ID: 1131508574

View in Genome Browser
Species Human (GRCh38)
Location 15:93036487-93036509
Sequence GGCCGGGACCACCAGGGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 247}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131508574_1131508579 -6 Left 1131508574 15:93036487-93036509 CCTGGTCCCTGGTGGTCCCGGCC 0: 1
1: 0
2: 0
3: 29
4: 247
Right 1131508579 15:93036504-93036526 CCGGCCCCAGCCTTGACCTGAGG 0: 1
1: 0
2: 6
3: 112
4: 567
1131508574_1131508580 -5 Left 1131508574 15:93036487-93036509 CCTGGTCCCTGGTGGTCCCGGCC 0: 1
1: 0
2: 0
3: 29
4: 247
Right 1131508580 15:93036505-93036527 CGGCCCCAGCCTTGACCTGAGGG 0: 1
1: 0
2: 0
3: 13
4: 265
1131508574_1131508585 6 Left 1131508574 15:93036487-93036509 CCTGGTCCCTGGTGGTCCCGGCC 0: 1
1: 0
2: 0
3: 29
4: 247
Right 1131508585 15:93036516-93036538 TTGACCTGAGGGCCACTCAGCGG 0: 1
1: 0
2: 0
3: 7
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131508574 Original CRISPR GGCCGGGACCACCAGGGACC AGG (reversed) Intronic
900178070 1:1299417-1299439 GGACGGGTCCACCAGTCACCAGG - Intronic
900178079 1:1299446-1299468 GGACGGGTCCACCAGTCACCAGG - Intronic
900589007 1:3451249-3451271 GCCAGGGACCAACAGCGACCAGG - Intergenic
902955109 1:19920266-19920288 AGGCGGGACCTCCAGGGACGGGG + Exonic
904834398 1:33325443-33325465 GCCGGGGACCACCAGGGCCTTGG - Intronic
907439719 1:54471724-54471746 GGGTGGTACCACCAGGGACGGGG - Intergenic
908592831 1:65652008-65652030 GGCCTAAACCACCAGGGCCCTGG + Intergenic
908780632 1:67686270-67686292 GGCGGCGACCCCCAGGGACCCGG + Intronic
910839308 1:91546442-91546464 GGCCGGGACTGCCAGGGACTCGG - Intergenic
910935481 1:92482817-92482839 GGGCGGGAGCTGCAGGGACCCGG - Intronic
910936102 1:92485441-92485463 GGCTGGCGCCACCAGAGACCAGG + Intronic
912468730 1:109892268-109892290 GGCCAAGAACTCCAGGGACCAGG + Intergenic
913454447 1:119016656-119016678 GGCCGGGCCCAACAGGCCCCTGG - Intergenic
919764230 1:201115765-201115787 GGCCGCGAGGACCAAGGACCAGG - Exonic
920054072 1:203180253-203180275 GGCCTGCACCACTAGGCACCTGG - Intronic
921072714 1:211675545-211675567 GACCAGGAACTCCAGGGACCTGG + Exonic
922666492 1:227473916-227473938 TGCCTACACCACCAGGGACCTGG + Intergenic
924087189 1:240464694-240464716 GCCCCGGACCCCCAGGGAGCTGG + Intronic
1063122960 10:3117569-3117591 GGCTGGGAGTACCAGGGTCCTGG - Intronic
1066007244 10:31156599-31156621 GGTCTGGACCACCTGGGACCTGG + Intergenic
1067162209 10:43836668-43836690 GGCCTATACCACCAGGGCCCTGG - Intergenic
1067251968 10:44594152-44594174 AGCCTACACCACCAGGGACCCGG + Intergenic
1067808718 10:49410600-49410622 GGCTGGGAGCACCCGGGAGCTGG - Intergenic
1071695432 10:87864101-87864123 GGCTGGCACATCCAGGGACCCGG + Exonic
1073398276 10:103236301-103236323 GACAGGGACCACAAGGGAGCAGG + Intergenic
1073930244 10:108566834-108566856 GGGCGGGCCCAGCAAGGACCTGG + Intergenic
1075508809 10:123052026-123052048 GGGAGGAAGCACCAGGGACCAGG - Intronic
