ID: 1131509914

View in Genome Browser
Species Human (GRCh38)
Location 15:93044269-93044291
Sequence CTTTCTAAGCACAGGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 0, 3: 39, 4: 278}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131509910_1131509914 -10 Left 1131509910 15:93044256-93044278 CCAAGCACTTCGACTTTCTAAGC 0: 1
1: 0
2: 1
3: 4
4: 93
Right 1131509914 15:93044269-93044291 CTTTCTAAGCACAGGGTGGAAGG 0: 1
1: 0
2: 0
3: 39
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131509914 Original CRISPR CTTTCTAAGCACAGGGTGGA AGG Intronic
900312124 1:2038746-2038768 CCTTCTAAGCACAGGATGCTGGG + Intergenic
900856343 1:5188072-5188094 CTTTGTAATAACAGGGTAGAAGG - Intergenic
901236815 1:7671641-7671663 TTTTCTGGGCACAGGGTAGATGG - Intronic
902275948 1:15339352-15339374 CTTTAAAACCACAGGTTGGATGG + Intronic
902460229 1:16569381-16569403 CCTTCTAAATACAGGGTGGAGGG + Intronic
903349970 1:22711380-22711402 CTTGCTCCGCACAGGGTGGAGGG + Intronic
903507329 1:23846961-23846983 CTTTCTAAGGCCAAGGTGGGAGG - Intronic
903867480 1:26410139-26410161 CTATCTAAGCACACGGGGGTGGG + Intergenic
907948330 1:59156147-59156169 GTTTTTAAGCACAGAGAGGATGG + Intergenic
908202806 1:61815149-61815171 CTTTCTGAGCCCAGGCTTGAAGG + Intronic
909025587 1:70478054-70478076 CTTTGTAAGCACATGGATGAAGG - Intergenic
910359830 1:86404531-86404553 ATTTCTAGGCTGAGGGTGGAGGG + Intergenic
910478542 1:87634253-87634275 GTTTATAGGCACAGGATGGAGGG + Intergenic
911596289 1:99801986-99802008 ATTTCTAAGCAAAGTGTTGAAGG - Intergenic
912992953 1:114507814-114507836 CTATCTAAAAACACGGTGGATGG + Intronic
913605188 1:120459200-120459222 CCTTCTAAATACAGGGTGGAGGG - Intergenic
913642054 1:120821937-120821959 CCTTCTAAATACAGGGTGGAGGG - Intronic
914083350 1:144430008-144430030 CCTTCTAAATACAGGGTGGAGGG + Intronic
914189374 1:145395286-145395308 CCTTCTAAATGCAGGGTGGAGGG + Intronic
914211222 1:145580998-145581020 CCTTCTAAATGCAGGGTGGAGGG + Intergenic
914276426 1:146128427-146128449 CCTTCTAAATACAGGGTGGAGGG + Intronic
914366391 1:146982761-146982783 CCTTCTAAATACAGGGTGGAGGG - Intronic
914486056 1:148110686-148110708 CCTTCTAAATACAGGGTGGAGGG + Intronic
914537470 1:148579382-148579404 CCTTCTAAATACAGGGTGGAGGG + Intronic
914586388 1:149065834-149065856 CCTTCTAAATACAGGGTGGAGGG + Intronic
914628456 1:149485963-149485985 CCTTCTAAATACAGGGTGGAGGG - Intergenic
916900330 1:169215292-169215314 CTTTATAGGCACAGGATGGGGGG + Intronic
917307373 1:173640321-173640343 CCTTCTCATCAAAGGGTGGAAGG + Intronic
920141108 1:203814118-203814140 ATTTCTAAGCAAAGTGTGGAAGG - Intronic
920933937 1:210413551-210413573 ATTTCTAAGCAAAGTGTTGAAGG - Intronic
921615030 1:217256598-217256620 ATAGCAAAGCACAGGGTGGAAGG - Intergenic
921664050 1:217845367-217845389 CTTTCTAGGCTCCAGGTGGAAGG + Intronic
922222071 1:223616251-223616273 CTTACTAGGCACAGTTTGGATGG - Intronic
