ID: 1131511127

View in Genome Browser
Species Human (GRCh38)
Location 15:93050108-93050130
Sequence AGCAGGATGTTGAAGGCCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 169}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131511127_1131511135 11 Left 1131511127 15:93050108-93050130 CCAATGGCCTTCAACATCCTGCT 0: 1
1: 0
2: 3
3: 13
4: 169
Right 1131511135 15:93050142-93050164 CATCGCCAGCTCCCCTTTGCTGG 0: 1
1: 0
2: 0
3: 12
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131511127 Original CRISPR AGCAGGATGTTGAAGGCCAT TGG (reversed) Intronic
900927862 1:5717425-5717447 AGCAGGATGTTTACCCCCATGGG - Intergenic
901159174 1:7162065-7162087 AGGAACATGTAGAAGGCCATTGG + Intronic
904602696 1:31682615-31682637 ATCAGGAAGTTGAAGGCCAGAGG - Intronic
904992490 1:34604373-34604395 GGGAGGCTGTGGAAGGCCATGGG + Intergenic
905361822 1:37426115-37426137 AGAAGGATCTGGAAGGTCATGGG - Intergenic
905893763 1:41532446-41532468 AGCATGGTGTTCAAGGCCAATGG - Intronic
908462419 1:64358085-64358107 AGCAGGGTGTTGCATGTCATAGG - Intergenic
911667454 1:100569677-100569699 AGCAGGAAGGTAAAGGGCATAGG - Intergenic
913072058 1:115308283-115308305 AACAGGCTGATGAAGGCTATAGG + Intronic
914980639 1:152411485-152411507 ACCAGGATGATGATGGCCTTAGG - Intronic
916301288 1:163277206-163277228 AGCAGGAGGTTCCAGGTCATAGG - Intronic
917233687 1:172866145-172866167 AGCAGGATTTTGAGGGGCTTAGG - Intergenic
918702936 1:187627986-187628008 AGCAGAATGTTGAAGGACGATGG - Intergenic
921054253 1:211532154-211532176 AGCAGGTTGCTGAAGGCCCTTGG + Intergenic
924354515 1:243157005-243157027 AACAGGATGTTGAATGACAGAGG - Intronic
1066054546 10:31668241-31668263 ACCAGGATGTTGAAGGAAATGGG - Intergenic
1067156660 10:43787067-43787089 TGCAGGATGTTGAGGGCCTGTGG + Intergenic
1069138624 10:64796709-64796731 AGAAGGATGTTGAAGTCTGTGGG - Intergenic
1069716830 10:70526527-70526549 ACCAGGCTGTTGAAGGGCCTTGG + Intronic
1069833243 10:71293757-71293779 AGCAGGATGTGACAGGCCCTGGG - Exonic
1072701127 10:97641854-97641876 AGCAGGCTGTTGATAGCCCTGGG - Intronic
1074822792 10:117194048-117194070 AGCAGGATGTGCAAGGAGATTGG + Intergenic
1076734291 10:132451871-132451893 ATCAGGATGTTCAGGGCCAGAGG + Intergenic
1076836538 10:133023870-133023892 AGCAGGAGCTTGAAGACCCTGGG - Intergenic
1077609376 11:3635120-3635142 GGCAGGATGTTGAAGGGCACAGG - Intergenic
1081756710 11:45549864-45549886 AGCAGGATGTTGGTGGGCAAGGG - Intergenic
1082215924 11:49569368-49569390 AGCAGCATGTGCAAAGCCATTGG + Intergenic
1086633655 11:89055108-89055130 AGCAGCATGTGCAAAGCCATTGG - Intronic
1088852840 11:113719467-113719489 ATCAGGATGGGGAAGGTCATGGG - Intergenic
1090076919 11:123585391-123585413 AGCAGGATGTTGGCAGCCACAGG - Intronic