1077186938 11:1239629-1239651 GGCGGGGATCCCCAGGGACGCGG + Intronic
1077207278 11:1350588-1350610 GGCTGGGACCACAAGAGGCCAGG + Intergenic
1077410096 11:2399931-2399953 GCCCGGGAGGACCGGGGACCTGG + Intergenic
1077487584 11:2846130-2846152 GGCCGGGCGCATGAGGGACCAGG + Intronic
1077729833 11:4718653-4718675 GCCCAGGAACACCAGGGAGCAGG - Intronic
1081285873 11:41269539-41269561 GCCCTGGACCACCAGGGAGAAGG + Intronic
1082811881 11:57483216-57483238 TGCCGGGCACACCAAGGACCTGG + Intergenic
1082872182 11:57953648-57953670 TGCCTACACCACCAGGGACCTGG - Intergenic
1083808263 11:65087874-65087896 CGCGGGGGCCACCAGGGACTGGG + Intronic
1084189901 11:67494159-67494181 GGGCACAACCACCAGGGACCAGG + Intronic
1087038065 11:93773776-93773798 GCCCGGGCCCAGCAAGGACCTGG - Intronic
1089195923 11:116693993-116694015 AGGCGGGAACACCAGGGCCCTGG + Intergenic
1089286742 11:117412281-117412303 TGCAGGAGCCACCAGGGACCAGG + Exonic
1089378420 11:118011251-118011273 GGCCAGGGCCACCTGGGTCCTGG + Intergenic
1089700928 11:120243324-120243346 GTCCTGGACCTCCTGGGACCAGG - Intronic
1090629332 11:128632727-128632749 GGTGGGGACTCCCAGGGACCAGG + Intergenic
1097891489 12:64781292-64781314 GGCCGGGCGCAGCAGGGTCCCGG + Intronic
1103091814 12:118103479-118103501 GGCTGGGGCCACCACGGATCCGG + Intronic
1103341366 12:120222822-120222844 GGCAGGGTCTACCAGGGCCCAGG - Intronic
1103839062 12:123848014-123848036 AACCGAGACCACCAAGGACCTGG + Exonic
1105069858 12:133227784-133227806 GGCAGGGACCCCCTGGGTCCTGG + Intronic
1105253852 13:18726659-18726681 GGACGGGACCACACGGGACCGGG - Intergenic
1105280955 13:18962345-18962367 GGCCGGCCCCTCTAGGGACCTGG - Intergenic
1106378855 13:29216488-29216510 TGCCTGCACCACCAGGGCCCTGG - Intronic
1107804526 13:44141729-44141751 CGTCGGGACCTCCGGGGACCTGG - Intergenic
1108508857 13:51136753-51136775 GGCCAGGACCCCCAGGAGCCTGG + Intergenic
1110436180 13:75481031-75481053 GGCCGGCTACAGCAGGGACCCGG - Intronic
1111204196 13:84983168-84983190 GGCAGGGACCTCCAAGTACCAGG + Intergenic
1112344111 13:98576571-98576593 GGCAGGGACGCCCAGGGACTCGG + Intronic
1114043307 14:18700044-18700066 GACCGGGAGCTCCAGGGACCTGG + Intergenic
1114047598 14:18890490-18890512 GACCGGGAGCTCCAGGGACCTGG + Intergenic
1114114925 14:19511155-19511177 GACCGGGAGCTCCAGGGACCTGG - Intergenic
1114116615 14:19628918-19628940 GACCGGGAGCTCCAGGGACCTGG - Intergenic
1114635528 14:24184799-24184821 GGCAGGGACCACCAGCCACAGGG + Intronic
1114744939 14:25136749-25136771 TGCCTGTGCCACCAGGGACCTGG + Intergenic
1121047573 14:90799283-90799305 GGCCTGGGCCATCAGGGTCCTGG + Intronic
1121718559 14:96093308-96093330 CTCTGGGACCTCCAGGGACCTGG + Exonic
1122697303 14:103562399-103562421 GGCCGGAGACACCAGAGACCAGG + Intronic
1128067991 15:64775988-64776010 GGCAGGGCCGCCCAGGGACCGGG - Intergenic
1128477973 15:68013533-68013555 GGCAGTGACCAACATGGACCCGG + Intergenic
1128725894 15:69988460-69988482 AGCCAGGACCAACAAGGACCTGG + Intergenic