922667339 1:227482046-227482068 ATTTCTAAGGACAGAGTAGATGG + Intergenic
922801181 1:228365422-228365444 CTTCCTAACCCCAGGATGGAGGG + Exonic
923269001 1:232337872-232337894 GTTTCTGAGCTCAGGGTGGGTGG - Intergenic
923841475 1:237676411-237676433 CATTCTATCCACAGGGTAGAGGG + Intronic
923953478 1:238988170-238988192 ATTTCTAAGCAAAGTGTTGAAGG + Intergenic
1064358628 10:14642751-14642773 TTTTCTAAGCAAAGTGTTGAAGG - Intronic
1064676606 10:17766219-17766241 GTTTCTAAGCAAAGTGTTGAAGG - Intronic
1065684916 10:28274627-28274649 CTGTGTAAACACTGGGTGGATGG - Intronic
1067411815 10:46071202-46071224 CTCTGTAAGCCCAGGCTGGAGGG - Intergenic
1068015947 10:51516362-51516384 CTTTATAGGCACAGGATGGGAGG + Intronic
1069029959 10:63585192-63585214 CTTTCCAGGCACAGGGTGCTAGG + Intronic
1070083024 10:73207246-73207268 CTTTCTAGGTACAGGGTGCAAGG - Intronic
1070547831 10:77466288-77466310 CTTTCTTAGCACAGTGTGTTTGG - Intronic
1070809246 10:79289342-79289364 CCTTCTCAGTACAGGCTGGAAGG - Intronic
1071283178 10:84121240-84121262 CGTTCTCATCAAAGGGTGGAAGG - Intergenic
1071548605 10:86548332-86548354 ATTTCTAAGCAAAGTGTTGAAGG + Intergenic
1072208666 10:93226376-93226398 CTTTATAGGCACAGGATGGTGGG + Intergenic
1072708511 10:97699736-97699758 CTTTGGAAGCCCAAGGTGGAAGG - Intergenic
1073261909 10:102196857-102196879 CTTACTATACAAAGGGTGGAAGG - Intergenic
1074629064 10:115229915-115229937 CTTTCTTAGCACAGGTAGGCAGG - Intronic
1074689331 10:115990301-115990323 CTTTCTGAGCAGAGGGCAGAGGG + Intergenic
1077331148 11:1984303-1984325 CTTTCTCAGCGCTGTGTGGAGGG + Intronic
1078099891 11:8323772-8323794 GTTTCTCAGACCAGGGTGGATGG - Intergenic
1079470171 11:20770491-20770513 CTTCCTGAGCACAAGGTTGAAGG + Intronic
1081129703 11:39363892-39363914 TCTCCTAAGAACAGGGTGGAAGG - Intergenic
1081625403 11:44652389-44652411 CTTTCTCAGCACAGGATACAGGG + Intergenic
1083621625 11:64052110-64052132 CTTTCTCACTACAGGGAGGAGGG - Intronic
1085507642 11:77069284-77069306 CTTTCTAAGTACATGGTGTCTGG + Intronic
1086287440 11:85265721-85265743 CTTTATAGGCACAGGATGGTGGG - Intronic
1086427735 11:86703311-86703333 ATATCTAATCACAGGGTGGTTGG + Intergenic
1091106277 11:132922423-132922445 CTCTGTTTGCACAGGGTGGAAGG - Intronic
1202814129 11_KI270721v1_random:39479-39501 CTTTCTCAGCGCTGTGTGGAGGG + Intergenic
1091983227 12:4883546-4883568 CTTTCTGAGCACAGGGGCAAAGG + Intergenic
1092409099 12:8240694-8240716 GCTTCTAAGCTCAGTGTGGACGG + Intergenic
1092778465 12:11964224-11964246 CTTTCTATGGACATGGTGTAAGG - Intergenic
1095902880 12:47346553-47346575 CTTTCTAAGTACAGTGTGCTGGG + Intergenic
1096568167 12:52498504-52498526 CTTGATAAGAACAGGGTTGAAGG + Intergenic
1096606651 12:52771308-52771330 ATTTCTAAGGAAAGGGAGGAAGG - Intronic
1096964508 12:55614953-55614975 ATTTCTAAGCAAAGTGTTGAAGG - Intergenic
1097277405 12:57822790-57822812 CTTTCTAAACACAGAGTGTTGGG - Exonic
1097669172 12:62515570-62515592 CTTTGTAAGGCCAAGGTGGATGG + Intronic
