ID: 1131507142

View in Genome Browser
Species Human (GRCh38)
Location 15:93029068-93029090
Sequence CTGTTGGCGCTGACTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131507142_1131507151 29 Left 1131507142 15:93029068-93029090 CCCTCCTCAGTCAGCGCCAACAG No data
Right 1131507151 15:93029120-93029142 GCAGTTTGCCAGACCAGAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131507142 Original CRISPR CTGTTGGCGCTGACTGAGGA GGG (reversed) Intergenic
No off target data available for this crispr