1129397366 15:75259141-75259163 GGCTGGCACCTCCAAGGACCTGG + Intronic
1131273307 15:90959946-90959968 GGCCCTGCCCACCAGGAACCTGG + Exonic
1131508574 15:93036487-93036509 GGCCGGGACCACCAGGGACCAGG - Intronic
1131578296 15:93614313-93614335 GGCAGGGACCTCCGGGGGCCCGG - Intergenic
1132718820 16:1306018-1306040 GGGCGGGACCTCCAGTGCCCTGG - Intergenic
1132879391 16:2155216-2155238 GGCCTGGACGCCCAGGGACCTGG + Intergenic
1132947182 16:2538115-2538137 GGCCAGGACCACCAGCCAGCTGG + Exonic
1133335781 16:5005965-5005987 GGCAGCAACTACCAGGGACCCGG + Exonic
1134409423 16:13991664-13991686 GGAGGGGACCACCAGAGTCCTGG - Intergenic
1134997530 16:18751311-18751333 GGCTGGGACCACCAGAGGTCTGG - Intergenic
1137249680 16:46732533-46732555 AGCAGGGCCCACCTGGGACCGGG - Exonic
1137296271 16:47097050-47097072 TGCCTACACCACCAGGGACCTGG + Intronic
1138389121 16:56657666-56657688 GGCCAGGATCTCCAGGTACCCGG + Intronic
1139279232 16:65755589-65755611 GGCCGGGAGCGCCAGAGACCGGG + Intergenic
1139549695 16:67666572-67666594 GGCGGGGACCGGCAGGGGCCCGG - Exonic
1139955945 16:70693051-70693073 GGCCAGGACCACCTGGGACTTGG + Intronic
1141797730 16:86286390-86286412 GCCCTGGACCACCAGGGCGCAGG - Intergenic
1142145872 16:88492757-88492779 GTCTGGGACCACCAGGGACAGGG - Intronic
1142152028 16:88516878-88516900 GGCCGGGATGAACAGGGACAGGG + Intronic
1142366449 16:89652476-89652498 GGCCAGGGCCACCTGGTACCAGG - Intronic
1142366470 16:89652553-89652575 GGCCAGGGCCACCTGGTACCAGG - Intronic
1142799466 17:2336498-2336520 GGGCGGGCCCTCCAGGGAGCGGG + Exonic
1143359608 17:6358297-6358319 GGCCTGGACCACCAGGCTTCTGG - Intergenic
1143508259 17:7381290-7381312 GGCCGGGTCCCCCAGGGTCCTGG + Intronic
1143582226 17:7834172-7834194 GGGCGGGACCACAAGGGGGCGGG + Intergenic
1143765516 17:9135120-9135142 GGCCGGGAGCATCAGGGGCTGGG - Intronic
1144075942 17:11719409-11719431 GACCGAGACCACCAAGGACCTGG + Exonic
1146678385 17:34789585-34789607 GCCAGGGGCCACAAGGGACCAGG + Intergenic
1150695193 17:67398659-67398681 AGCAGCGACCACCAGTGACCGGG + Intronic
1151363213 17:73600882-73600904 GTCTGGGCCCACCAGGGAACAGG + Intronic
1151816067 17:76472041-76472063 GGCCGGGCCCACCTGGGGCGGGG + Exonic
1151854401 17:76710784-76710806 GGCCGAGGCCACCGGGGCCCCGG - Exonic
1152653887 17:81510989-81511011 GGGCGGCACCACCATGTACCCGG - Exonic
1152920914 17:83066219-83066241 GGCCAGGGCCTCCAGGCACCAGG - Intergenic
1153265199 18:3262446-3262468 GGCCCGGACGTCCAGGGGCCGGG + Exonic
1153942679 18:9991229-9991251 GGCCGGGATCGCCAGGAACCTGG - Intergenic
1155002906 18:21704308-21704330 GGCCGGGACCCCCAGGGGGCGGG + Intronic
1159384958 18:67711112-67711134 GGCAGGAAACACCATGGACCTGG - Intergenic
1160677123 19:397412-397434 GGCAGGGACCAGGAGGGACGAGG - Intergenic
1160760713 19:782743-782765 CGCCGGGGCCACCCTGGACCCGG + Intergenic
1160810384 19:1010632-1010654 TGCCGCGGCCACCAGGGAGCTGG + Exonic
1161057122 19:2196204-2196226 GGTCGGGGCCACCAGGGATCGGG - Intronic
1161175821 19:2841702-2841724 GGGCGGGACCCCCGGGGCCCAGG - Intronic
