GTTGATGGGCACTGGGGAGTTGG + Intronic
1115239436 14:31240298-31240320 GATGGTGGGGAGGGGCGAGGAGG - Intergenic
1115486106 14:33912930-33912952 GCTGGTGGGGAGGGGAGAGGAGG - Intergenic
1117776658 14:59190104-59190126 GCTGGGAGGGAGTGGCTAGTGGG + Intronic
1119068494 14:71555802-71555824 GCAGATGGGGAATGGCTGGTGGG + Intronic
1119930544 14:78542278-78542300 GCTGATGTGGAGTGTAGAGGTGG + Intronic
1120727580 14:87962204-87962226 TCTGACAGGGAGTGGGGAGTAGG + Intronic
1121372062 14:93368389-93368411 GATGATGGGGAGTGGGGAGAAGG + Intronic
1122551212 14:102550965-102550987 GGTGATGGGGGGTGGGGAGATGG + Intergenic
1122606154 14:102948458-102948480 GGTGAGGGGGAGTGGGGGGTGGG + Intronic
1122658573 14:103279225-103279247 GCTGCTGGGGAGCGTGGAGTGGG + Intergenic
1123114915 14:105890277-105890299 GCAGATGGGGGGTGGGGGGTGGG + Intergenic
1126347737 15:47714938-47714960 GCTGTTAAGGAGTGTCGAGTGGG + Intronic
1130990808 15:88874636-88874658 GCTGATTTGGAGGGGTGAGTGGG - Exonic
1131506584 15:93025181-93025203 GCTGATGGGGAGTGGCGAGTTGG + Exonic
1135476046 16:22776087-22776109 GGTTATGGTGAGTGGAGAGTGGG + Intergenic
1135497650 16:22966475-22966497 GCTGCTGGGGAGTGTCGAGGAGG - Intergenic
1137986948 16:53117066-53117088 TCTGTTGGGGAGTGGCAAGGGGG + Intronic
1138415126 16:56867210-56867232 GGTGATGGTGAGTGGGGTGTGGG + Exonic
1139469713 16:67171563-67171585 TCTGATGGGCAGTGGGGTGTGGG + Intronic
1140140517 16:72252309-72252331 AATGATTGGGAGTGGGGAGTGGG + Intergenic
1140435462 16:74943356-74943378 GCTGATGGGGAGTGGGGTGCGGG - Intronic
1141014169 16:80432563-80432585 AGTGATGGGGAGTGGGGAGGGGG + Intergenic
1142527804 17:556910-556932 GCTGAAGGGGGGTGGCCAGGAGG + Intronic
1142697201 17:1640139-1640161 ACTGCTGAGGAGTGGCCAGTTGG - Intronic
1143082792 17:4394103-4394125 ACCGATGGGGAGTGGGGAGGAGG + Intergenic
1143405275 17:6673404-6673426 GTTGATGGTGTGTGGCGAGATGG - Intergenic
1143637999 17:8177364-8177386 TGAGATGGGGAGTGGGGAGTAGG - Intergenic
1144707523 17:17379471-17379493 GGGGATGGGGAGTGGAGAGAGGG - Intergenic
1144836211 17:18157955-18157977 GCAGAAGGGGTGAGGCGAGTGGG + Intronic
1151130618 17:71893106-71893128 GCTGGTGGGGGGTGGGGGGTGGG + Intergenic
1151352392 17:73539479-73539501 GCTGATGGGGAGAGGAGAGAGGG + Intronic
1152323584 17:79622920-79622942 GCTGATGGGGAGTGGCAGCTGGG - Intergenic
1152343382 17:79737567-79737589 TGTGGTGGGGAGTGGGGAGTGGG - Intronic
1153199680 18:2635412-2635434 CCTGATGGAGGGTGACGAGTAGG + Intergenic
1153480360 18:5542466-5542488 GTTGAGGGGGGGTGGGGAGTGGG - Intronic
1153843253 18:9026008-9026030 ACAGAGGGGGAGTGGGGAGTGGG + Intergenic
1155005488 18:21725432-21725454 ACAGATGGGGAGTGGGGACTAGG - Intronic
1157322091 18:46642440-46642462 AGTGATGGGGAGTGGCAAGAAGG - Intronic
1157579260 18:48764009-48764031 GCTGATGGGGGGTGGGGAGCAGG - Intronic
1157595174 18:48859837-48859859 TCTGATGGGGAGGGGAGAGGCGG - Exonic
1158820776 18:61156400-61156422 GCTGGTGGTGAGTAGGGAGTGGG - Intergenic