1097924380 12:65111266-65111288 TTATCTCATCACAGGGTGGAGGG - Intronic
1098488403 12:71047648-71047670 CTTTATAGGCACAGGAGGGAGGG + Exonic
1099164314 12:79284222-79284244 TTTTATAAGCACATGGTGTAAGG + Intronic
1099778386 12:87163559-87163581 ATTTCTAAGCAGAGTGTTGAAGG - Intergenic
1100471572 12:94898178-94898200 CTTACTATGCACAGGGTGCATGG - Intronic
1101210861 12:102534157-102534179 CTTTCTAGGTACATGGTGTAAGG - Intergenic
1101424373 12:104575961-104575983 GTTTGTAATCACAGGGTGGGTGG - Intronic
1103300320 12:119921308-119921330 TTTTCTCTGCATAGGGTGGAAGG - Intergenic
1103882835 12:124179591-124179613 ATTTCTAAGCAAAGTGTTGAAGG + Intronic
1104110690 12:125701184-125701206 CCTTCTCAGCACAGTGTGGGAGG + Intergenic
1104263381 12:127206145-127206167 CTTTATAAAAACATGGTGGAGGG - Intergenic
1104351451 12:128047693-128047715 AGTTCTAAGCACAGTGAGGATGG - Intergenic
1104867148 12:131963114-131963136 CTTTCTAAGCACAGGTAAGGGGG - Intronic
1105212219 13:18263674-18263696 CTGTCTAACCACAAGGTGGAAGG - Intergenic
1109313983 13:60727963-60727985 CTTTGTAGGCACAGGATGGAGGG + Intergenic
1109672793 13:65632171-65632193 TTTTCTATGAAAAGGGTGGAGGG - Intergenic
1110306345 13:73991838-73991860 CTTTCTTCGCACAGGATAGAGGG - Intronic
1111580179 13:90212191-90212213 CCTTTTAAGCACAGATTGGAAGG - Intergenic
1111845959 13:93508770-93508792 TTTTCTAGGGAAAGGGTGGAGGG + Intronic
1112899360 13:104340071-104340093 TGTCCTAAGCACAGGGAGGATGG - Intergenic
1116204249 14:41841733-41841755 CTTTCTGTTCACAGGGTAGATGG + Intronic
1118253650 14:64185762-64185784 CTTTGGAAGCCCAAGGTGGACGG - Intronic
1119264495 14:73256001-73256023 CTAGCTAAGCAGAGGGTGGAAGG + Intronic
1120793011 14:88602597-88602619 CTTAGTAAGTACAGGCTGGAGGG + Intronic
1121161965 14:91751801-91751823 TTTTGGAAGCACAGGATGGAGGG - Intronic
1122281700 14:100627043-100627065 CTCTCTAAGCTAAGTGTGGAAGG - Intergenic
1122285244 14:100647691-100647713 ATTTCTAAGCAAAGTGTTGAAGG + Intergenic
1123205542 14:106709296-106709318 ATTTCTAAGCAAAGTGTGGATGG + Intergenic
1123482651 15:20647141-20647163 ATTTCTAAGCAAAGTGTGGATGG + Intergenic
1124088829 15:26578703-26578725 CTTTCTAGGCAAAGGCTGCATGG + Intronic
1125802860 15:42465518-42465540 CTTTGGGAGCCCAGGGTGGAAGG - Intronic
1127471936 15:59297823-59297845 CTTTCAAAGCCCACGGTGGGAGG - Intronic
1128590618 15:68893363-68893385 GTTTCTAAGCAGAAGTTGGATGG + Intronic
1129197212 15:73975899-73975921 GTTTATAACCACAGGATGGATGG + Intergenic
1130567677 15:85011070-85011092 GTTTCTAAGAACAGTTTGGAAGG - Intronic
1130751704 15:86719496-86719518 CTTTCTATGCATAGGGAGCAGGG + Intronic
1131509914 15:93044269-93044291 CTTTCTAAGCACAGGGTGGAAGG + Intronic
1131968250 15:97867837-97867859 CTACCTAAGCCCATGGTGGAGGG + Intergenic
1132138583 15:99368936-99368958 ATTTCTAAGCAAAGTGTTGAAGG - Intronic
1133089023 16:3389333-3389355 CTGGCTAAGCCCAGGGTGGGAGG - Intronic