1161937030 19:7378474-7378496 GGGAGGGACCCCCAGGGAACAGG + Intronic
1162492732 19:11003501-11003523 GGCAGGGAACAGCAGGGCCCAGG + Intronic
1162534047 19:11252865-11252887 GCCCGGGCCCCTCAGGGACCTGG - Exonic
1162976034 19:14207338-14207360 GGCCCGGAACTCCCGGGACCTGG + Intergenic
1164982659 19:32626003-32626025 GGCCGGGCCTCCCAGGGAGCCGG - Intronic
1165778712 19:38419991-38420013 GGCCAGGGCCACCAGGGCTCAGG + Exonic
1165899195 19:39160914-39160936 AGCCGGGACCACTGGGGAACAGG + Intronic
1166104438 19:40590412-40590434 GGCAGGGAGTACCAGGGGCCTGG - Exonic
1166294619 19:41883033-41883055 GGCCGGTGCCCGCAGGGACCCGG + Intergenic
1166372490 19:42309959-42309981 GGCCCGAACCTCCAGGCACCTGG - Exonic
1166745014 19:45137553-45137575 GCCTGGGAACACCCGGGACCAGG + Intronic
1168254246 19:55157250-55157272 GGCTGGGACCCCCAGGGCCAGGG - Intronic
1168686287 19:58351365-58351387 AGCCGGGGCCAGCAGGGACAGGG - Intronic
924962104 2:45216-45238 GGCCTGGACCAGCAGGTGCCTGG + Intronic
925029100 2:636165-636187 GTCCGGGGCCACCTGGGACCGGG - Intergenic
925048418 2:791895-791917 GGCACAGACCACCAGTGACCAGG + Intergenic
926220400 2:10932339-10932361 GGCTGGGACCTGCAGAGACCTGG + Intergenic
928174429 2:29024338-29024360 GGTGAGGACCACCAGGGAGCGGG - Exonic
930476701 2:51891486-51891508 TGCCTGTACCACCAGGGCCCTGG - Intergenic
933759356 2:85663402-85663424 GGCCGGGAACAGCAGCGAGCAGG - Exonic
934710020 2:96508575-96508597 GGCAGGGCCCACGAGGGACCGGG - Intergenic
935325791 2:101935695-101935717 TGCCTGCACCACCAGGGCCCTGG + Intergenic
935593541 2:104862599-104862621 TGCCGGGCCGAGCAGGGACCCGG - Intergenic
937231223 2:120399149-120399171 GGCCAGGACATCCAGGGCCCTGG + Intergenic
938424970 2:131179012-131179034 GACCGGGAGCTCCAGGGACCTGG + Intronic
939385189 2:141486912-141486934 GGCCGGGACCACAGAGGCCCTGG - Intronic
941104909 2:161341164-161341186 GGCCGAGGCCACCGGGGCCCCGG - Intronic
945660899 2:212683985-212684007 GGAAGGGACCAACAGGGACCAGG + Intergenic
947472673 2:230413006-230413028 GGCGGGGACCGGAAGGGACCGGG + Intergenic
947564280 2:231184168-231184190 AGCCGGCACCACCAGGCTCCAGG - Intergenic
947815607 2:233034426-233034448 GGCGGGCACCACCAGGCTCCGGG - Exonic
948809843 2:240468919-240468941 GACCGTGGCTACCAGGGACCTGG - Intergenic
948852763 2:240716486-240716508 GGCGGGGACCAGGAGGGAGCGGG - Exonic
949035693 2:241814845-241814867 GACCAGGACGTCCAGGGACCTGG - Intronic
1168799144 20:633481-633503 GGCCTGGCCCAGCAGGGAGCTGG - Intergenic
1168904604 20:1393039-1393061 GGCGTGGACCAACAGCGACCTGG + Exonic
1168938747 20:1690941-1690963 TGCCTAGACCACCAGGGCCCTGG + Intergenic
1170631532 20:18070624-18070646 GGGCTCGACCACCAGGAACCTGG - Intergenic
1172468619 20:35175044-35175066 GGCTGGGACTTGCAGGGACCCGG + Intronic
1173166374 20:40689479-40689501 GGCCGGGACCTGCAGGGTACGGG - Intergenic
1173225457 20:41159990-41160012 GGCTGGGAGCATTAGGGACCAGG + Intronic
