ID: 1131507661

View in Genome Browser
Species Human (GRCh38)
Location 15:93031436-93031458
Sequence CCAGGTGCTCAGCGGGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131507661_1131507668 10 Left 1131507661 15:93031436-93031458 CCATCTGCCCGCTGAGCACCTGG No data
Right 1131507668 15:93031469-93031491 GAATCAATTCCGGCCATCTCTGG No data
1131507661_1131507667 0 Left 1131507661 15:93031436-93031458 CCATCTGCCCGCTGAGCACCTGG No data
Right 1131507667 15:93031459-93031481 TGGTCTTCAAGAATCAATTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131507661 Original CRISPR CCAGGTGCTCAGCGGGCAGA TGG (reversed) Intergenic
No off target data available for this crispr