1133957337 16:10456134-10456156 GTTTCTAAGCAAAGTGTTGAAGG + Intronic
1135030386 16:19033436-19033458 CTTTCTGAGTACAAGGTGGGTGG + Intronic
1135530733 16:23251187-23251209 CTTTCAAAGCACACGATGGAGGG - Intergenic
1136779875 16:32891194-32891216 ATTTCTATGCAAAGTGTGGATGG - Intergenic
1136890740 16:33970323-33970345 ATTTCTATGCAAAGTGTGGATGG + Intergenic
1137707480 16:50545581-50545603 CTTTCTAAGCACTGTGAGAAAGG + Intergenic
1138233023 16:55353657-55353679 CTTTCTCCTCACATGGTGGATGG - Intergenic
1139148464 16:64351257-64351279 GTTTCTAAGCAAAGGGTTGAAGG + Intergenic
1139421208 16:66850618-66850640 GGTTCTGAGCACACGGTGGACGG + Exonic
1139910945 16:70397282-70397304 CTTTGAGAGCACAGGGCGGACGG - Intronic
1203082293 16_KI270728v1_random:1153283-1153305 ATTTCTATGCAAAGTGTGGATGG - Intergenic
1142907361 17:3053133-3053155 CTCTCTAAGCAAAGGGAGGAGGG - Intergenic
1142927202 17:3251108-3251130 CTCTCTAAGCAAAGGGAGGAGGG + Intergenic
1146400309 17:32496100-32496122 CTTTCTAAGCACTGGTTGCCCGG + Intronic
1146587746 17:34097055-34097077 CTCTCTAAGCACACAGAGGAAGG + Intronic
1147178554 17:38671519-38671541 CTCCCGAAGCACAGGGTGGAAGG + Intergenic
1148394458 17:47296930-47296952 CTATTTAAGCGAAGGGTGGATGG - Intronic
1149057104 17:52379638-52379660 CTTTATAGGCACAGGATGGGAGG - Intergenic
1149344919 17:55725187-55725209 CTTTGTAGACACAGAGTGGAAGG - Intronic
1149557675 17:57585743-57585765 CTTTCTGAGCTCAGGGGAGATGG - Intronic
1150892791 17:69173457-69173479 CTTTCTGTGGACAGGGTGAAGGG - Intronic
1155449020 18:25944019-25944041 TTCTGCAAGCACAGGGTGGATGG - Intergenic
1155628546 18:27864183-27864205 CTTCCAAAGCACACAGTGGATGG + Intergenic
1155799947 18:30089295-30089317 CTTTATAGGCACAGGATGGAGGG - Intergenic
1156412311 18:36842498-36842520 ATCTCAAAGCAGAGGGTGGAAGG + Intronic
1157570207 18:48707162-48707184 CTTTCAAAGCACATAGTAGAAGG + Intronic
1157640840 18:49212738-49212760 CTTTGGAAGGCCAGGGTGGATGG - Intronic
1160117854 18:76098850-76098872 CTTTCCAACCACAGGGTGGTCGG + Intergenic
1160566884 18:79791524-79791546 CTTTCACAGCACACGGTGCAGGG + Intergenic
1161532967 19:4801118-4801140 ATATCAAGGCACAGGGTGGAGGG - Exonic
1161601734 19:5188331-5188353 CTTTGTCCTCACAGGGTGGAAGG - Intronic
1166232058 19:41430453-41430475 GTTTCTAAGCACAGGAAGGCTGG + Intronic
1167196829 19:48034919-48034941 CTTTGGAAGGACAAGGTGGAAGG - Intronic
1167316048 19:48763328-48763350 CTTTGTAAGGCCAGGGTGGGCGG + Intergenic
1202676661 1_KI270711v1_random:13109-13131 CCTTCTAAATACAGGGTGGAGGG + Intergenic
925182732 2:1827451-1827473 CCTTCTAGGCAGAGGGTGGCGGG - Intronic
925349379 2:3190189-3190211 CTTCCTCAGCACAGCGTGCATGG + Intronic
925749206 2:7072359-7072381 ATTTCAAAGCAAAGTGTGGAAGG + Intergenic
926562741 2:14435308-14435330 CTTTATAGGCACAGGATGGGGGG + Intergenic
926857498 2:17272775-17272797 CTTTTTAAGCACAGTGTGGGAGG - Intergenic
928281819 2:29953260-29953282 CTTTCTTTGCACAGGGCAGATGG - Intergenic