1160347891 18:78149869-78149891 GGAGATGGGGAGTGTCCAGTGGG + Intergenic
1160580405 18:79881058-79881080 GCTGAAGAGGAGTGGGGAGCAGG - Intronic
1164989572 19:32674669-32674691 GCTGGAGGGGAGCGGCGGGTGGG - Intronic
1165159224 19:33805994-33806016 GCGGATGGGGACTGGAGAGAAGG - Intronic
1165770306 19:38376138-38376160 GCTGATGGGGAGGGGAGGGAGGG - Exonic
1166144783 19:40826403-40826425 GCTGAGGGGGAGTGGGAAGGAGG + Intronic
1166182959 19:41121804-41121826 GCTGAGGGGGAGTGGGAAGGAGG - Intronic
1166317141 19:41995645-41995667 GCTGATGGGGTGTTGTGTGTCGG - Intronic
925855075 2:8121512-8121534 GTAGATGGGGAGAGGAGAGTGGG + Intergenic
926119629 2:10235041-10235063 GCTGATGGGGAGCAGCCAGAAGG - Intergenic
926242520 2:11099624-11099646 GCTGATGGGGGGATGCGACTTGG - Intergenic
927882524 2:26698715-26698737 GGAGATGGGGGGTGGGGAGTGGG - Intronic
930026423 2:47031899-47031921 GCTGATGGGGAGCCACGAGTGGG - Intronic
930096673 2:47571000-47571022 GGTGTTGGGGAGGGGTGAGTAGG + Intergenic
930712501 2:54562216-54562238 GCTGATGTGAAGTGGAGAGATGG - Intronic
933528525 2:83475651-83475673 GAGGATGGGGACTGGGGAGTGGG - Intergenic
933629949 2:84644590-84644612 GCTGTTGGAGGGTGGGGAGTGGG - Intronic
933862879 2:86487644-86487666 GGTGATGGGGAGTTAAGAGTGGG - Intronic
933969429 2:87458199-87458221 GCTGATGAGAGGTGGAGAGTGGG - Intergenic
934857518 2:97738459-97738481 GCTGGTGGGGACTGGAGTGTTGG - Intronic
935184535 2:100720162-100720184 GCTGATGGGAAGTGATGAGATGG - Intergenic
935584030 2:104784669-104784691 GCTGCTGGGGAGTGGCTGGTGGG - Intergenic
935802582 2:106713739-106713761 GTTGGTGGGGAGAGGAGAGTGGG + Intergenic
935840013 2:107098817-107098839 GCTGATTCGAAGTGGTGAGTTGG - Intergenic
936324358 2:111492295-111492317 GCTGATGAGAGGTGGAGAGTGGG + Intergenic
937309801 2:120895047-120895069 GCTGATGGGGAGGGGAGGGGAGG + Intronic
937319308 2:120951439-120951461 GCTGATGGTGAGTAGGGTGTGGG + Exonic
937424704 2:121789420-121789442 GCTGGTGAGGGGTGGCGAGAAGG - Intergenic
937768775 2:125694660-125694682 CCTGATGGGGAGTGGACATTGGG - Intergenic
939007425 2:136805681-136805703 GCTGATTGGGTTTGGCTAGTAGG + Intronic
944095381 2:195961385-195961407 GCTGGTGGGTAGTGGGGATTGGG - Intronic
948342293 2:237263597-237263619 CCTGATGTCGAGTGGCCAGTGGG + Intergenic
948364129 2:237443564-237443586 GGAGATGGGGAGTTGGGAGTTGG + Intergenic
948554281 2:238796517-238796539 GCTGATGTGGAGCAGGGAGTGGG - Intergenic
948944648 2:241213311-241213333 GCTGATGGGGAGAGGACAGCTGG - Intronic
948995143 2:241574218-241574240 GAGGGTGGGGAGTGGCGAGAGGG + Intergenic
1169502853 20:6177670-6177692 GCTGAGGGGGATTGGTGGGTGGG + Intergenic
1174117218 20:48234802-48234824 GCTGCTGGGGATTGGTGTGTGGG - Intergenic
1174218057 20:48932333-48932355 GATGATTGGGAGGGGAGAGTTGG + Intronic
1174534104 20:51237566-51237588 GCAGACGGGCAGGGGCGAGTTGG + Intergenic
1174613200 20:51815902-51815924 TCTCATGGTGAGTGGGGAGTGGG + Intergenic
1175844115 20:62049677-62049699 ACTGCTGGGGAGTTGGGAGTTGG - Intronic