1174451769 20:50624981-50625003 GGCCAGCACCGCCAGGCACCTGG - Intronic
1175298155 20:57923491-57923513 CGCCAGGACCACCAAAGACCGGG - Intergenic
1175331501 20:58167964-58167986 GGCCGGCCCCACCAGAGGCCTGG + Intergenic
1175985323 20:62761547-62761569 GGCCGGGACCAGCCAGGAGCTGG + Exonic
1176068823 20:63215748-63215770 GGCCGGGCCCAGGCGGGACCGGG - Intronic
1176247026 20:64102280-64102302 GGCCGGGCTCTCCTGGGACCAGG + Intergenic
1176276310 20:64271842-64271864 GGCCGGGACCCCGAGGGCCTCGG + Intronic
1176839360 21:13826654-13826676 GGACGGGACCACACGGGACCGGG - Intergenic
1179595288 21:42438951-42438973 AGCCGGGGCCACGAGGGGCCGGG + Intronic
1179713311 21:43275207-43275229 GCCCGGGACATCCAGGCACCAGG + Intergenic
1179833572 21:44012906-44012928 GGCCGGGGCCCCCAGGTCCCGGG - Intronic
1179916305 21:44480391-44480413 TGCAGAGACCATCAGGGACCTGG - Intergenic
1180161965 21:46002146-46002168 GGCCGAGCCCACCTGGGATCAGG - Intronic
1180466129 22:15613161-15613183 GACCGGGAGCTCCAGGGACCTGG + Intergenic
1180864085 22:19105907-19105929 AGCCGGGACCCCCAAGAACCTGG - Intronic
1181498666 22:23302768-23302790 AGCCTGGACCTCCAGGGACCAGG + Intronic
1182296435 22:29313241-29313263 GACTGGGACAATCAGGGACCTGG - Exonic
1183628779 22:39020819-39020841 GGGCGGGACCACCAGGGGAGGGG + Intronic
1183632257 22:39040578-39040600 GGGCGGGACCACCAGGGGAGGGG + Intergenic
1183638079 22:39076979-39077001 GGGCGGGACCACCAGGGGAGGGG + Intronic
1183966812 22:41447119-41447141 GCCGGGGACCACCTGGGGCCGGG + Intergenic
1184021621 22:41825368-41825390 GGCTGAGACCACCACAGACCCGG - Intronic
1184361918 22:44024168-44024190 GGCCGGGACCAGCAGGCCTCGGG + Intronic
1185347021 22:50314910-50314932 GGCCGGAAGCACCTGGGGCCGGG + Exonic
951613910 3:24521697-24521719 GGCCGCGACCACGGTGGACCCGG - Intergenic
954490661 3:50901584-50901606 TGCCTACACCACCAGGGACCTGG - Intronic
954681973 3:52350745-52350767 GGCCGGGACCAGCCAGGGCCAGG + Intronic
961669600 3:128519270-128519292 AGCCGAGACAACCAGGGAACAGG + Intergenic
961752240 3:129103490-129103512 GGCAGGGAACACCAAGGACAAGG - Intronic
962472629 3:135725877-135725899 GGCAGGGAACAACAGAGACCAGG - Intergenic
962630308 3:137269263-137269285 GGCCAGGCCAGCCAGGGACCAGG - Intergenic
962821012 3:139047289-139047311 GGCCGGGGTAACCAGGGTCCAGG + Intronic
963014013 3:140803399-140803421 TGCCTGTACCACCAGGGCCCTGG - Intergenic
964732570 3:159883008-159883030 GGCAGGGAGCACCAGGGGTCTGG - Intronic
965880406 3:173382178-173382200 GGCCTACACCACCAGGGCCCTGG + Intergenic
966309361 3:178576369-178576391 TGCCTATACCACCAGGGACCGGG + Intronic
967858241 3:194134240-194134262 GGCCGGGAGCGCCAGGGCTCTGG - Intergenic
968443643 4:636948-636970 GGCCGTGGGAACCAGGGACCAGG + Intronic
968471433 4:784444-784466 GGGCGGGACCGCCAGCAACCAGG + Intergenic
968508055 4:981172-981194 CGCCGGGACCTCCACTGACCAGG + Intronic
968508978 4:987140-987162 GGCCGGGGCCACCGGGGGCGCGG - Exonic
969683361 4:8655668-8655690 GGCCGGCACCAGCAGGGCCCAGG - Intergenic