928411671 2:31059112-31059134 CTGTTTAAGCACAAGTTGGAGGG + Intronic
930484886 2:51999142-51999164 TTTTCTAGGCACATGGTGCAAGG - Intergenic
932773332 2:74513680-74513702 CTTCCTAGGCACAGAATGGAGGG + Intronic
933298257 2:80514785-80514807 CTTTATAGGCACAGGATGGGGGG + Intronic
933877039 2:86630231-86630253 CTTTAGAAGCCCAGGGTGGAGGG - Intronic
934301405 2:91778728-91778750 CTGTCTAACTACAAGGTGGAAGG + Intergenic
936858379 2:116987228-116987250 CTTTATAGGCACAGGATGGGGGG - Intergenic
937478049 2:122232477-122232499 CTTCCAAGGCACAGGATGGAGGG - Intergenic
937480197 2:122250509-122250531 ATTTCTAAGCAAAGTGTTGAAGG + Intergenic
937770953 2:125720725-125720747 CTTTATAGGCACAGGATGGTGGG - Intergenic
938294929 2:130172190-130172212 CTGTCTTAGCACAGACTGGAGGG - Intronic
938461698 2:131501645-131501667 CTGTCTTAGCACAGACTGGAGGG + Intergenic
938880612 2:135582566-135582588 CTTACTCAGTACAGGGTGCAGGG + Intronic
942707604 2:178794229-178794251 CTTTCTGAGCAAAAGGTGGTCGG - Intronic
943969558 2:194386138-194386160 CTTTATAGGCACAGGATGTAGGG - Intergenic
944001353 2:194842488-194842510 CTTTATAAGCACAAGATGGGGGG - Intergenic
944389011 2:199197920-199197942 ATTTCTAAGCAAAGTGTTGAAGG + Intergenic
945289035 2:208109841-208109863 CTTTGGAAGGCCAGGGTGGAAGG + Intergenic
946287099 2:218711993-218712015 CTTTCTGAGCACAAAGTGGGTGG - Intronic
946340915 2:219067926-219067948 CATTCCAAGCACAGGGTGAAAGG + Intergenic
947857513 2:233334039-233334061 CTGGCTAGGCACAGGATGGAGGG + Intronic
947920462 2:233866915-233866937 CTTTGTAAGGAGATGGTGGATGG - Intergenic
948157795 2:235798479-235798501 TTTTTTAAGGACATGGTGGAAGG + Intronic
1170257381 20:14360095-14360117 CTTGCTGGGCACAGGGTGGTGGG + Intronic
1171203355 20:23259376-23259398 CTGTCTATGCAAATGGTGGAAGG + Intergenic
1172181109 20:33004186-33004208 ATCTCCAAGGACAGGGTGGAGGG + Intronic
1173439089 20:43059369-43059391 CTTTCTAAGCAAAATGTTGAAGG - Intronic
1174237153 20:49103274-49103296 GTTCCTAAGCACAGTGGGGAGGG - Intergenic
1174241375 20:49138039-49138061 CTTTTTAAGGACAAGGTGGGTGG + Intronic
1175361900 20:58418511-58418533 CTTTCTGATCACGGGGTGGAGGG - Intronic
1176114684 20:63426609-63426631 ATTTCCAAGCAAAGTGTGGAAGG - Intronic
1177319497 21:19501703-19501725 CTTTCTAAGAAAAGGTTGGTAGG - Intergenic
1177439280 21:21099490-21099512 AGTGCTAAGCAAAGGGTGGAGGG + Intronic
1177801556 21:25833554-25833576 CTTTATAGGCACAGGATGGGGGG - Intergenic
1178712115 21:34926766-34926788 TTTTCTAAGCACAGGAAGAATGG + Intronic
1180815032 22:18783994-18784016 CTGTCTAACTACAAGGTGGAAGG - Intergenic
1181114210 22:20621102-20621124 CTTTCTTAGCACAGACTGGAGGG - Intergenic
1181201220 22:21218331-21218353 CTGTCTAACTACAAGGTGGAAGG - Intronic
1181700523 22:24618636-24618658 CTGTCTAACTACAAGGTGGAAGG + Intronic
1182259213 22:29060950-29060972 ATTTCTAAGAACTGGGTGGAAGG - Intronic
1182531398 22:30961890-30961912 ATTTCTAAGCACTGTGTGGCAGG - Intronic