1179437680 21:41373569-41373591 GCTGAAGGGCAGAGGGGAGTTGG - Intronic
1181024865 22:20122439-20122461 GCTGCTGGGGACTGTCGAGGTGG - Intronic
1181058921 22:20272751-20272773 GCTGGTGGGGGCTGGGGAGTAGG + Intronic
1181431542 22:22884706-22884728 GATGGTGGGGAGTGGGGAGCTGG + Intronic
1181959527 22:26612910-26612932 GCTAATGGGGAGAGGACAGTGGG - Intronic
1182109221 22:27711042-27711064 CCTGTTGGGGAATGGGGAGTGGG + Intergenic
1183338069 22:37262314-37262336 GTTGGTGGGAAGTGGGGAGTAGG - Intergenic
1183747300 22:39699033-39699055 GGTGATGGGGAGTGATGAGGAGG - Intergenic
1184688633 22:46107572-46107594 GCTGACGGGGAGTGAGCAGTCGG - Intronic
1185036007 22:48477258-48477280 GGTGATGGGGTGTGTGGAGTGGG - Intergenic
950375906 3:12572254-12572276 GCTGCTGGGGAGTGCCGGTTTGG + Exonic
950537045 3:13584699-13584721 GCAGATAGGGAGTGGGCAGTAGG + Intronic
950556494 3:13699208-13699230 GCTGACGGGGAGGGGCGAGGAGG - Intergenic
951487978 3:23235439-23235461 ATTGAGGGGGAGTGGGGAGTGGG + Intronic
953080187 3:39609263-39609285 GGTGATGGGGGGTGGCAAGATGG - Intergenic
954444476 3:50539480-50539502 GCTGACTGGGAGTGGGGAGGAGG + Intergenic
959693662 3:109226404-109226426 TCTGATGTGGAGTGGGAAGTAGG + Intergenic
960085993 3:113592128-113592150 GGGGATGGGGAGTGGGGAATGGG + Intronic
960993266 3:123325306-123325328 GCGGATGGTGAGTGGCTGGTGGG - Exonic
961173348 3:124814946-124814968 GCTGATGGGGAGTGGGGAGCAGG - Intronic
961219753 3:125190359-125190381 GCTGGTGGTGAGTGCTGAGTTGG - Exonic
962846601 3:139279266-139279288 GCTGATGAGGATTGGGCAGTTGG + Intronic
963075198 3:141339698-141339720 CCTGGCGTGGAGTGGCGAGTGGG + Intronic
964371565 3:156005331-156005353 GCTGTTGAGGAGAGGTGAGTAGG + Intergenic
965765784 3:172128563-172128585 GGGGCTGGGGAGTGGGGAGTTGG + Intronic
966441377 3:179948690-179948712 GCTGGTGGGGATTGGGGATTGGG - Intronic
968473186 4:791295-791317 GCTGATGGGGAGTGGGGGCCGGG - Intronic
968896515 4:3407128-3407150 GCTGAAGTGGAGTAGCGTGTTGG + Intronic
971273082 4:25170098-25170120 GGTGGTGGGGAGTGGAGAGGGGG - Intronic
973257540 4:48128379-48128401 GTTGATGGGCTGTGGTGAGTGGG + Intronic
977895400 4:102358888-102358910 TCTTCTGGGGAGTGGAGAGTGGG - Intronic
983490102 4:168378977-168378999 CGTTATGGGGAGTGGAGAGTAGG - Intronic
984702220 4:182825748-182825770 GGAGGTGGGGAGTGGGGAGTGGG - Intergenic
985942716 5:3151316-3151338 GCTGCTGGGGGGTTGGGAGTGGG - Intergenic
986619519 5:9657732-9657754 GCTGGCGGGGAGTGGGGAATGGG + Intronic
987317785 5:16740212-16740234 GCTGATGGGGATTTGGGAATTGG + Intronic
991955718 5:71994473-71994495 GCTAATGGGGAGTGGGAAGGAGG - Intergenic
992565656 5:77993122-77993144 GCAGGTGGGGAGTGTGGAGTTGG + Intergenic
993735845 5:91476385-91476407 CTGGATGGGCAGTGGCGAGTTGG + Intergenic
995127379 5:108591870-108591892 AAAGATGGGGAGTGGGGAGTTGG + Intergenic
997895681 5:137714613-137714635 GCTGATGGGGAGTGGTGGTAAGG + Intronic
998099443 5:139419751-139419773 GCTGGTGGGGAGAGGAGAGGGGG + Intronic
999552835 5:152708170-152708192 GCTGGTGGGGAGGGTCAAGTGGG - Intergenic