973773529 4:54226798-54226820 CTCCGGGACCACCCAGGACCCGG + Intronic
975213014 4:71722798-71722820 GAGCTAGACCACCAGGGACCTGG - Intergenic
977897863 4:102384437-102384459 TGCCTACACCACCAGGGACCTGG - Intronic
979468791 4:121071649-121071671 GGCGGGGAAGACCTGGGACCCGG - Intronic
981885288 4:149666454-149666476 TGCCTGCACCACCAGGGCCCTGG + Intergenic
985141091 4:186840940-186840962 GGCAGGGACCCCCAGGGAACAGG - Intergenic
985247888 4:187995537-187995559 GCCCGGGGCCCCCAGGCACCCGG - Intergenic
985317366 4:188672501-188672523 AGCCTGCACCACCAGGGCCCTGG + Intergenic
985727595 5:1524109-1524131 GGCCGGGGCCGCTGGGGACCGGG + Intergenic
992396714 5:76375287-76375309 GGCCTGGACCTGCTGGGACCAGG - Intergenic
992460257 5:76953794-76953816 GGCCGGAACCGCCAGGGGCGCGG + Intronic
993255765 5:85588353-85588375 TGCCTACACCACCAGGGACCTGG - Intergenic
993381902 5:87217981-87218003 TGCCTGCACCACCAGGGCCCTGG - Intergenic
997435292 5:133869715-133869737 GGTCAGGACCAGGAGGGACCTGG - Intergenic
997582083 5:135024475-135024497 GGCAGGGACCAGCAGGGGCTGGG + Intergenic
998094725 5:139390767-139390789 GGCAGGGACTGCTAGGGACCTGG + Exonic
998404956 5:141869075-141869097 TGCAGGGATCACCAGGGAGCTGG + Exonic
1002451580 5:179321877-179321899 GGCCGGGATCTCCAGGCACTTGG - Intronic
1002579482 5:180199028-180199050 GGCTGAGACCACTAGGGGCCTGG - Intronic
1003313983 6:4994804-4994826 GGCCAGGATGTCCAGGGACCGGG - Exonic
1003527391 6:6909645-6909667 AGCCAGCACCACCTGGGACCCGG - Intergenic
1006672514 6:35738204-35738226 GGCCGTAACCCCCAGGGGCCAGG - Intronic
1007581127 6:42960790-42960812 GGCCGCCACCCCCAGGGAGCGGG - Exonic
1015108867 6:129569004-129569026 TGCCTACACCACCAGGGACCTGG + Intergenic
1016254535 6:142088538-142088560 GGACGGGACCACCACGGAGTTGG - Exonic
1016986166 6:149897558-149897580 GGCCGGGACCTCAAGGCAGCTGG - Intronic
1017497520 6:154995179-154995201 GTCCGGGACCAGCCGGGAGCTGG + Intronic
1017950384 6:159130760-159130782 GGTCAGCACCACCTGGGACCTGG + Intergenic
1019658685 7:2211489-2211511 GGCCGGGCCCATCAGGCACGTGG + Intronic
1022345266 7:29508581-29508603 TGCCAGGACCACTAGGGCCCCGG - Intronic
1022809309 7:33853216-33853238 GGCTGGGACCCCCATGGACCTGG - Intergenic
1025192519 7:56906918-56906940 GGCAGGGACCCTTAGGGACCTGG - Intergenic
1025679427 7:63670004-63670026 GGCAGGGACCCTTAGGGACCTGG + Intergenic
1027116555 7:75486050-75486072 GGCCGGGAGCCCCAGGGAGGCGG - Exonic
1027320473 7:77006914-77006936 GGCCGGGACCACCCTGGGCAGGG - Intergenic
1028808318 7:95054632-95054654 GGCAGGGACAAGCAGGGACCAGG - Intronic
1028984108 7:96996684-96996706 GGCCGGGGCTGCCTGGGACCTGG - Intergenic
1029987688 7:104936765-104936787 GGCCGGAAGCACCTGGGGCCTGG - Intergenic
1030705674 7:112690276-112690298 TGCCTACACCACCAGGGACCTGG - Intergenic
1034241967 7:149617660-149617682 GCCCAGGCCCACCAGGGACAGGG - Intergenic
1034495156 7:151416465-151416487 GGCAGTGACCAACAGAGACCAGG - Intergenic
1035271042 7:157720144-157720166 GCATGGCACCACCAGGGACCAGG + Intronic