1090227158 11:125078623-125078645 AGCAGGATGATGAAGGCGTCAGG + Intronic
1090471011 11:126981354-126981376 AGAAGGAGGCTGATGGCCATTGG + Intronic
1092657901 12:10706698-10706720 AACAGGATGTTTAAAGCCGTAGG - Intronic
1092816320 12:12315216-12315238 AGCAGGATTGGGAAGGCAATTGG - Intergenic
1094605958 12:31949328-31949350 AGGAGGAAGTTGAGGGCCAGGGG + Intergenic
1095188059 12:39224808-39224830 AGCAGGATGCTGTAGCCCCTGGG + Intergenic
1095749714 12:45697029-45697051 GACAGCATGTTGATGGCCATGGG - Intergenic
1096365299 12:51024249-51024271 AGAAGGCTTTTTAAGGCCATAGG + Intronic
1096392603 12:51240720-51240742 AGGAGAATATTGAAGGCCAGTGG + Intronic
1096416884 12:51422272-51422294 AGCAGGACGCTGAAGGCTTTAGG - Intronic
1096539312 12:52296032-52296054 ACAAGGATCTTGAAGGCCTTGGG + Intronic
1097750286 12:63345150-63345172 AGCAGTTTGTTGTAGGCTATGGG - Intergenic
1099173709 12:79396468-79396490 AGCAGTTAGTTGAAGGTCATAGG + Intronic
1102038976 12:109788512-109788534 AGCAGGATGATGAAGACCACGGG + Exonic
1102811030 12:115824236-115824258 GTCAGGAAGTTGAAGGCCTTTGG - Intergenic
1104513048 12:129399038-129399060 GGCAGGATGTGGAAGGGCAAAGG + Intronic
1104858335 12:131912299-131912321 AGTAGGAGGTCGGAGGCCATAGG + Intronic
1105981167 13:25517988-25518010 TGCCAGATGTGGAAGGCCATGGG + Intronic
1107890302 13:44908589-44908611 AGCTGGGTGTGGAAGGCCCTGGG - Intergenic
1109459530 13:62637956-62637978 AGCAGAATGATGAAGGAGATGGG - Intergenic
1111067411 13:83113282-83113304 AGCAGAATGTTGATTGCCAGGGG - Intergenic
1113242566 13:108354799-108354821 AGCAGGAAGTAGAAGAGCATTGG + Intergenic
1118541556 14:66833177-66833199 AGCAGGGTGTGGTAGGCCTTAGG + Intronic
1120300438 14:82699587-82699609 AGAAGGATGTAGAAGGACCTAGG + Intergenic
1123772059 15:23538872-23538894 AGCTGGATGTGGAAGGTCACAGG - Intergenic
1126550009 15:49918468-49918490 AGCAGGATATTGGAGACCTTGGG - Intronic
1129570866 15:76682417-76682439 GGCAGGGTGTTGATGGGCATGGG - Intronic
1131511127 15:93050108-93050130 AGCAGGATGTTGAAGGCCATTGG - Intronic
1132391131 15:101438978-101439000 AGGAGGATCTTAAAGGCCAGTGG + Intronic
1132521069 16:389390-389412 AGCTGGAAGATGAAGGGCATGGG + Intergenic
1136075255 16:27812708-27812730 AGCTGCATCATGAAGGCCATGGG + Intronic
1137708727 16:50552008-50552030 ATCAGGATGTAGGAGGGCATGGG + Intronic
1140677079 16:77343025-77343047 AGCAGGGTTTTGAAGGCCTTAGG - Intronic
1140790916 16:78390110-78390132 AGCAGGTTGGTGACGGGCATGGG + Intronic
1141871273 16:86788435-86788457 AGCAGGACAATGAAGGCCAAGGG + Intergenic
1144693910 17:17288275-17288297 AGGAGGATGCTGAAGGGGATGGG + Intergenic
1147682421 17:42259345-42259367 AGCAGGAGCTTCAAGGACATGGG + Intronic
1148105083 17:45114679-45114701 AACAGGTTGTTGAAGGCCTGGGG - Intronic
1150649724 17:67001854-67001876 GGCAGGATGTTGGGTGCCATGGG + Intronic
