ID: 1131507154

View in Genome Browser
Species Human (GRCh38)
Location 15:93029140-93029162
Sequence CGGCTCCAGATTCCAACCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131507148_1131507154 7 Left 1131507148 15:93029110-93029132 CCAAGTCCCTGCAGTTTGCCAGA No data
Right 1131507154 15:93029140-93029162 CGGCTCCAGATTCCAACCTGTGG No data
1131507150_1131507154 0 Left 1131507150 15:93029117-93029139 CCTGCAGTTTGCCAGACCAGAGT No data
Right 1131507154 15:93029140-93029162 CGGCTCCAGATTCCAACCTGTGG No data
1131507147_1131507154 8 Left 1131507147 15:93029109-93029131 CCCAAGTCCCTGCAGTTTGCCAG No data
Right 1131507154 15:93029140-93029162 CGGCTCCAGATTCCAACCTGTGG No data
1131507149_1131507154 1 Left 1131507149 15:93029116-93029138 CCCTGCAGTTTGCCAGACCAGAG No data
Right 1131507154 15:93029140-93029162 CGGCTCCAGATTCCAACCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131507154 Original CRISPR CGGCTCCAGATTCCAACCTG TGG Intergenic
No off target data available for this crispr