1182917235 22:34045783-34045805 CTTTCAAAGCACAGTGAGGGTGG - Intergenic
1183238784 22:36640325-36640347 CTTTCAAAGCAAGGGCTGGAGGG + Intronic
1203225693 22_KI270731v1_random:77100-77122 CTGTCTAACTACAAGGTGGAAGG + Intergenic
1203265135 22_KI270734v1_random:9684-9706 CTGTCTAACTACAAGGTGGAAGG - Intergenic
949372813 3:3353887-3353909 ATTTCTAAGCAAAGTGTTGAAGG + Intergenic
950656064 3:14437097-14437119 CTTTATCAGCACAGGAAGGATGG + Intronic
951546221 3:23828940-23828962 CTTTCAGTGGACAGGGTGGATGG + Intronic
952581459 3:34838255-34838277 ATTTCCAAGCAAAGAGTGGAAGG - Intergenic
952708494 3:36405304-36405326 GTTTCAGAGCACATGGTGGAGGG - Intronic
953844269 3:46414900-46414922 GTTTCTAAATACAGGGGGGATGG + Intergenic
954419190 3:50409679-50409701 CTCTCTGAGGGCAGGGTGGAAGG + Intronic
954933308 3:54303174-54303196 GATTCTAAGCTCTGGGTGGATGG + Intronic
958628643 3:96658898-96658920 CTTATTAAGCATTGGGTGGAGGG + Intergenic
959887675 3:111521156-111521178 CTTTCTGAGCAAAGGGTGTCAGG + Intronic
961185967 3:124915293-124915315 ATTACCAAGCACAGTGTGGAAGG - Intronic
962322721 3:134405188-134405210 CTATCTGGGAACAGGGTGGAAGG + Intergenic
962911628 3:139856246-139856268 CAATCTATGCACAGGGAGGATGG + Intergenic
964032191 3:152151619-152151641 CTTTTTCAGCACAGGCTGGTGGG + Intergenic
964279702 3:155051005-155051027 ATTTCTAAGCAAAGTGTGGGAGG + Intronic
964492606 3:157253090-157253112 CTTTCTGAGAGCAGGGGGGATGG - Intergenic
964915556 3:161837537-161837559 ATTTCTAAGCAAAGTGTAGAAGG + Intergenic
969605074 4:8198352-8198374 CTATCACAGCACAGGCTGGAGGG + Intronic
970207252 4:13667339-13667361 ATTTCTAAGCAAAGTGTTGAAGG - Intergenic
971232997 4:24815830-24815852 CTTTTTAAGCAGTGGGTGCAGGG + Intronic
971486172 4:27162801-27162823 ATTTCTAAGCAAAGTGTTGAAGG - Intergenic
972852921 4:43072551-43072573 CGTTCTCATCAAAGGGTGGAAGG + Intergenic
974291576 4:59938790-59938812 TTTTCTAAGGACAGGTTTGATGG + Intergenic
976689084 4:87849175-87849197 CTTTTTGAGCACAAGGTGGCAGG - Intergenic
977269056 4:94892227-94892249 CTTGCTACCCACAGGGTGGTTGG + Intronic
978327367 4:107574868-107574890 TTTTATAGGCACAGGATGGAGGG - Intergenic
979786655 4:124723191-124723213 ATTTCTAAGCAAAGTGTTGAAGG + Intergenic
981197989 4:141942893-141942915 CTTCCTAGGCACAGAGAGGAGGG - Intergenic
982606545 4:157523490-157523512 CTTTATAGGCACAGGATGGGGGG + Intergenic
984583230 4:181534363-181534385 ATTTCTAAGCACAGTGATGAAGG + Intergenic
985675645 5:1230066-1230088 CTCTCACAGCACAGGCTGGAGGG + Intronic
986031189 5:3894131-3894153 CTTTCTACACAAAGGTTGGAAGG - Intergenic
986059768 5:4176960-4176982 ATTTCTAAGCAAAGCGTAGAAGG - Intergenic
986113887 5:4750381-4750403 TTTTCCAAGCACATGGTGCAAGG + Intergenic
986351392 5:6883152-6883174 CTTTCCAAGTCCAGGGTGGAGGG - Intergenic
987316441 5:16728978-16729000 TCTTTTAAGCACAGCGTGGAAGG + Intronic
987606581 5:20143677-20143699 ATTTCTAAGCAAAGTGTTGAAGG + Intronic