1150892881 17:69174723-69174745 ACCAGTATGCTGAAGGCCAGAGG + Exonic
1152941419 17:83174677-83174699 TGAAGGATGTTGCAGGCCCTGGG - Intergenic
1154066931 18:11116206-11116228 AGCTGGATATTGAAGGCAGTGGG - Intronic
1156450417 18:37263423-37263445 GTCAGGATTTTGGAGGCCATCGG + Intronic
1156949153 18:42872045-42872067 AGCAAGATGATGAAGGACAATGG - Intronic
1157904500 18:51557254-51557276 AGCAGAAGGTTAAAGGTCATGGG + Intergenic
1159643268 18:70888128-70888150 AGCAGGCTGTCCAAGGCCATGGG + Intergenic
1165752782 19:38270963-38270985 AGGAGGATCTTGCAGGACATCGG - Intronic
1167772486 19:51529966-51529988 TGCAGGATTTTGAAGGCTTTGGG + Exonic
1168706622 19:58474008-58474030 TGCAGGATTTTGGAAGCCATGGG - Intronic
926113097 2:10195111-10195133 AGCAGGGTGGTGAGGGCCACAGG + Intronic
929844105 2:45503381-45503403 AGTAGGATGTCAAAAGCCATAGG - Intronic
930400950 2:50886563-50886585 AGCATGACTTTGAAGGCCAAAGG + Intronic
931721570 2:65070903-65070925 AGCACAGTGTTGAAGGACATGGG - Intronic
932471900 2:71964789-71964811 AGCAGTGTCTTGAAGGTCATGGG - Intergenic
936081436 2:109435195-109435217 GTCAGTATGTTGAAGGCCATGGG + Intronic
942632290 2:177963832-177963854 AGCTGGATGGTGGAGGCCACTGG - Intronic
946901187 2:224373340-224373362 AGCAGGTTGTTGAAGGGCAATGG + Intergenic
947816794 2:233042761-233042783 AGCAGGAGGCTGAAGTCCCTGGG - Intergenic
948457343 2:238111459-238111481 AGTAGGATGTTGCTGGCCAGGGG - Intronic
1169182755 20:3584424-3584446 CCCAGGATGTTGAAGGCAAAAGG - Intronic
1169236869 20:3936662-3936684 AACTGGCTGTTGAAGGCCAGAGG - Intronic
1170264022 20:14444921-14444943 AGCAGGATGATGGTGGTCATAGG - Intronic
1173556116 20:43967071-43967093 AGAAGGATGTTGCAGGTGATTGG + Intronic
1174699593 20:52594605-52594627 AGCAGGATGGTGAGGGTAATGGG - Intergenic
1175426945 20:58873893-58873915 AGCAGGTTGTTGAAGTCTTTTGG - Intronic
1175858962 20:62139339-62139361 AAAAGGATGTTGAAAGCTATTGG - Intronic
1176215012 20:63943899-63943921 ACCAGGATGTTGAAGGCCTGAGG - Intronic
1177341679 21:19811268-19811290 ATCTGGATTTTGAAGGGCATTGG + Intergenic
1178478833 21:32961606-32961628 AGCATGGTGGTGAAGGACATGGG + Intergenic
1184637803 22:45848978-45849000 TGCAGGGTCTTCAAGGCCATGGG + Intergenic
949140954 3:632281-632303 TGCAGAATCTTGAAAGCCATGGG + Intergenic
953928433 3:46994097-46994119 AGCAGGATGCTTATGGCCACCGG - Intronic
954360072 3:50117299-50117321 AACAAGATGCTGCAGGCCATGGG + Exonic
954581247 3:51704017-51704039 TGCAGGAGGGTGCAGGCCATGGG - Exonic
955772075 3:62395160-62395182 AGCAGGAAGTTGAAGGTGGTGGG + Intergenic
956639789 3:71404903-71404925 AAAAGGAGGTTGAAAGCCATGGG - Intronic
961804350 3:129478225-129478247 AGCAGCATGTTGAAGGAGTTGGG + Intronic
962727884 3:138251672-138251694 TTCAGTATGTTGAAGGCCAAAGG - Intronic