1035402461 7:158576466-158576488 AGCCTGCACCACCAGGGACATGG + Intronic
1035754743 8:2022870-2022892 AGCAGGGACCACGAGTGACCTGG + Intergenic
1036789495 8:11708653-11708675 GGCGGCGGCCGCCAGGGACCCGG - Exonic
1038583407 8:28769581-28769603 GGCCAGGACAAAGAGGGACCCGG - Intronic
1045975146 8:108123139-108123161 TGCCTGTACCACCAGGGCCCTGG - Intergenic
1048828523 8:138453483-138453505 GTCCGGGACCAGCAGGGAATGGG - Intronic
1048978053 8:139684068-139684090 GTCCAGGACCACCTGGGACCTGG - Intronic
1049368485 8:142252310-142252332 GGCCGGGCCCCCCCGGTACCAGG + Intronic
1049444178 8:142622457-142622479 GGCCGGGACCTCTTGGGACAGGG - Intergenic
1049466562 8:142753592-142753614 GGCCTTGACCGCCAGGGCCCAGG - Intergenic
1049522821 8:143103074-143103096 GGCCTGGACAACCAGGGTCTGGG - Intergenic
1051452019 9:17207467-17207489 TGCTGACACCACCAGGGACCTGG - Intronic
1051760098 9:20453416-20453438 GGCATGCACCACCACGGACCCGG - Intronic
1053608209 9:39681503-39681525 TGCCTGCACCACCAGGGCCCTGG - Intergenic
1053866049 9:42437863-42437885 TGCCTGCACCACCAGGGCCCTGG - Intergenic
1054245322 9:62660906-62660928 TGCCTGCACCACCAGGGCCCTGG + Intergenic
1054559450 9:66695437-66695459 TGCCTGCACCACCAGGGCCCTGG + Intergenic
1054808118 9:69412430-69412452 GGCTGGGACCCCCAGGATCCCGG + Intergenic
1056003573 9:82243116-82243138 TGCCTACACCACCAGGGACCTGG - Intergenic
1056732568 9:89178487-89178509 GGCCGGCACCAGCAGCGCCCGGG - Exonic
1057271898 9:93656212-93656234 GGCCGGCTCCTCAAGGGACCTGG + Intronic
1058072926 9:100619724-100619746 TGCCTAGACCACCAGGGGCCTGG - Intergenic
1059657155 9:116367534-116367556 AGCTGAGTCCACCAGGGACCAGG + Intronic
1061133640 9:128721566-128721588 AGCCAGGACTCCCAGGGACCCGG - Intronic
1062138384 9:134941969-134941991 GGCCGTGACCCACATGGACCTGG + Intergenic
1062392520 9:136339625-136339647 GGCCGTGACCACCAGGGGAGGGG + Intronic
1062502226 9:136856494-136856516 GGCCCTGACCAGCAGGGAGCTGG + Intronic
1186370063 X:8937504-8937526 GGCCTACACCACCAGGGCCCTGG - Intergenic
1186515039 X:10160707-10160729 GGCCCGCACCACCAGCGACACGG + Intronic
1187064313 X:15818387-15818409 GACCTGGACCAACAGGGATCAGG + Intronic
1187620474 X:21047523-21047545 AGCCTGTACCACCAGGGCCCTGG + Intergenic
1187784270 X:22866707-22866729 TGCCTACACCACCAGGGACCTGG + Intergenic
1190966465 X:55305831-55305853 TGCCCAAACCACCAGGGACCTGG - Intergenic
1191172110 X:57458844-57458866 TGCCTACACCACCAGGGACCTGG + Intronic
1191788819 X:64946227-64946249 GACCTGTACCACCAGGGCCCTGG - Intronic
1191962444 X:66718629-66718651 TGCCTACACCACCAGGGACCTGG + Intergenic
1192598511 X:72437366-72437388 TGCCTACACCACCAGGGACCTGG + Intronic
1200066474 X:153506484-153506506 TGCAGGGACCACCAGGCTCCCGG + Intronic
1200093127 X:153644935-153644957 GGCTGTGACCAGCAGGGAGCTGG - Intronic
1200123072 X:153800385-153800407 GGCCGGGTGCAGCAGGCACCGGG + Intergenic
1200951448 Y:8903043-8903065 GGCCGGGGCCTCCTGGGGCCAGG + Intergenic