ID: 1131508111

View in Genome Browser
Species Human (GRCh38)
Location 15:93033756-93033778
Sequence CTGGAGGACCACAGTAATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131508111_1131508124 30 Left 1131508111 15:93033756-93033778 CCCTCATTACTGTGGTCCTCCAG No data
Right 1131508124 15:93033809-93033831 ATGCTTGGTGATCTGGCCGGAGG No data
1131508111_1131508123 27 Left 1131508111 15:93033756-93033778 CCCTCATTACTGTGGTCCTCCAG No data
Right 1131508123 15:93033806-93033828 CTAATGCTTGGTGATCTGGCCGG No data
1131508111_1131508117 -1 Left 1131508111 15:93033756-93033778 CCCTCATTACTGTGGTCCTCCAG No data
Right 1131508117 15:93033778-93033800 GGGTATACGCATCCTCAGCAAGG No data
1131508111_1131508122 23 Left 1131508111 15:93033756-93033778 CCCTCATTACTGTGGTCCTCCAG No data
Right 1131508122 15:93033802-93033824 CTGGCTAATGCTTGGTGATCTGG No data
1131508111_1131508120 15 Left 1131508111 15:93033756-93033778 CCCTCATTACTGTGGTCCTCCAG No data
Right 1131508120 15:93033794-93033816 AGCAAGGCCTGGCTAATGCTTGG No data
1131508111_1131508118 4 Left 1131508111 15:93033756-93033778 CCCTCATTACTGTGGTCCTCCAG No data
Right 1131508118 15:93033783-93033805 TACGCATCCTCAGCAAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131508111 Original CRISPR CTGGAGGACCACAGTAATGA GGG (reversed) Intergenic
No off target data available for this crispr