962844368 3:139261926-139261948 AGCTGGCTGGTGAAGGCCTTTGG + Intronic
963271503 3:143290100-143290122 TGCAGGCTGTAGAAGACCATAGG - Intronic
965936785 3:174123839-174123861 AGCAGGCAGTTGAAGTACATAGG - Intronic
966549194 3:181184983-181185005 CAAAGGATGTGGAAGGCCATAGG + Intergenic
966923543 3:184629882-184629904 AGGAGGAGGTGAAAGGCCATGGG + Intronic
966931131 3:184676449-184676471 AGCAGGATGGGGAAGCCCAGTGG - Intronic
967358421 3:188600724-188600746 AGCAGAATGGTGATTGCCATGGG - Intronic
968939060 4:3628605-3628627 GGGAGGATGTTGGAGGCCAACGG + Intergenic
969417437 4:7069865-7069887 AGCTGGGTGATGAATGCCATAGG + Intergenic
978135508 4:105253668-105253690 AGTATGATGTTGAAAGGCATTGG + Intronic
979247290 4:118522647-118522669 AACAGGATGTTGAATGACAGAGG + Intergenic
983614605 4:169688281-169688303 AGCAGGGTGATGAAGGGGATAGG - Intronic
985996513 5:3600150-3600172 TGCAGGAAGGTGAGGGCCATGGG - Exonic
986286074 5:6360092-6360114 GGCAGGATGTGGCAGGCCCTGGG + Intergenic
987474342 5:18372387-18372409 AGCAGGAATTTGAATACCATAGG + Intergenic
988965080 5:36408084-36408106 AGCAGGATGTTGAATAACAGTGG - Intergenic
991569532 5:68039962-68039984 AGCAGGATGACAAAGGCAATGGG + Intergenic
992002917 5:72452654-72452676 AGCAGAAGGCTGAAGGCCAGAGG - Intronic
992045256 5:72881487-72881509 ACCAGGTTGTTGAATGCCTTTGG + Intronic
996691738 5:126347704-126347726 TGGAGGATGTTGAATGCCCTGGG - Intergenic
996814028 5:127554246-127554268 AGCAGGAGGTTCAAGGAAATGGG - Exonic
997593435 5:135090239-135090261 AGCAGAGTGTTGAAGGCCATAGG + Intronic
997698847 5:135882258-135882280 AGCAGGAAGTTGAATGCCATGGG - Intronic
997762309 5:136461753-136461775 AGGAGTATTTTGAAGGACATTGG - Intergenic
999216182 5:149937329-149937351 AGCAGGGCTTTGGAGGCCATGGG + Intronic
1004124241 6:12856694-12856716 CGCAGGATCTTGAAAGCCTTAGG - Intronic
1007601268 6:43083179-43083201 AGCAGGAGGTTGAGGGACACAGG - Intronic
1008928007 6:56907583-56907605 AGCAGAATGTTGAAGGGCACTGG - Intronic
1010211332 6:73364463-73364485 AGCTGGATTTGGAAGGCCCTGGG + Intergenic
1011144315 6:84195500-84195522 AGCAGGATGTTGGAATACATTGG - Intronic
1012119182 6:95341873-95341895 AGTAGGATTTTGAATGTCATAGG + Intergenic
1013790011 6:113825846-113825868 ACCAGGATGTTGTAGGGGATTGG - Intergenic
1016891247 6:149008869-149008891 AGCAGGATGGTGCAGCCCACTGG + Intronic
1017588466 6:155952386-155952408 ACTAAGATGTTGAAGGCCAGAGG + Intergenic
1017821405 6:158051448-158051470 AGCCAGGTGTTGATGGCCATGGG + Intronic
1020045357 7:5036486-5036508 AGCAGCCTGTTGAAGGCCTCAGG + Intronic
1020370964 7:7431611-7431633 TGAAGGATCTTCAAGGCCATGGG + Intronic
1021031048 7:15736406-15736428 GGCTGTATGTTGAAGGCAATGGG + Intergenic
1021636493 7:22699240-22699262 AGCAGGACCTTGCAGGACATGGG + Intergenic