1001424879 5:171616403-171616425 GCTGTGGGGGAGGGGCGTGTGGG + Intergenic
1002105716 5:176878677-176878699 GCTGGTGGGGAGTTGGTAGTGGG - Intronic
1003948265 6:11094376-11094398 GCTGATGGTGTGCGGTGAGTGGG + Exonic
1004650099 6:17600335-17600357 GCTGTTGGGGAGGGGCCATTGGG + Exonic
1005990129 6:30897339-30897361 GCTGAAGAGGAATGCCGAGTGGG - Exonic
1006405726 6:33843678-33843700 TCTGATGGGGTTTGGCCAGTGGG + Intergenic
1006443001 6:34063640-34063662 GCTCATGGGGAGGGGGGAGAAGG + Intronic
1007107755 6:39295319-39295341 GCTGGTGGGGTGTGGGGAGCAGG + Intergenic
1007334802 6:41148044-41148066 CCTGCTGGGGAGTGGAGAGGTGG - Intergenic
1008368303 6:50707252-50707274 GCTGAGGGGGAGTGGGGCTTGGG + Intergenic
1008982054 6:57495712-57495734 GGTTATGGGGAGTGGAGTGTAGG - Intronic
1010777985 6:79908654-79908676 GCTGATTGGCTGTGGTGAGTAGG - Intergenic
1011844613 6:91547997-91548019 GCTGATGTGGAGTGGAGAGAGGG + Intergenic
1012811962 6:103970182-103970204 GTTGAAGAGTAGTGGCGAGTGGG - Intergenic
1013117748 6:107115381-107115403 GCTGAGGGGGAGGGGCGGGCCGG - Intergenic
1017685903 6:156913822-156913844 GTTGTTGGGAAGTGGAGAGTGGG - Intronic
1018231987 6:161683762-161683784 GCTGTTGGGGTGTGGTGAGACGG + Intronic
1018401057 6:163420506-163420528 AGGGATGGGGAGTGGTGAGTGGG + Intronic
1019500814 7:1363994-1364016 GGAGATGGGGAGTGAGGAGTGGG - Intergenic
1020368023 7:7401179-7401201 GCTGAGATGGAGTGGCCAGTGGG - Intronic
1020565340 7:9787837-9787859 GCTGATGGGGAATGTGGGGTTGG - Intergenic
1022171559 7:27836744-27836766 GCTGCTGTGCAGTGGCCAGTAGG - Intronic
1023620532 7:42067457-42067479 TCTGATGGGGAGTGGGGAGAGGG - Intronic
1025943385 7:66089210-66089232 GCTGATGGTGGGTGGCCAGGGGG + Intronic
1026867357 7:73831930-73831952 GCTGCTGGGGACTGGGGACTGGG + Exonic
1028669410 7:93384052-93384074 GCTGATTGGGAGGGTCTAGTTGG - Intergenic
1028849463 7:95520632-95520654 GGGGATGGGGGGTGGGGAGTGGG - Intronic
1029032974 7:97488360-97488382 GCACATGGGGAGTGGAGAATAGG - Intergenic
1030735838 7:113047655-113047677 GATGGTGGGGAGTGAGGAGTGGG - Intergenic
1030987463 7:116259368-116259390 GGTGGTGGGGAGTGGAGAGGTGG - Intergenic
1031484057 7:122307281-122307303 GCTGCTGGGAAGTGGCAGGTAGG - Intronic
1032182443 7:129691956-129691978 ACAGATGTGGAGTGGAGAGTAGG - Intronic
1033278825 7:139991687-139991709 GAAGATGGGGAGTGGTGACTTGG + Intronic
1034448354 7:151124734-151124756 GCTTGTGGGGAGGGGCCAGTCGG + Intronic
1035490535 7:159272641-159272663 ATTGATGGGGAGCGGCAAGTGGG - Intergenic
1036074045 8:5474892-5474914 GCTGAGTAGGAGTGGAGAGTGGG - Intergenic
1036564437 8:9926329-9926351 GCCCATGGGGAATGGCGAGGAGG - Intergenic
1037118852 8:15258687-15258709 TCTGATAGAGAGTGGAGAGTTGG - Intergenic
1039442800 8:37607050-37607072 GGTGATAGGGAGTGGGGAGCGGG + Intergenic
1039884166 8:41646029-41646051 GCTGTTGGGGCGGGGGGAGTGGG - Exonic
1040904622 8:52453652-52453674 GCTGGTGGGGAGTGGAGATGGGG - Intronic
1041019633 8:53625783-53625805 GCTGCCTGGGAGTGGGGAGTTGG + Intergenic