989273453 5:39558803-39558825 ATTTCTGGGCACAGAGTGGAAGG + Intergenic
990984374 5:61627069-61627091 CTTTCTCAGGACAGTGTGGGTGG + Intergenic
993822885 5:92642339-92642361 TTTTCTAACCACAGGATGGAAGG - Intergenic
994119983 5:96102442-96102464 CTTTATAGGCACAGGATGGGGGG + Intergenic
994502181 5:100593083-100593105 CTTTTTAAGCACTGGGTGCCTGG + Intergenic
995058446 5:107788195-107788217 ATTTCTAAGCAAAGGGTTGAAGG + Intergenic
997109437 5:131058733-131058755 ATTTCTAAGCAAAGGGTTAAAGG - Intergenic
997737495 5:136224783-136224805 CTGTGGAAGCAGAGGGTGGAGGG - Intronic
997791993 5:136769813-136769835 CTTTCAGAGCACAGTGTGGTGGG + Intergenic
999451382 5:151680917-151680939 CTTTATAAGCCCAGGGAGAAAGG + Intronic
999846614 5:155488388-155488410 CTGTATAATCACATGGTGGAAGG - Intergenic
1004746143 6:18511011-18511033 TTTTATAGGCACAGGGTGGGGGG - Intergenic
1007191936 6:40026954-40026976 ATTTCTAAGCAAAGTGTCGAAGG + Intergenic
1009948228 6:70364651-70364673 TTTTATAAGCCCAGGATGGAGGG + Intergenic
1010656598 6:78518594-78518616 CTTTCTCAGCAGAGGGTGATGGG - Intergenic
1012811042 6:103958666-103958688 ATTTTTAAACACAGTGTGGATGG - Intergenic
1014775696 6:125507202-125507224 ATTTCTAAGCAAAGTGTTGAAGG + Intergenic
1015604441 6:134940754-134940776 CTTTCATAGCACAGGCTTGAGGG - Intronic
1016005007 6:139080173-139080195 CTTTCTAATCAGAAGGAGGAGGG + Intergenic
1016083017 6:139878548-139878570 CTTTATAGGCATAGGATGGAGGG + Intergenic
1019289802 7:244939-244961 CTTTCTGAGAACAGCGTGGGAGG + Intronic
1020488543 7:8749592-8749614 CATTTTAAGAACAGTGTGGAAGG + Intronic
1022805675 7:33819863-33819885 ATTTCCAAGCAAAGTGTGGAAGG - Intergenic
1023651365 7:42372715-42372737 CTGTCTGAGCAAAGAGTGGAGGG + Intergenic
1024414154 7:49082637-49082659 ATTTCTAAGCAAAGTGTTGAAGG - Intergenic
1027433875 7:78143098-78143120 CTTTCCAATCAAGGGGTGGAAGG + Intronic
1027943804 7:84720255-84720277 TTTTCTAACCACAGGCAGGAAGG + Intergenic
1028947388 7:96595973-96595995 CTTTGCAGGCATAGGGTGGAGGG + Intronic
1029933561 7:104399026-104399048 CTTTCTAAGGACAGGCTTTATGG + Intronic
1032010050 7:128339974-128339996 GTTTCTAAGCAAAGTGGGGAGGG - Intronic
1032066203 7:128773481-128773503 TTTGGTAAGCACAGGGAGGAAGG - Intronic
1033180561 7:139173609-139173631 CTTTTTAAGGAGATGGTGGATGG - Intronic
1033225703 7:139560533-139560555 GTTGCTAGGCACCGGGTGGAGGG + Intergenic
1033408560 7:141094504-141094526 TATTCTAAGCACTGGGTGGCTGG + Intronic
1033719908 7:144048438-144048460 CTTTCTCACCACAGTGTGGGAGG + Intergenic
1035092973 7:156329746-156329768 TTTTCTGAGCAGAGGGTGGAAGG - Intergenic
1035812053 8:2500777-2500799 CTTTGTAGGCACAGGATGGAAGG - Intergenic
1037594539 8:20343882-20343904 CTTTATAGGCACAGGATGGTTGG + Intergenic
1042367205 8:67951574-67951596 CTTTCCAAGCTCAGACTGGAGGG + Intergenic
1042816754 8:72886555-72886577 CTTTCTGAGCAGAGTGTAGATGG - Intronic