1023843010 7:44107270-44107292 AGCAGGATGCTGAAGGCCAGAGG + Intronic
1024226316 7:47328810-47328832 GGCAGGATGTTATAGCCCATTGG - Intronic
1027729215 7:81848551-81848573 AGCAGGTTAATGAATGCCATTGG + Intergenic
1028444818 7:90909586-90909608 AGCAGGCAGTTTAAAGCCATGGG - Intronic
1031970489 7:128061494-128061516 AGCAGAATGAGGAAGGCCAGAGG + Intronic
1033088000 7:138359959-138359981 AGCAGGATTTTAAAGACAATGGG + Intergenic
1033367681 7:140683968-140683990 AGTAGGATGCAGAGGGCCATGGG + Intronic
1033567931 7:142597890-142597912 AGCAGGATGCTAAAGGCAATTGG + Intergenic
1034104809 7:148481374-148481396 GGCAGGATGCTGGAGGCCAAAGG - Intergenic
1043056870 8:75450406-75450428 ATCAGTATGTTGCAGGCCTTAGG - Intronic
1044978106 8:97686271-97686293 AGCATGATGTGGAAGGGCACAGG + Intronic
1045397286 8:101773477-101773499 AGTAGGATGGTGGAGACCATGGG + Intronic
1045495306 8:102703157-102703179 AGCTGGATGTTGGAGTCCACGGG - Intergenic
1046729869 8:117713380-117713402 AGCAGGATGGAGAAGGACGTGGG - Intergenic
1047523481 8:125613566-125613588 AGCGGGAGGTTAATGGCCATTGG - Intergenic
1048411497 8:134178821-134178843 ATCAGAATGTTGAAAGCCAAAGG - Intergenic
1048448320 8:134509713-134509735 TGCAGGATGTTCACGGCCGTGGG + Exonic
1049386254 8:142344489-142344511 AGGCGGATGTTTAAGGCCCTGGG + Intronic
1052267759 9:26594020-26594042 AGCAGAATTTTGAAAGCCACAGG - Intergenic
1052757455 9:32555673-32555695 TGCAGGAGGTTGAATGCCAGAGG - Intronic
1054451687 9:65406715-65406737 GGAAGGATGTTGGAGGCCAATGG - Intergenic
1058852318 9:109024852-109024874 AGCTTTATCTTGAAGGCCATGGG + Intronic
1062286604 9:135775824-135775846 CGCAGGACGCTGAAGGCCTTCGG - Intronic
1186371537 X:8952175-8952197 TTCATGATGTTGGAGGCCATTGG - Intergenic
1186807080 X:13150999-13151021 AGCAGATTGTTGATGGCCAGAGG - Intergenic
1188583582 X:31745362-31745384 GACATCATGTTGAAGGCCATGGG + Intronic
1189111212 X:38291800-38291822 ACCAGGACGTTGTAGGTCATTGG - Intronic
1189546264 X:42045624-42045646 AGCTGGGTGTGGAAGGTCATAGG - Intergenic
1189755814 X:44270366-44270388 AGCAGGGATTTGAGGGCCATGGG - Intronic
1190056889 X:47186307-47186329 AGTCGGATGCTGCAGGCCATGGG + Exonic
1193773106 X:85610998-85611020 AGCAGGTTTTTAAAGGACATTGG - Intergenic
1195994528 X:110718446-110718468 TGCAGGATTCTGAAGGCCATGGG - Intronic
1198184852 X:134243842-134243864 AGCAGTATGTGGAGGGCCACTGG - Intronic
1199268487 X:145855716-145855738 AGCAGAATGTTGAGTGCCAGGGG + Intergenic
1199808645 X:151327526-151327548 GACAAGATGTTGAAGGCCCTTGG + Intergenic
1200142745 X:153909998-153910020 AGGAGGATGGTGAGGGCGATGGG - Exonic
1200905136 Y:8474002-8474024 TGCAGGATTTTTAAGGCCCTTGG + Intergenic
1202329835 Y:23737331-23737353 AGCAGGTTGTTGTAGTCAATAGG - Intergenic
1202540935 Y:25932723-25932745 AGCAGGTTGTTGTAGTCAATAGG + Intergenic