1042560500 8:70069936-70069958 GCTGGTGGGGAGGCGCGGGTCGG - Intronic
1042887427 8:73567848-73567870 GCTGGGGGGGAGGGGGGAGTTGG + Intronic
1042965992 8:74352528-74352550 GATGGTGGGCAGTGGCGAGGGGG + Intronic
1045397966 8:101780558-101780580 GCTGATGGGGAGGGGTGAATAGG + Intronic
1045502073 8:102751335-102751357 GCTGATGGGAAGTGGGGAAAGGG - Intergenic
1046443513 8:114285988-114286010 GCTGGTGGTGTGTGGCGATTAGG - Intergenic
1047202954 8:122781833-122781855 CCCGGTGGGGAGTGGGGAGTGGG + Exonic
1047992676 8:130302659-130302681 GCTGAGGGGGAGGGGCACGTGGG + Intronic
1048028920 8:130612814-130612836 GCTGAAGGGAAGGGGCAAGTAGG + Intergenic
1049193467 8:141302341-141302363 GGTGATGGTGAGTGGCGTGGAGG - Intronic
1049954247 9:677371-677393 GCTGCTTGGGAGTGGCTACTAGG - Intronic
1050133606 9:2439216-2439238 GCTGTGGGGGATTGGGGAGTGGG + Intergenic
1051621070 9:19049692-19049714 GCTGATGGGGAAGAGCGGGTCGG + Exonic
1052164816 9:25312296-25312318 GGTGATGGGGAGGGGCTTGTTGG + Intergenic
1053186562 9:36021508-36021530 GCTGATGGGGAATGAGGAGGAGG + Intergenic
1056940807 9:90954467-90954489 GCTGAGGTGGAGTGGAGAATAGG + Intergenic
1059016306 9:110519705-110519727 CCTGATGGAGAGTGGAGGGTGGG + Intronic
1059751968 9:117256134-117256156 GATGATGCGGAATGGGGAGTGGG + Intronic
1060400319 9:123344754-123344776 GCTGCTGGGGAGAGGGGAGGAGG + Intergenic
1060881889 9:127123126-127123148 GCTGATGGGGAGAGGCGCTCTGG - Intronic
1061780849 9:132995259-132995281 GCTGACGGGAAGTGGAGAATTGG - Intergenic
1061895172 9:133643352-133643374 GCTGCTGGGGAGGGGAGGGTGGG + Intronic
1185518760 X:720825-720847 GATGATGGGGAGTGGCCACTTGG - Intergenic
1185702522 X:2242034-2242056 GCGGAAGGGGAGTGGGGAATTGG - Intronic
1186869535 X:13756958-13756980 GCTGATTGGGTTTGGCCAGTGGG + Intronic
1187319241 X:18225866-18225888 GTTGTTGGGGAGTGGGGGGTAGG - Intergenic
1188077495 X:25796695-25796717 GCTGAAGGGAAGTGGTGAGAGGG - Intergenic
1189239524 X:39515017-39515039 GGGGATGGGGAGCTGCGAGTGGG - Intergenic
1190120965 X:47658933-47658955 GCTCCTGGGGAGTGGGGAGGGGG + Exonic
1190225498 X:48541454-48541476 GATGCTGGGGACTGGCCAGTGGG + Intronic
1191948521 X:66562481-66562503 ACTGTTGGGGAGTGGGGGGTGGG + Intergenic
1192180888 X:68914848-68914870 GCTGCTGAGGAGCTGCGAGTGGG + Intergenic
1197655365 X:129110910-129110932 GATGATGGGGAGTGGGGCGGGGG + Intergenic
1198178063 X:134174557-134174579 GGAGATGGGGGGTGGCGAATAGG - Intergenic
1200145133 X:153922439-153922461 GGTGATTGGGAGTGGGAAGTGGG - Intronic
1201062920 Y:10064275-10064297 GCAGATGGAGAGAGGGGAGTGGG + Intergenic
1201789680 Y:17825733-17825755 GCTGATTGGGTTTGGCTAGTGGG + Intergenic
1201811874 Y:18080256-18080278 GCTGATTGGGTTTGGCTAGTGGG - Intergenic
1201848718 Y:18452712-18452734 GCTGATTGGGTTTGGCCAGTGGG - Intergenic
1201884599 Y:18867663-18867685 GCTGATTGGGTTTGGCCAGTGGG + Intergenic
1202351331 Y:23995482-23995504 GCTGATTGGGTTTGGCTAGTGGG + Intergenic
1202519448 Y:25674637-25674659 GCTGATTGGGTTTGGCTAGTGGG - Intergenic