1045145664 8:99341088-99341110 CTTTGTAAGGAGATGGTGGATGG - Intronic
1046357770 8:113110359-113110381 ATTTCTAAGCAAAGTGTTGAAGG - Intronic
1046949435 8:120005732-120005754 CTTAGTGAGCACAGGATGGATGG + Intronic
1047105684 8:121728008-121728030 ATTTCTAAGCAAAGTGTTGAGGG - Intergenic
1048408358 8:134145866-134145888 CCCTCTAAGCACAGGGTGCAGGG + Intergenic
1049691519 8:143962778-143962800 ATTTCCAAGCAAAGTGTGGAAGG + Intronic
1050456407 9:5838998-5839020 CTTCCTAGGCACAGGGTTGCTGG - Intergenic
1051212485 9:14759264-14759286 CTTTCGAAGGCCAAGGTGGATGG + Intronic
1052122164 9:24731055-24731077 CTTTTTAGGCACAGGATGGGGGG + Intergenic
1052660152 9:31419195-31419217 CTTTATAGGCACAGGGGGGCAGG - Intergenic
1055209062 9:73767150-73767172 TTTTTTAAGCACAGGTTTGAAGG - Intergenic
1056616260 9:88168710-88168732 CTTCCAAAGCACAGGGGGAAAGG + Intergenic
1056667216 9:88590332-88590354 CCTTATAAGCACAGGATGGGGGG - Intergenic
1057078813 9:92156506-92156528 CTTTCGGAGCCCAAGGTGGAAGG + Intergenic
1059159588 9:112021428-112021450 CTTTCCAAGCTCAGGTTGTAGGG + Intergenic
1059325172 9:113499970-113499992 CTTGCCAAGCACAGAGAGGATGG + Intronic
1061306618 9:129736245-129736267 CTTCCCAAGCTCAAGGTGGAGGG + Intergenic
1061848129 9:133399563-133399585 ATTTCTAAGCAAGGCGTGGAGGG - Intronic
1061880150 9:133564879-133564901 CTTGCGAGGCACAGGATGGAGGG - Intronic
1185684584 X:1917871-1917893 CCTTTTTAGCACACGGTGGAAGG - Intergenic
1186670573 X:11763787-11763809 CTTTGTAAGGAGATGGTGGATGG + Exonic
1187464619 X:19515784-19515806 CTTTCAAAGCATCGGTTGGATGG + Intergenic
1188519269 X:31019855-31019877 ATTTCTAAGCAAAGTGTTGAAGG + Intergenic
1189145479 X:38650813-38650835 ATTTCTAAGCACAACATGGAAGG + Intronic
1189213281 X:39302594-39302616 TTTTCCATGGACAGGGTGGAGGG - Intergenic
1189238185 X:39505094-39505116 AATTCTCAGCACGGGGTGGAGGG + Intergenic
1189789916 X:44593388-44593410 CTTTGTTTGCACATGGTGGAAGG + Intergenic
1190481506 X:50881690-50881712 ATTTCTAAGCAAAGTGTTGAAGG - Intergenic
1190714907 X:53094800-53094822 TTTTCTAAGGACCGGGTGCAGGG - Intergenic
1191841548 X:65516849-65516871 CCTTGTATGGACAGGGTGGAAGG - Intronic
1192681689 X:73259618-73259640 CGTTCTCATCAAAGGGTGGAAGG - Intergenic
1194790463 X:98142194-98142216 ATTTCTAAGCAAGGGGTGGGGGG - Intergenic
1195232725 X:102867375-102867397 CTTTTTCAGCACAGGCTGGTGGG + Intergenic
1196456197 X:115893152-115893174 TTTCCTCAGCAAAGGGTGGAGGG - Intergenic
1196540346 X:116900217-116900239 CTTTCCAGGCACATGGTGCAAGG + Intergenic
1197198775 X:123731294-123731316 CATTCTAAGCATAGGCTGGGGGG + Intronic
1198079065 X:133221459-133221481 ATTTCTAAGCAAAGTGTTGAGGG - Intergenic
1198253960 X:134908952-134908974 CTTTCTAAAAACAGGTTGCAGGG - Intronic
1199970168 X:152853810-152853832 GTTCCTTAGCACAGGGTGGCTGG - Intronic
1201848603 Y:18451427-18451449 CATTTTAGGCACAGGGTGCATGG + Intergenic
1201884714 Y:18868948-18868970 CATTTTAGGCACAGGGTGCATGG - Intergenic